Search

For its future application in 4F2 dynamic random access memory (DRAM) with vertical transistor architecture, it is critical to enhance the thermal stability as well as to reduce specific contact resistivity ( $\rho _{\text {c}}$ ) of CoSi2/n+-Si contacts. In this work, the carbon preamorphization implantation (PAI) method to simultaneously decrease the $\rho _{\text {c}}$ and improve thermal stability of CoSi2 is proposed. The electrical property and morphology of the CoSi2/n+-Si contact with and without carbon PAI are systematically investigated. Compared to the reference without carbon, the samples with carbon PAI achieve a 68.2% reduction in $\rho _{\text {c}}$ , as well as significantly lowered sheet resistance ( ${R}_{\text {s}}$ ) of CoSi2 after high-temperature annealing at $950~^{\circ }$ C/30 s $+ 750~^{\circ }$ C/30 min. These findings manifest the critical role of carbon in reducing $\rho _{\text {c}}$ and enhancing the thermal stability of CoSi2, providing valuable insights for advancing DRAM technology.

Objective: Post-stroke transcranial magnetic stimulation (TMS) has gradually become a brain intervention to assist patients in the recovery of motor function. The long lasting regulatory of TMS may involve the coupling changes between cortex and muscles. However, the effects of multi-day TMS on motor recovery after stroke is unclear. Methods: This study proposed to quantify the effects of three-week TMS on brain activity and muscles movement performance based on a generalized cortico-muscular-cortical network (gCMCN). The gCMCN-based features were further extracted and combined with the partial least squares (PLS) method to predict the Fugl-Meyer of upper extremity (FMUE) in stroke patients, thereby establishing an objective rehabilitation method that can evaluate the positive effects of continuous TMS on motor function. Results: We found that the improvement of motor function after three-week TMS was significantly correlated with the complexity trend of information interaction between hemispheres and the intensity of corticomuscular coupling. In addition, the fitting coefficient (${{\bm{R}}}^2$) for predicted and actual FMUE before and after TMS were 0.856 and 0.963, respectively, suggesting that the gCMCN-based measurement may be a promising method for evaluating the therapeutic effect of TMS. Conclusion: From the perspective of a novel brain-muscles network with dynamic contraction as the entry point, this work quantified TMS-induced connectivity differences while evaluating the potential efficacy of multi-day TMS. Significance: It provides a unique insight for the further application of intervention therapy in the field of brain diseases.

Location-controlled single grains were obtai- ned through amorphous silicon grown on substrates embedded with microstructure called grain filters (GFs) using long-pulse green laser annealing. This work demonstrates the significant influence of GF spacing and size on grain quality. Accomplished results in this work evidenced that defects like grain boundary could be decreased by manipulating the GF spacing and dimensions to achieve high-integrity single grains with large grain sizes, which is beneficial for device fabrication. Thin-film transistors (TFTs) (W/L = 0.18/ $0.22~\mu \text{m}$ ) fabricated on the grains under optimized conditions exhibit excellent electrical performance, with an extracted field-effect mobility of 336 cm2/V-s and an exceptional ${I}_{\text {on}}/{I}_{\text {off}}$ ratio of $5.16\times 10^{{6}}$ .

SiGe/Si multilayer is the core structure of the active area of gate-all-around field-effect transistors and semiconductor quantum computing devices. In this paper, high-quality SiGe/Si multilayers have been grown by a reduced-pressure chemical vapor deposition system. The effects of temperature, pressure, interface processing (dichlorosilane (SiH2Cl2, DCS) and hydrogen chloride (HCl)) on improving the transition thickness of SiGe to Si interfaces were investigated. The interface quality was characterized by transmission electron microscopy/atomic force microscopy/high-resolution X-ray diffraction methods. It was observed that limiting the migration of Ge atoms in the interface was critical for optimizing a sharp interface, and the addition of DCS was found to decrease the interface transition thickness. The change of the interfacial transition layer is not significant in the short treatment time of HCl. When the processing time of HCl is increased, the internal interface is optimized to a certain extent but the corresponding film thickness is also reduced. This study provides technical support for the acquisition of an abrupt interface and will have a very favorable influence on the performance improvement of miniaturized devices in the future.

