Search

Giraffa giraffa (Boddaert, 1784) Diagnosis Anterior horn rudimentary, shanks coloured and fully spotted, three ES in the C1orf74 intron: 24 A=>T, 33 A=>G, 825 C=> G; three ES in the DHX36 intron: 127 G =>A, 449 dAT, 498 A=>G; one ES in the IGF2B1 intron: 45 G =>A; one ES in the UBN2 intron: 386 dTCT; six ES in the USP33 intron: 267 G =>A, 279 T=>C, 309 dAA, 538 G =>T, 805 A=>G, 928 G =>A. Type material examined Neotype (here designated) NAMIBIA • 1 specimen (mounted skeleton), “Giraffe of Levaillant”; North of the Orange river; MNHN-A7977. Distribution Angola, Botswana, Mozambique, Namibia (neotype), South Africa, Zambia, Zimbabwe. Remarks No concrete holotype specimen assigned, as specimens of the Prince of Orange Museum in The Hague and the giraffe of Vosmaer (1787) from the Naturalis museum in Leiden (Netherlands) are ʻwhereabouts unknownʼ., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Boddaert P. 1784. Camelopardalis giraffa. Elenchus Animalium Vol. 1: Systems Quadrupedia. C. R. Hake, Rotterdam.","Vosmaer A. 1787. Description du chameau-leopard (Camelopardalis). P. Meyer and G. Warners, Amsterdam."]}

Giraffa camelopardalis senegalensis Petzold, Magnant & Hassanin, subsp. nov. urn:lsid:zoobank.org:act: 838C1DB1-59BA-49DD-B5AA-F5432F36B112 Diagnosis Beige ground colour covered with dark brown spots following a reticulated pattern separated by narrow lines, skull features detailed in Blainville (1864), one ES in the Cytb gene: 732 A=> G; four ES in the CR: 92 dC, 95 A=>G, 359 C =>T, 463 A=>G. Type material examined Holotype (here designated) SENEGAL • 1 specimen (skeleton); Bakel; MNHN-A10617. Past distribution Probably extinct, former range extended over Senegal (holotype) and potentially Gambia, Mauritania and Mali.

Giraffa giraffa giraffa (Boddaert, 1784) Camelopardalis australis Swainson, 1835: 284. Camelopardalis capensis Lesson, 1842: 168. Camelopardalis maculata Weinland, 1863: 205, fig. p. 206. Giraffa camelopardalis angolensis Lydekker, 1903: 121, fig. p. 121. Diagnosis One ES in the Cytb gene: 798 T=>C; two ES in the CR: 130 iT, 170 A=>G. Distribution Angola, Botswana, Namibia, Zimbabwe., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Boddaert P. 1784. Camelopardalis giraffa. Elenchus Animalium Vol. 1: Systems Quadrupedia. C. R. Hake, Rotterdam.","Swainson W. 1835. A Treatise on the Geography and Classification of Animals. Green Longman, London. https: // doi. org / 10.5962 / bhl. title. 25975","Lesson R. P. 1842. Nouveau tableau du Regne animal: Mammiferes. Arthus Bertrand, Paris.","Weinland D. F. 1863. Zur Erinnerung an unsere Giraffe. Zoologischer Garten 4: 204 - 207.","Lydekker R. 1903. Local variation in the Giraffe. In: Animal Life and the World of Nature. Vol. 2: 78 - 84. Hutchinson & Co, London."]}

Giraffa camelopardalis peralta Thomas, 1898 Diagnosis Elongated skull, large spatulate nasal opening, vertically upright direction of the ossicones, fawncoloured patch below the ears, white sparsely spotted occipital region; two ES in the Cytb gene: 219 C=>T, 1080 C=>T, and one ES in the CR: 23 A=> G. Type material Holotype NIGERIA • 1 specimen (skull and bones of right fore and left hind limb); Lokoja; NHMUK-1898.2.18.1. Distribution Niger. Remarks The type locality has originally been assigned to the junction between the Niger and Benue rivers in Nigeria, but it was corrected in this study to Lokoja (Nigeria) north of the confluence of the Niger and Benue rivers in accordance with Happold (1969)., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on pages 22-23, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Thomas O. 1898. On a new subspecies of giraffe from Nigeria. Proceedings Zoological Society London 1898: 39 - 41.","Happold D. C. D. 1969. The present distribution and status of the giraffe in West Africa. Mammalia 33 (3): 516 - 521. https: // doi. org / 10.1515 / mamm. 1969.33.3.516"]}

