Search

The widespread presence of multidrug-resistant pathogenic microorganisms challenges the development of novel chemotype antimicrobials, insensitive to microbial tools of resistance. To date, various monoterpenoids have been shown as potential antimicrobials. Among many classes of molecules with antimicrobial activity, terpenes and terpenoids are an attractive basis for the design of antimicrobials because of their low toxicity and availability for various modifications. In this work, we report on the synthesis of sulfenimines from chiral trifluoromethylated and non-fluorinated pinane-type thiols. Final compounds were obtained with yields of up to 81%. Among the 13 sulfenimines obtained, 3 compounds were able to repress the growth of both bacteria (S. aureus, both MSSA and MRSA; P. aeruginosa) and fungi (C. albicans) with an MIC of 8–32 µg/mL. Although compounds exhibited relatively high cytotoxicity (the therapeutic index of 3), their chemotype can be used as a starter point for the development of disinfectants and antiseptics for targeting multidrug-resistant pathogens.

Annotation. Markers of vascular damage constitute highly informative substances in coronary heart disease, which allows not only assessing the state of endothelial function of the arteries, but also to predict the further course of cardiovascular pathology. The purpose of the study was to analyse changes in laboratory markers of vascular lesions under the influence of different tactical, diagnostic, and interventional approaches in patients with myocardial infarction with stable elevation of the ST segment in the presence of multivascular lesions. The study included patients who were randomly divided into 4 observation groups depending on the diagnostic and treatment tactics. The obtained results were compared with similar ones in healthy people. Studies of markers of vascular endothelial function were performed on the 1st day of infarction, on day 3-4, and a year later. Statistical data processing was performed using a package of licensed software for statistical analysis “Statistica 6.0”. An odd Student’s t test (t) was used to compare quantitative parameters between independent samples, and a χ2 criterion was used for qualitative samples at a significance level of p

The purpose of the work. Despite some progress, the creation of transgenic pigs remains a long and inefficient process. One of the key points in the transfection of porcine generative cells is determining the event of the internalization of foreign DNA by cells. The methods currently used to determine the event of the internalization of foreign DNA by cells do not take into account the possibility of the presence of foreign DNA on the surface of sperm, even after washing from the culture medium. With this in mind, the purpose of this work is to develop a method for confirming the transfection of sperm with plasmid DNA. Materials and methods of research. Sperm were washed four times with GCCS diluent. Sperm transfection was carried out in 0.6 ml polypropylene tubes with a lid in a volume of 50 μl of a suspension of protein-washed sperm in GCCS with a sperm concentration of 100 million/ml. To 50 μl of the suspension of washed sperm from proteins it was added 10 μl of the ring form of plasmid pET-28c (Novagen, France). Sperm were incubated in a thermostat at 37.7°C for two hours. Incubated sperm were stored at -20°C. To isolate DNA, 60 μl of a suspension of washed sperm from proteins with plasmid pET-28c was transferred to 1.5 ml of a polypropylene tube with a lid and centrifuged for 5 min under conditions of 12 thousand vol. min, then 35 μl of supernatant was transferred into a clean 1.5 ml tube leaving at the bottom of approximately 25 μl of liquid with sediment. Isolation of DNA from the supernatant: In a 1.5 ml tube containing 35 μl of supernatant, 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 were added to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing the DNA of plasmid pET-28c was transferred to a clean 0.6 ml tube with a lid and stored at -20°C. Isolation of DNA from the precipitate: To the precipitate it was added 100 μl of TE buffer and 2 μl of Proteinase K (20 mg/ml) and kept for 1.5 h at +56°C. After 5 minutes of centrifugation under conditions of 12 thousand vol. min the supernatant was removed, then to the precipitate was added 100 μl of TE buffer. The procedure of washing with TE buffer was repeated twice. To the purified precipitate it was added 7 μl of dithiothreitol (DTT), 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid-state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing boar sperm DNA was transferred to a clean 0.6 ml tube with a lid and stored at -20°C. The amplification was performed on a programmable thermostat TERTSIK-2 (DNA Technology, Russia). Oligonucleotide primers for the amplification of pET-28c DNA had the following structure: T7 promoter – TAATACGACTCACTATAGGG, T7 terminator – CGCTGAGCAATAACTAGC. This pair of oligonucleotide primers allows to obtain a PCR product with a size of 314 b.p. Tubes with PCR products were stored at -20°C. The specificity of the PCR products was checked by 2% agarose gel electrophoresis in 1 × Tris-borate electrode buffer (TBE) for 2 h at a current of 50 mA in a horizontal electrophoretic chamber (Cleaver Scientific Ltd., UK). DNA of plasmid pUC19 hydrolyzed by Msp I endonuclease was used as a molecular weight marker. After electrophoresis, the gel was stained with ethidium bromide solution (10 mg / cm3), and the results of electrophoresis were photographed using a gel documentation system (Cleaver Scientific Ltd., UK). Research results. The amplification of DNA of plasmid pET-28c, which was isolated using differential lysis, allowed to obtain a PCR product with a size of 314 b.p. The size of the PCR product using oligonucleotide primers (T7promoter/T7terminator) was as expected. Thus, evidence was obtained that plasmid DNA can enter sperm. Conclusions. The time required to isolate DNA using differential lysis depends on the qualifications of the staff and the amount of researches and averages 5–6 hours. This method of DNA isolation does not require the complex equipment and significant costs for reagents, but fertilization of eggs with sperm with a confirmed transfection event will save in the next stages of transfection.