A special Ge nanowire/nanosheet (NW/NS) p-type vertical sandwich gate-all-around (GAA) field-effect transistor (FET) (Ge NW/NS pVSAFET) with self-aligned high-κ metal gates (HKMGs) is proposed. The Ge pVSAFETs were fabricated by high-quality GeSi/Ge epitaxy, an exclusively developed self-limiting isotropic quasi atomic layer etching (qALE) of Ge selective to both GeSi and the (111) plane, top-drain implantation, and ozone postoxidation (OPO) channel passivation. The Ge pVSAFETs, which have hourglass-shaped (111) channels with the smallest size range from 5 to 20 nm formed by qALE, have reached a record high Ionof ∼291 μA/μm and exhibited good short channel effects (SCEs) control. The integration flow is compatible with mainstream CMOS processes, and Ge pVSAFETs with precise control of gate lengths/channel sizes were obtained.

Caries is considered to be the most prevalent non-communicable disease in humans, mainly deriving from acidogenic bacterial biofilm and resulting in the demineralization and decomposition of hard dental tissue. Herein, a composite responsive foam brace loaded with magnesium organic framework (MPC) is designed for caries prevention and tooth remineralization. MPC can intelligently release organic antibacterial molecules (gallic acid) and mineralized ions (Mg2+, Ca2+and PO43−) under acidic conditions (pH < 5.5) of biofilm infection, regulating pH and killing bacteria. Additionally, due to the excellent photothermal conversion efficiency, MPC can further enhance the destruction of bacterial biofilm by inhibiting virulence genes and destroying bacterial adhesion under near-infrared light irradiation (808 nm). More importantly, MPC can not only reverse the cariogenic environment at both pH and microbial levels, but also promote self-healing of demineralized teeth in terms of both the micro-structure and mechanical properties.

This article provides a comprehensive review of the current state of noninvasive brain imaging and brain stimulation in motor rehabilitation after stroke. The functional organization of the brain is determined by brain network connections. Brain imaging enables us to map the network organization of the brain, so as to assess the motor function in a stroke state. The noninvasive functional imaging techniques include electroencephalography (EEG) and magnetoencephalography (MEG) with the better temporal resolution, and functional magnetic resonance imaging (fMRI) and functional near-infrared spectroscopy (fNIRS) with better spatial resolution. Based on single-mode or multimode imaging methods, the changes of brain networks caused by stroke and during motor recovery progress can be observed. Brain stimulation is an effective way to reorganize brain networks. Transcranial magnetic stimulation (TMS) and transcranial direct current stimulation (tDCS) are the most widely studied noninvasive neuromodulation techniques. Combined with imaging, brain stimulation can alter brain networks in controlled ways and making neuromodulation a closed loop. This review also outlines the methods of facilitate motor rehabilitation: 1) multimode imaging for motor assessment; 2) brain stimulation combined with rehabilitation training; 3) close-loop motor rehabilitation; and 4) influencing factors motor rehabilitation.

In this article, a refined ladder transmission line model (R-LTLM) test structure capable of extracting significantly low specific contact resistivity ( $\rho _{c}$ ) eliminating parasitic metal resistance is proposed. Theoretical derivations, technology computer-aided design (TCAD) simulations, and experiments are performed to verify the validity and superiority of R-LTLM. Compared with refined transmission line model (RTLM) and ladder transmission line model (LTLM), R-LTLM not only achieves higher extraction accuracy than RTLM but also relieves the impact of process variation during the formation of contact area patterns and contact spacings. Moreover, the impacts of process variation on the extraction of $\rho _{c}$ using LTLM and R-LTLM are analyzed. As for experimental verification, RTLM, LTLM, and R-LTLM test structures are fabricated to extract $\rho _{c}$ of TiSix/ $\text{n}^{+}$ -Si Ohmic contacts. Results show that R-LTLM can eliminate parasitic metal resistance, leading to higher extraction accuracy than RTLM.