Giraffa camelopardalis senegalensis Petzold, Magnant & Hassanin, subsp. nov. urn:lsid:zoobank.org:act: 838C1DB1-59BA-49DD-B5AA-F5432F36B112 Diagnosis Beige ground colour covered with dark brown spots following a reticulated pattern separated by narrow lines, skull features detailed in Blainville (1864), one ES in the Cytb gene: 732 A=> G; four ES in the CR: 92 dC, 95 A=>G, 359 C =>T, 463 A=>G. Type material examined Holotype (here designated) SENEGAL ��� 1 specimen (skeleton); Bakel; MNHN-A10617. Past distribution Probably extinct, former range extended over Senegal (holotype) and potentially Gambia, Mauritania and Mali., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["de Blainville H. M. D. 1864. Osteographie: ou, Description iconographique comparee du Squelette et du Systeme dentaire des Mammiferes recents et fossiles pour servir de base a la Zoologie et a la Geologie. Vol. 4: Quaternates. JB Bailliere et fils, Paris."]}

Giraffa giraffa wardi Lydekker, 1904 Giraffa infumata Noack, 1903: 356. Diagnosis Irregular spots, spots on the side of the face restricted to the region below and behind the eyes, two ES in the Cytb gene: 634 C=>T, 705 A=>G. Type material Holotype SOUTH AFRICA • 1 specimen (mounted head and neck); NHMUK-1903.11.18.1. Distribution Botswana, Mozambique, South Africa (holotype), Zambia, Zimbabwe. Remarks The holotype is given by Lydekker (1914) under the collection number NHMUK - 1903.11.18.1, but this catalogue number leads to a fish specimen (Pomatomus telescopus Risso, 1810) on the collection website (https://data.nhm.ac.uk/dataset/collection-specimens/resource/05ff2255-c38a-40c9-b657- 4ccb55ab2feb/record/3124756). However, two other specimens of wardi can be found in the museum collection (NHMUK-1903.11.17.1 and NHMUK-1903.11.17.3), one of which might be considered the neotype if the holotype cannot be found., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 26, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Lydekker R. 1904. On the Subspecies of Giraffa camelopardalis. Proceedings of the Zoological Society of London 74: 202 - 227. https: // doi. org / 10.1111 / j. 1469 - 7998.1904. tb 08288. x","Lydekker R. 1914. Catalogue of the Ungulate Mammals in the British Museum. British Museum, London."]}

Giraffa tippelskirchi Matschie, 1898 Diagnosis Faint or strongly stellate form of the patches, absence of occipital horns, seven ES in the UBN2 intron: 48 dA, 209 iCATAATATATTTAATATATTTAATATTTAATAA, 243 T=>A, 318 G =>C, 332 T=>G, 504 A=> C, 623 C=>T Type material Lectotype (here designated) TANZANIA • 1 specimen (skull and skin); Lake Eyasi; ZMB-084951. Distribution Kenya, Tanzania (lectotype), Zambia. Remarks Matschie (1898) mentions two different specimens as syntypes, but the second cannot be found in the collection catalogue and might be considered as lost., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669

Giraffa camelopardalis rothschildi Lydekker, 1903 Diagnosis Lower parts of the legs pure white and unspotted, spots show a tendency to split up into stars, occipital pair of ossicones, one ES in the CR: 129 T=> C. Type material Holotype KENYA • 1 specimen (mounted skin); Guasin-gisha Plateau east of Mount Elgon; NHMUK-1903.4.15.1. Distribution Western Ethiopia, Kenya (holotype), Uganda, South Sudan., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 23, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Lydekker R. 1903. Local variation in the Giraffe. In: Animal Life and the World of Nature. Vol. 2: 78 - 84. Hutchinson & Co, London."]}

Giraffa tippelskirchi tippelskirchi Matschie, 1898 Giraffa schillingsi Matschie, 1898: 79. Diagnosis Stellate formed spots, shanks olive-coloured and spotted down to the hoofs, anterior horn less developed, one ES in the Cytb gene: 1033 C=>T. Distribution Southern Kenya, Tanzania., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669