The article is aimed at researching the status of the Ukrainian accounting services market; allocating the features, advantages and disadvantages of the existing models of organization of providing accounting services with use of crowd technologies, as well as exploring the prospects for their introduction into activities of national enterprises. The most common models of providing accounting services with use of crowd technologies are analyzed: outsourcing, cosoursing, offshoring, insourcing, outstaffing. It is determined that accounting models, along with significant advantages, have a number of drawbacks. It is noted that the choice of a certain model, the ability and necessity of its use depends on the volumes and types of activities and is left to the owners of the enterprise, taking into account the advantages and presence of an economic effect. It is defined that Ukrainian market of accounting services is represented by a large number of enterprises and individual entrepreneurs, who are increasing the volume of services sold and are in the greatest demand among businesses and institutions in comparison with the ordinary population and other categories of consumers. It is substantiated that, provided the use of services of outsourcers by business owners, it is advisable to focus on the compliance of those who provide services to certain criteria, the main ones among them: professionalism and competence in the specifics and strategies of the customer’s activity; responsibility for result and quality; privacy; cost of accounting services. It is defined that the use of crowd technologies by enterprises in the organization of the accounting process will contribute to its optimization, obtainment of significant benefits from the use of additional resources, and increase in the ability to adapt them to modern economic realities.

The article defines the essence of women’s charity of the 21st century as a voluntary, socio-economic, gender-oriented, professionally adjusted force. The author established the following constitutional factors to organize the women’s charitable activities: 1) legal; 2) spiritual and moral; 3) factors of practical capability / ability of charity participants. The importance of the legal factor above others was noted. After all, it is the government that by means of its legal, social, educational, financial and economic, and other institutions directly or indirectly influence the development of the spiritual and moral factors (inner personality) and the factor of person’s practical ability to be the subject of charity.The purpose of women’s charitable activities is to develop the national education in the context of Ukraine’s integration into European and world space; modernization of domestic women’s experience in charity through advanced technologies and standards of world charity initiatives, their procedural and organizational approaches, problem diagnosis and acquisition of universal charity background. The paper also describes the principles (voluntariness, disinterestedness, humanity, cordocentrism, love to people, mercy, tolerance, etc.), the types (financial, property, organizational and territorial, personality-activity); forms of women’s charity (cash aid in the form of grants, subsidies, voluntary donations, single or systematic material assistance, free transfer of property and / or property rights to permanent use or ownership, establishment of charitable organizations, funds, unions, societies; arranging and conducting charity events, providing direct help with personal work, etc.); and the functions (axiological, educational, socio-economic, marketing-investment, social, socially regulative, public and political).

Predicting the outcome of in vitro fertilization is of great importance when deciding on the use of this method. The purpose of the study was to determine the echographic and morphological criteria for the readiness of the endometrium for implantation to increase the effectiveness of IVF. The case-control method was used to select and examine 250 women, divided into 3 groups: group 1 (main group, IVF 1, n=87) included infertile women planning IVF for the first time, group 2 (comparison group, IVF 2, n=83) - women with unsuccessful previous IVF attempts; in group 3 (control group, n=80) - women with a history of physiological pregnancy that successfully ended in natural childbirth. An ultrasound examination of the pelvic organs and morphological examination of the biopsy of the uterine mucosa in a significant part of women from the IVF 1 and IVF 2 groups revealed signs of chronic endometritis, which is the cause of infertility. According to 2D echography and Doppler ultrasound data, the echographic criteria for the readiness of the endometrium for IVF are determined: the thickness of the endometrium is more than 8 mm, the correspondence of the endometrial echostructure to the phase of the menstrual cycle, the uniformity of the M-echo, the absence of hyper- and hypoechoic inclusions, and the absence of hemodynamic disturbances in the uterine vessels and in the vascular basin of the pelvis in the second phase of the menstrual cycle. The morphological criteria of the readiness of the endometrium for implantation, in our opinion, include the absence of inflammatory changes in the endometrium (focal and diffuse lymphoid cell infiltrates, plasma cells in the stroma), as well as sclerotic changes in the walls of the spiral arteries. Under these conditions, the prognosis of the effectiveness of the IVF program is favorable.