The greatest challenge in autism spectrum disorder (ASD) detection and treatment arises from the elusive etiological origins and heterogeneity of ASD. ET-EEG correlative analytics refers to correlating simultaneously recorded eye tracking (ET) and electroencephalography (EEG) data or combining them to yield diagnostic biomarkers. This approach was recently applied in ASD research as EEG and video-based ET are suitable for children and do not interfere with each other. It allows researchers to associate neural correlates with gaze patterns in the same cognitive task. Besides, correlative analytics has shed light on the inconsistent findings derived from the unimodal approach, reveals the developmental trajectory of ASD, and provides biomarkers to assist ASD diagnosis or intervention. This review focuses on eight articles applying ET-EEG correlative analytics and synthesized the reported correlation between ET and EEG patterns. Studies concerning such patterns that acquired either ET or EEG data were also reviewed to provide comparisons. In recent years, correlative analytics has also been developed in other research fields, such as visual information processing and EEG artifact correction. Incorporating methodologies used in these research works into ASD studies would help identify cognitive alteration related to a specific visual pattern in naturalistic settings. The opportunities and limitations of this approach in ASD research are discussed at last.

Biofilm-driven caries and tooth discoloration are two major problems in oral health care. The current methods have the disadvantages of insufficient biofilm targeting and irreversible enamel damage. Herein, an injectable sodium alginate hydrogel membrane doped with bismuth oxychloride (Bi12O17Cl2) and cubic cuprous oxide (Cu2O) nanoparticles was designed to simultaneously achieve local tooth whitening and biofilm removal through a photodynamic dental therapy process. This fast cross-linked hydrogel could form a biofilm removal coating on the target tooth surface precisely. Afterward, reactive oxygen species was effectively released on demand under green light, which could not only eradicate the biofilm but also whiten the tooth non-destructively in a facile manner without significant damage to both the enamel and biological cells. After the usage, the removal of this hydrogel can also enhance the effect of biofilm destruction and caries prevention.

Defects induced by the source/drain process have a significant impact on the scattering mechanism of PMOS at cryogenic temperatures. Here, the cryogenic characteristics of FD-SOI devices with heavily doped epitaxial source/drain (Epi FD-SOI devices) and metallic Schottky barrier source/drain (SB FD-SOI devices) were investigated from 300 K down to 6 K. The doping profile along the channel was analyzed by TCAD simulation analysis. Experimental comparison of transistor performance at cryogenic temperatures was carried out for these devices with gate lengths (LG) of 100 nm and 40 nm. The I-Vcharacteristics of the FD-SOI devices were measured with a liquid helium cooling environment. The cryogenic effect of the two types of devices on Key parameters including transconductance (Gm), field effect mobility (μFE), threshold voltage (Vth) and subthreshold slope (SS) were systematically analyzed. The doping distribution of the heavily doped epitaxial SiGe source/drain structure were subjected to more Coulomb scattering at cryogenic temperatures, whereas the doping distribution of the Schottky-barrier source/drain structure dictates that the device is mainly subjected to phonon scattering at cryogenic temperatures.

Nonvolatile logic devices are crucial for the development of logic-in-memory (LiM) technology to build the next-generation non-von Neumann computing architecture. Ferroelectric field-effect transistors (Fe FET) are one of the most promising candidates for LiMs because of high compatibility with mainstream silicon-based complementary metal-oxide semiconductor processes, nonvolatile memory, and low power consumption. However, because of the unipolar characteristics of a Fe FET, a nonlinear XOR or XNOR logic gate function is difficult to realize with a single device. In addition, because single Fe polarization switch modulation is available in the devices, a reconfigurable logic gate usually needs multiple devices to construct and realize fewer logic functions. Here, we introduced polarization-switching (PS) and charge-trapping (CT) effects in a single Fe FET and fabricated a multi-field-effect transistor with bipolar-like characteristics based on advanced 10 nm node fin field-effect transistors (PS-CT FinFET) with 9 nm thick Hf0.5Zr0.5O2films. The special hybrid effects of charge-trapping and polarization-switching enabled eight Boolean logic functions with a single PS-CT FinFET and 16 Boolean logic functions with two complementary PS-CT FinFETs were obtained with three operations. Furthermore, reconfigurable full 1 bit adder and subtractor functions were demonstrated by connecting only two n-type and two p-type PS-CT FinFET devices, indicating that the technology was promising for LiM applications.