Giraffa camelopardalis (Linnaeus, 1758) Diagnosis Shanks white, presence of occipital horns, five ES in the Cytb gene: 186 A=> G, 288 G =>A, 333 A=>G, 597 C=>T, 924 C=>T; one ES in the CR: 462 A=>G; two ES in the CTAGE5 intron: 570 T=> C, 705 C=> G; two ES in the CWF19L1 intron: 263 T=> G, 264 T=> G; one ES in the DDX1 intron: 268 dACAT; one ES in the DHX36 intron: 50 iGTT; two ES in the SOS1 intron: 103 T=>C, 118 G=>A. Type material examined Neotype (here designated) ETHIOPIA • 1 specimen (skin and complete skeleton); Abyssinia; MHNT-1996.121.2. Other specimens ETHIOPIA • 1 specimen (skull and skeleton parts); Abyssinia; MNHN-A8012. SUDAN • 1 specimen (skull), “Zarafa”; Sennar; MNHN-1845-211. Distribution Niger, Chad, Cameroon, Central African Republic, Democratic Republic of Congo, South Sudan (holotype), Uganda, Somalia, Ethiopia (neotype), Kenya. Remarks The holotype designation was based on a living giraffe illustrated by Belon du Mans (1553), which was not sampled for a museum collection. The neotype herein designated represents the most complete specimen (skin and complete skeleton) and has been the first giraffe to be dissected, providing several anatomical drawings (see Joly & Lavocat 1845)., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on pages 21-22, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Linnaeus C. 1758. Systema Naturae per Regna Tria Naturae. Editio decima reformata, Tomus I. Regnum Animale. Laurentius Salvius, Stockholm.","Belon du Mans P. 1553. Les Observations de plusieurs Singularitez et Choses memorables trouvees en Grece, Asie, Iudee, Egypte, Arabie et autres Pays estranges. Corrozet et Canellat, Paris. https: // doi. org / 10.5962 / bhl. title. 127374","Joly N. & Lavocat A. 1845. Recherches historiques, zoologiques, anatomiques et paleontologiques sur la Giraffe (Camelopardalis giraffa, Gmelin). V. Berger-Levrault, Boulogne-Billancourt."]}

Giraffa tippelskirchi thornicrofti Lydekker, 1911 Diagnosis Low and conical anterior horn, grey colour and scattered spotting of the sides of the face, fawn shanks, three ES in the CR: 39 A=>G, 272 T=>C, 336 T=>A; two ES in the IGF2B1 intron: 60 C=>T, 304 G =>A. Type material Holotype ZAMBIA • 1 specimen (skin); Petauke district; NHMUK-1910.10.17.1. Distribution Luangwa Valley in Zambia., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Lydekker R. 1911. Two undescribed giraffes. Nature 87: 484. https: // doi. org / 10.1038 / 087484 c 0"]}

Giraffa camelopardalis camelopardalis (Linnaeus, 1758) Camelopardalis aethiopicus Ogilby, 1837: 134. Camelopardalis biturigum Duvernoy, 1844: 12, fig. 4. Giraffa camelopardalis typica Bryden, 1899: 489, plate XIV. Diagnosis Front of the face sparsely and sides fully spotted, similar pattern to reticulata but with chestnut or sandy patches. Past distribution Probably extinct, former range between the Blue Nile and Tekezé /Atbara rivers in southeastern Sudan (eastern Sennar) and northern Ethiopia (Abyssinia)., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 22, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Linnaeus C. 1758. Systema Naturae per Regna Tria Naturae. Editio decima reformata, Tomus I. Regnum Animale. Laurentius Salvius, Stockholm.","Ogilby W. 1837. On the generic characters of ruminants. Proceedings of the Zoological Society of London 1836: 131 - 139.","Duvernoy M. 1844. Sur une machoire de girafe fossile decouverte a Issoudun. Notes communiques au L'Academie de Science, 1843.","Bryden H. A. 1899. Great and Small Game of Africa: An Account of the Distribution, Habits, and Natural History of the Sporting Mammals, with Personal Hunting Experiences. R. Ward, London."]}