The authors carried out a historiographical review of the development of legal education of officers in higher military education institutions of Ukraine in the twentieth century in terms of modern historical and pedagogical science.The article clarifies the concepts related to the organization of legal education of officers in higher military educationalinstitutions of the USSR and independent Ukraine. It was found that in the period under study laid the foundation for further development of the modern system of domestic military education.The authors analyzed a set of studies on the legal education of officers, the degree of scientific development of the problem of legal education in higher military school in Ukraine and identified areas for its study. The authors found that representatives of various fields of scientific knowledge (history, philosophy, law and pedagogy) studied certain aspects related to the legal education of officers in higher military educational institutions. Such as the systematization of the experience of officer training; pedagogy and psychology of higher military school; problems of development of the modern system of military education in Ukraine, humanitarianization and technological aspects of personalityoriented training of military specialists with higher education; content and structure of the process of legal training of the contingent in military educational institutions; legal regulation of the military education system.The article offers a classification of scientific works related to this issue according to: the moment of their creation (modern works and published in the period under study); origin (Soviet scientific works and published in independent Ukraine and the countries of the former USSR); purpose (those that reveal the peculiarities of maintaining general discipline in the army and are devoted to issues of team training); subject (legal education of officers as an element of professional training and in the context of rulemaking of public authorities and military administration.).It was found that despite the appeal of some scholars to certain aspects of the formation of legal education of military officers in Ukraine, this problem has not been the subject of a separate scientific study.&nbsp, Авторами здійснено історіографічний огляд розвитку правової освіти офіцерів у закладах вищої військової освіти України в ХХ столітті з погляду сучасної історикопедагогічної науки. У статті уточнено поняття, пов’язані з організацією правової освіти офіцерів у вищих військових навчальних закладах СРСР та незалежної України. Зокрема, з’ясовано, що саме в досліджуваний період закладалося підґрунтя для подальшої розбудови сучасної системи вітчизняної військової освіти.Проаналізовано сукупність досліджень, присвячених правовій освіті офіцерських кадрів, ступінь наукової розробленості проблеми правової освіти у вищій військовій школі України, визначено напрями її вивчення. Встановлено, що представниками різних галузей наукового знання (історії, філософії, права та педагогіки) досліджувалися окремі аспекти, пов’язані із правовою освітою офіцерів у вищих військових навчальних закладах (систематизація досвіду підготовки офіцерських кадрів; педагогіка і психологія вищої військової школи; проблеми розвитку сучасної системи військової освіти в Україні, зокрема її гуманітаризація й технологічні аспекти особистісно орієнтованої підготовки військових фахівців з вищою освітою; зміст та структура процесу правової підготовки контингенту у військовонавчальних закладах; нормативноправове регулювання діяльності системи військової освіти).Запропоновано класифікацію наукових праць, що стосуються цієї проблематики відповідно до: моменту їх створення (сучасні праці та видані у досліджуваний період); походження (радянські наукові праці та видані в незалежній Україні й країнах колишнього СРСР); цільового призначення (такі, що розкривають особливості підтримання загальної дисципліни у військах та присвячені питанням підготовки командних кадрів); предмета (правова освіта офіцерів як елемент професійної підготовки та в контексті нормотворчості органів державної влади та військового управління.).З’ясовано, що попри звернення окремих учених до тих чи інших аспектів становлення правової освіти військовослужбовців в Україні, ця проблема не була предметом окремого наукового дослідження.

The article presents the results of the study about the influence of plowing with soil turnover and of surface tillage on meter layer soil available moisture and yield of phytomass of maize. It was concluded that the most effective tillage for maize is plowing with soil turnover, because it ensures accumulation of maximum available moisture reserve and high maize phytomass yield. The influence of mineral nitrogen fertilizing was the most effective with plowing with soil turnover in comparison with surface tillage.

α,α’-Disubstituted styrenes undergo a difluorination-rearrangement reaction with fluoro-benzoiodoxole reagent 1 . The reaction is catalyzed by Pd(MeCN) 4 (BF 4 ) 2 and Cu(MeCN) 4 PF 6 . We have studied the rearrangement of α,α’-diaryl substituted styrenes, in which the aryl groups have different electronic character. In the case of α-aryl, α’-alkyl substituted styrenes, the aryl substituent has a higher migratory aptitude than the alkyl group. We have also extended the reactions to cycloalkyl styrenes, which underwent interesting ring contraction/expansion reactions. The regioselectivity of the migration can be explained on the basis of the formation of a phenonium intermediate.