An alternative process of Pd-catalyzed C-4 selective coupling of 2,4-dichloropyridines with boronic esters was developed, which afforded 24 examples of C-4 coupled pyridines in moderate to good yields. After further arylation, 21 examples of C-2, C-4 diarylated pyridines with a significant photophysical property were obtained, which were applied as pyridine-based dyes into live-cell imaging with good biocompatibility and low toxicity.

A new type of vertical sandwich gate-all around tunneling field-effect-transistors (TFETs), called VSATFETs, was demonstrated firstly with a CMOS-compatible process. The VSATFETs with self-aligned high-κ metal gates (HKMG) and abrupt doping tunneling junctions were fabricated with the epitaxial of p+−Si/i-SiGe/n+−Si sandwich structure and an isotropic quasi-atomic layer-etch (qALE) process. VSATFETs have the advantage of excellent control of channel size, because its gate-length is mainly determined by the thickness of SiGe film grown by epitaxy, and the diameter of the nanowires (NWs)/thickness of nanosheets (NSs) is determined by the qALE etching of SiGe selective to Si. A NW VSATFET with a diameter of 18 nm was fabricated and exhibits excellent characteristics: SSmin= 61.64 mV dec−1, Ion= 2.25 × 10−7A u−1m−1(@Vgs−Vt= 0.45 V, Vd= 0.65 V), Ion/Ioff= 1.81 × 106, DIBL = 7.58 mV. The effect of interface traps on the device performance was analyzed by the calibrated model. It is found that the device performance can be improved by decreasing the thickness/diameter of NS/NW TFET.

By employing a 355-nm nanosecond (ns) ultraviolet (UV) laser annealing, the impact of fluorine (F) co-doping on the formation of a highly activated N-type shallow junction in germanium (Ge) is investigated. Secondary ion mass spectrometry (SIMS) depth profiling of phosphorus (P) demonstrated that an ultra high P concentration of 9 × 1020cm−3at a shallow junction of 55 nm with less dopant diffusion can be obtained using ns laser annealing. F co-doping was confirmed to be an efficient way to improve the activation of the P dopants, but show less influence on the redistribution of P dopants within the NLA melted region. However, the activation level of the shallow junction could be increased to approximately 1 × 1020cm−3in the presence of F at an optimized concentration.

We develop a method to fabricate an undoped Ge quantum well (QW) under a 32 nm relaxed Si0.2Ge0.8shallow barrier. The bottom barrier contains Si0.2Ge0.8(650 °C) and Si0.1Ge0.9(800 °C) such that variation of Ge content forms a sharp interface that can suppress the threading dislocation density (TDD) penetrating into the undoped Ge quantum well. The SiGe barrier introduces enough in-plane parallel strain (ε∥strain −0.41%) in the Ge quantum well. The heterostructure field-effect transistors with a shallow buried channel obtain an ultrahigh two-dimensional hole gas (2DHG) mobility over 2 × 106cm2/(V s) and a very low percolation density of (5.689 ± 0.062) × 1010cm–2. The fractional indication is also observed at high density and high magnetic fields. This strained germanium as a noise mitigation material provides a platform for integration of quantum computation with a long coherence time and fast all-electrical manipulation.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