Giraffa camelopardalis antiquorum (Jardine, 1835) Giraffa camelopardalis sennaariensis Trouessart, 1898: p.902. Giraffa camelopardalis congoensis Lydekker, 1903: 386. Giraffa camelopardalis cottoni Lydekker, 1904: 207, fig. 1. Diagnosis Spots on the upper part of the fore-limbs and the thighs broken up in a number of very small and irregular ones. Type material Holotype SUDAN • 1 ♂ (skull and tanned skin of a male giraffe); South of Darfur; SMF-498. Paratype SUDAN • 1 ♀ (skull and tanned skin of a female giraffe); South of Darfur; SMF-497. Distribution Cameroon, Chad, Central African Republic, Democratic Republic of Congo, South Sudan (holotype). Remarks The holotype designation was based on the information provided by Rüppel (1826), who collected two specimens in North Africa. Both specimens can be meanwhile found in the collection of the Senckenberg Museum Frankfurt (Germany) listed as SMF-498 (skull and tanned skin, male): unspecified type and SMF-497 (skull and tanned skin, female): paratype., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 22, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Jardine W. 1835. The Natural History of the Ruminating Animals, containing Deer, Antilopes, Camels & c. W. H. Lizars, Edinburgh. https: // doi. org / 10.5962 / bhl. title. 131528","Trouessart L. 1898. Catalogus Mammalium tam viventium quam fossilium. Vol. 4: Tillodontia et Ungulata. Freidlander, Berlin. https: // doi. org / 10.5962 / bhl. title. 130824","Lydekker R. 1903. Local variation in the Giraffe. In: Animal Life and the World of Nature. Vol. 2: 78 - 84. Hutchinson & Co, London.","Lydekker R. 1904. On the Subspecies of Giraffa camelopardalis. Proceedings of the Zoological Society of London 74: 202 - 227. https: // doi. org / 10.1111 / j. 1469 - 7998.1904. tb 08288. x"]}

8 pages; International audience; Evolutionary theories of ageing posit that increased reproductive investment occurs at the expense of physiological declines in later life. Males typically invest heavily in costly sexual ornaments and behaviour, but evidence that the expression of these traits can cause senescence is lacking. Long-lived houbara bustards (Chlamydotis undulata) engage in extravagant sexual displays to attract mates and here we show that males investing most in these displays experience a rapid senescent deterioration of spermatogenic function at a younger age. This effect is sufficiently large that the expected links between male 'showiness' and fertility reverse in later life, despite 'showy' males continuing to display at near maximal levels. We show that our results cannot be explained by the selective disappearance of competitive phenotypes and that they are instead consistent with an early vs. late life trade-off in male reproductive competence, highlighting the potential significance of sexual selection in explaining rates of ageing.

National audience

International audience; Quails issued of migrant parents show a large variability of their reproductive phenotypes when exposed in captivity to a winter Sahelian photoperiod (16º lat. N.). Fifteen per cent of these females lay spontaneously in December and/or January; 75% before late April. In order to evaluate the possibility of this sexual precocity in natural conditions, we have measured the gonadal development and other sexual characteristics: song, cloacal development, pair formation of the European quail (Coturnix c. coturnix) populations wintering in the alluvial plains in the Centre (39-40º lat. N.) of Portugal. The study was based on samples of birds shot there during the hunting seasons (September to December) of 1991, 1992, 1993 and 1994 (n=149). Results indicate that these wintering populations are starting their sexual development in late autumn. Importance and chronology of this sexual precocity seem to be related with sex: males were sexually more advanced than females. Distinct results were obtained in different years and stations according to weather conditions (temperature): in December 1992 (cold winter) only 38% of the birds analyzed in the coastal stations showed a beginning of sexual development, in contrast with 88% observed in December 1994. A large proportion (46% males, 51% females) of the birds shot on coastal stations (any frozen day) showed signs of sexual precocity (more than 100 mg of gonadal weight). Only a few birds were concerned the same year in colder interior stations of Centre Portugal as Guadiana basin (0% males and 18% females). Comparision with previous results obtained for Morocco and Portugal allows us to say that the European quail seasonal cycles are similar in both North African and Iberian areas. Those wintering birds, probably "short migrants", are precocious March breeders, which means that in mild winter, they can initialize their sexual development as early as December.These results justify the need of a wise protection of the quail present in December in some Portuguese agrosystems. Such conservative measures could have interesting consequences on the kinetics of all the Atlantic quail population.