An overview is given on the status of n‐type dopant activation and diffusion in Ge, based on a standard ion implantation and annealing scheme. Emphasis is on defect engineering approaches to optimize either or both parameters. A detailed discussion is given on the use of co‐implantation by neutral or other n‐type dopants. As a case study, the impact of the C ion implantation energy and dose on n‐type junctions in p‐Ge by P + C co‐implantation will be given. It is demonstrated that for fixed P implant conditions, there exist an optimum energy and dose for achieving a minimum junction depth by the formation of C–PV complexes. An alternative approach is the use of self‐interstitial management at the end‐of‐range of the P implantation. Finally, an overview is given of alternatives for obtaining shallow, highly activated n‐type junctions in Ge. They rely on: non‐standard implantation schemes, ultra‐short annealing methods or relying on in situdoped epitaxial deposition. In case you want to find out the latest in n‐type doping in Ge and what co‐implantation or end‐of‐range damage management can do for you, please have a look at this review. In addition, alternative doping and activation annealing strategies are highlighted.

In this work, the manipulation of phosphorus diffusion as well as the reduction of the specific contact resistivity in Ge by carbon co-doping is explored. It is found that there is an optimum condition for carbon implantation to suppress the rapid P diffusion effectively. For such a condition, the implanted carbon sits at the half range of the pre-amorphized Ge layer. In this case, both the diffusion of P in the amorphous layer and in the Ge virtual substrate beyond the amorphous/crystal (a/c) interface can be effectively manipulated. Except the control of P diffusion, the specific contact resistivity (rc) between as-formed NiGe and the Ge substrate in the presence of C can be also reduced, compared with the reference without C. At 500degC germanidation temperature,the rc values are reduced from 1.1x10-4 O-cm2 and 2.9x10-5 O-cm2 for NiGe/n- and p-Ge contacts without carbon to 7.3x10-5 O-cm2 and 1.4x10-5 O-cm2 for their counterparts with carbon, respectively.

In this study, the process integration of SiGe selective epitaxy on source/drain and SiGe/Ge bilayers selectively epitaxy on replacement Si channel regions for 14 nm node FinFETs has been presented. The epi-quality, layer profile and strain amount of the selectively grown SiGe and Ge layers were also investigated by means of various characterization tools. A series of prebaking experiments were performed for different temperatures in order to in-situ clean the Si fins prior to the SiGe S/D epitaxy. It was also found that a SiGe layer with graded Ge content was deposited as the strain relaxed buffer (SRB) layer in the channel trench prior to the Ge layer filling in the small trenches to make the void defect free.

A highly efficient and selective oxidative condensation–hydrogenation process of renewable furfural with aliphatic alcohols catalyzed by metallic platinum in a one-pot reactor is developed. A series of supported platinum catalysts including Pt/FH, Pt/H, Pt/HT, Pt/Fe3O4, Pt/Al2O3and Pt/ZrO2are prepared and employed for the polarization of furfural in ethanol and n-propanol. It is found that, in the presence of Pt/FH and potassium carbonate, 93.9% conversion of furfural and 67.9% selectivity to furan-2-acrolein were obtained viaoxidative condensation in the furfural–ethanol–O2(FEO) system, and 90.1% conversion of furfural and 90% selectivity to 3-(furan-2-yl-)-2-methylacrylaldehyde were obtained viaoxidative condensation in the furfural–n-propanol–O2(FPO) system. Moreover, the oxygen in the FPO system is completely replaced by molecular hydrogen to allow the further conversion of 3-(furan-2-yl-)-2-methylacrylaldehyde, while the catalytic system was kept unchanged. During this process, 87.3% conversion of 3-(furan-2-yl-)-2-methylacrylaldehyde and 73.2% selectivity to 3-(furan-2-yl-)-2-methylpropanol were obtained viaa hydrogenation reaction with the Pt/FH catalyst. Moreover, several common bases as promoters were investigated in detail. All the catalysts were characterized by XRD, TEM, SEM, TPD and BET methods to reveal their catalytic nature in the reaction.

In this work, a comparative study of Ga, Ge+B, and Ga+B ion-implantation (I/I) is reported to improve the specific contact resistivity (ρc) on p-type Ge. It is found that Ga I/I shows superiority for shallow source/drain (S/D) junctions doping over Ge+B I/I and Ga+B I/I in terms of activation (Na), junction depth (Xj), and ρc; whereas for contact surface doping, Ge+B I/I and Ga+B I/I demonstrate advantage over Ga I/I owing to less dose loss in NiGe and more robust B segregation at the NiGe/Ge interface. Using a combination of Ga I/I and Ge+B I/I for shallow S/D junctions and contact surface doping respectively, an ultralow ρcof 2.7 × 10−9Ω-cm2is achieved on p-type Ge.

In this paper, in order to improve the driving ability of vertically-stacked gate-all-around (GAA) Si nanosheets (NSs) devices, a high-efficiency hybrid pattern technique with the SiNx spacer-image transfer (SIT) and conventional photolithography pattern was proposed and implemented to form size-enlarged landing pads (LPs) on nanscale fins at the same time, which increase the volumes of electrical conductance pathway between NS channels and source and drain (SD) electrodes with high process efficiency and compatibility with traditional mass production technology. Due to introduced new structures, the parasitic resistance of the devices is reduced by 99.8% compared with those of w./o. LPs. Therefore, ∼3 times and ∼2 times driving current enhancements for 500 nm gate length n-type and p-type MOSFETs are obtained, respectively. The results indicate the proposed GAA NS FET fabrication process with LPs by high-efficiency hybrid pattern technique a promising solution for improving the device driving ability for stacked GAA Si NSs devices in future.

Polyphosphazene, as a precursor, was synthesized by ultrasonication using 4,4-diaminodiphenyl ether and hexachlorocyclotriphosphazene (HCCP). It was carbonized and functionalized at high temperature to obtain carboxylic acid functionalized N, P co-doped carbon materials (denoted as NPCs-COOH). The structure of NPCs-COOH was characterized by Fourier Transform Infrared Spectroscopy (FTIR), Scanning Electron Microscopy (SEM), X-ray photoelectron spectroscopy (XPS), X-ray diffractometry (XRD), Raman spectrometry (Raman), Thermogravimetric analysis (TG) and N2adsorption-desorption isotherm (BET). The electrosorption properties were explored under different pH values, applied potentials, initial concentrations and contact time. The optimal pH for electrosorption was 5.0 while the equilibrium time was 30 min. The maximum electrosorption capacity from the experiments towards U(VI) was about 551.46 mg g?1under the most suitable applied potential of 0.9 V, which was much higher than other carbon materials. Meanwhile, it also showed excellent recyclability with a 23.3% reduction of electrosorption capacity after six cycles. A plausible mechanism of electrosorption was presented using XPS analysis. The results showed the N, P co-doped NPCs-COOH can be used in the electrosorption field to remove U(VI) effectively in solution.

A tandem cyclization between 2-(2-aminophenyl)acetonitriles and 2-(hydroxy(aryl)methyl)phenols for the preparation of dihydrochromeno[2,3-b]indole derivatives was successfully developed. The transformation proceeded smoothly in the presence of a catalytic environmentally benign iron salt, and various multisubstituted dihydrochromeno[2,3-b]indoles were synthesized in moderate to high yields.

Transparent wood (TW), as a promising structural material, has attracted considerable attention owing to the high transmittance, excellent toughness, outstanding modulus and mechanical strength. Despite the encouraging achievements on TW materials have been made, their widespread applications are still restricted by the intrinsic flammability. Herein, in this work, a flame-retardant TW/polyimide (FRTW/PI) composite has been prepared by successfully impregnating polyimide into delignified porous wood template. As expected, the FRTW/PI composite maintains good self-extinguishing properties after leaving the fire source within 2 s. Additionally, the FRTW/PI composite exhibits an enhanced mechanical strength of 169 MPa, which is 42 times higher than that of natural wood (NW) and much higher than other previously reported values. This work put forwards an effective approach for the fabrication of FRTW/PI composite and holds a great promise as colored glass for future buildings.

The effects of carbon on improving the thermal stability of relatively thick NiGe films were manifested in previous work. How this thermal stability can be maintained for ultrathin NiGe films i.e. below 10 nm thickness, is, however, still unknown and deserves to be explored. In this work, the effects of carbon Pre-Germanidation Implantation (PGI) on the thermal stability of ultrathin NiGe films below 10 nm thickness were systematically studied. For different thicknesses of Ni layers, as-prepared NiGe films with carbon PGI were characterized by beans of sheet resistance measurement, X-ray diffraction (XRD), scanning electron microscopy (SEM) and secondary ion mass spectroscopy (SIMS). The presence of carbon is proved to be still effective in enhancing the thermal stability of ultrathin NiGe films by ?200 °C compared to the counterparts without C. The homogeneously distributed C at NiGe grain boundaries and C peak at the NiGe/Ge interface is responsible for such a distinguished improved thermal stability.

In this work, the manipulation of phosphorus diffusion as well as the reduction of the specific contact resistivity in Ge by carbon co-doping is explored. It is found that there is an optimum condition for carbon implantation to suppress the rapid P diffusion effectively. For such a condition, the implanted carbon sits at the half range of the pre-amorphized Ge layer. In this case, both the diffusion of P in the amorphous layer and in the Ge virtual substrate beyond the amorphous/crystal (a/c) interface can be effectively manipulated. Except the control of P diffusion, the specific contact resistivity (ρc) between as-formed NiGe and the Ge substrate in the presence of C can be also reduced, compared with the reference without C. At 500°C germanidation temperature,the ρc values are reduced from 1.1x10-4Ω-cm2and 2.9x10-5Ω-cm2for NiGe/n- and p-Ge contacts without carbon to 7.3x10-5Ω-cm2and 1.4x10-5Ω-cm2for their counterparts with carbon, respectively.

In this study, the process integration of SiGe selective epitaxy on source/drain and SiGe/Ge bilayers selectively epitaxy on replacement Si channel regions for 14 nm node FinFETs has been presented. The epi-quality, layer profile and strain amount of the selectively grown SiGe and Ge layers were also investigated by means of various characterization tools. A series of prebaking experiments were performed for different temperatures in order to in-situ clean the Si fins prior to the SiGe S/D epitaxy. It was also found that a SiGe layer with graded Ge content was deposited as the strain relaxed buffer (SRB) layer in the channel trench prior to the Ge layer filling in the small trenches to make the void defect free.

Achieving large on-state current at low power supply voltage is one great challenge for tunneling transistors (TFETs). In this paper, an N-type Green transistor (gFET) with an ultra-shallow pocket junction has been fabricated. The main feature of the device is that the pocket junction was formed by germanium (Ge) preamorphization implantation (PAI) plus arsenic (As) ultra-low energy implantation combined with spike annealing. The Ge PAI can form a Si1-xGex/Si heterojunction in the N+pocket region. Combined with a heavily doped N+pocket, it can realize an abrupt tunnel junction between N+pocket and P+source, which is helpful to increase the tunneling probability and get higher on-state current. The fabricated gFET exhibits good electrical characteristics. The device’s on-state current is up to 215µA/µm (@VDS=VGS=2V).

HfLaON is one of the most promising high-k dielectrics because of its higher crystallization temperature and ability to tune the work function of the metal gates from Si midgap to around 4eV, meeting the requirement of nMOSFETs. In this paper, HfLaON was prepared using reactive sputtering that alternates between Hf and HfLa targets in N2/Ar ambient, followed by a post-deposition anneal. Before deposition of HfLaON film, SiO2interfacial layer was grown to improve the interface properties. HfLaON/SiO2gate stack exhibited good physical and electrical characteristics, including good thermal stability, excellent interface properties, small equivalent oxide thickness and low gate-leakage current. Further studies found that the excellent characteristics of the gate stack have close relation to the grown method of SiO2 interfacial layer. In order to investigate their relationship, the different grown methods of SiO2 interfacial layer were adopted and compared in the fabrication of HfLaON/SiO2gate stacks, such as oxidation in O3/H2O solution, rapid thermal anneal in N2or N2/O2mixed gas.

The thirty‐six examples of the title reaction demonstrate the high functional group tolerance of the presented protocol.