Reaction of 1,1-disubstituted cyclopropanes with hypervalent iodines in the presence of AgBF4 leads to 1,3-difluorination and 1,3-oxyfluorination products., A new method is presented for 1,3-difluorination and 1,3-oxyfluorination reactions. The process is based on iodonium mediated opening of 1,1-disubstituted cyclopropanes. The reaction proceeds with high chemo- and regioselectivity under mild reaction conditions typically at room temperature in a couple of hours. The reaction probably occurs via electrophilic ring-opening of cyclopropanes.

The application of an air- and moisture-stable fluoroiodane reagent was investigated in the palladium-catalyzed iodofluorination reaction of alkenes. Both the iodo and fluoro substituents arise from the fluoroiodane reagent. In the case of certain palladium catalysts, the alkene substrates undergo allylic rearrangement prior to the iodofluorination process. The reaction is faster for electron-rich alkenes than for electron-deficient ones.

The copper-catalyzed oxytrifluoromethylation of phenylacetylenes and C-H trifluoromethylation of quinones were studied. It was found that both reactions are accelerated by B(2)pin(2) and PCy3 addit ...

Styrenes with an electron-deficient double bond undergo cyanotrifluoromethylation with a trifluoromethylated hypervalent iodine reagent in the presence of CuCN. The reaction proceeds under mild conditions in the presence of bulky phosphines or B2pin2 additives. The process is highly regioselective and involves the consecutive formation of two C-C bonds in a single addition reaction. In the presence of a p-methoxy substituent in the styrene, oxytrifluoromethylation occurs instead of the cyanotrifluoromethylation.

Coumarin-sensitized, long-wavelength-absorbing luminescent Eu(III)-complexes have been synthesized and characterized. The lanthanide binding site consists of a cyclen-based chelating framework that is attached through a short linker to a 7-hydroxycoumarin, a 7-B(OH)(2)-coumarin, a 7-O-(4-pinacolatoboronbenzyl)-coumarin or a 7-O-(4-methoxybenzyl)-coumarin. The syntheses are straightforward, use readily available building blocks, and proceed through a small number of high-yielding steps. The sensitivity of coumarin photophysics to the 7-substituent enables modulation of the antenna-absorption properties, and thus the lanthanide excitation spectrum. Reactions of the boronate-based functionalities (cages) with H(2)O(2) yielded the corresponding 7-hydroxycoumarin species. The same species was produced with peroxynitrite in a ×10(6)-10(7)-fold faster reaction. Both reactions resulted in the emergence of a strong ≈407 nm excitation band, with concomitant decrease of the 366 nm band of the caged probe. In aqueous solution the methoxybenzyl caged Eu-complex was quenched by ONOO(-). We have shown that preliminary screening of simple coumarin-based antennae through UV/Vis absorption spectroscopy is possible as the changes in absorption profile translate with good fidelity to changes in Eu(III)-excitation profile in the fully elaborated complex. Taken together, our results show that the 7-hydroxycoumarin antenna is a viable scaffold for the construction of turn-on and ratiometric luminescent probes.

The copper-catalyzed oxytrifluoromethylation of phenylacetylenes and C-H trifluoromethylation of quinones were studied. It was found that both reactions are accelerated by B(2)pin(2) and PCy3 addit ...

The reaction of α-methyl styrene (III) also leads to the β-difluorinated product but the methyl group migrates to the β-position.

Microdiamonds from two different Ukrainian Neogenic placer deposits, Samotkan and Zeleny Yar, and from kimberlite pipe Udachnaya, Yakutia, Russia, were studied by FTIR absorption spectroscopy. The spectra were normalized to sample thickness of 1 mm, background corrected and analyzed by curve fitting with Peakfit 4.0 software. For this purpose, four user-defined functions which simulate the absorption of the nitrogen-bearing-centers A, B, C and D were synthesized using each seven to nine Gaussians or Lorentzians out of the list of spectroscopic functions of the Peakfit 4.0 program. One result was that with respect to the IR active forms of nitrogen, most diamonds from Ukrainian Neogenic deposits are nitrogen-free. The rare nitrogen-bearing crystals from Samotkan (∼25% of total amount studied) contain nitrogen mainly in the A-form (pairs of adjacent nitrogen ions in regular sites of the structure) and, partly, in the C-form (single atoms randomly dispersed over regular sites of the diamond structure). This indicates either a relatively low temperature or a relatively short residence time of such crystals under Mantle conditions. The rare (∼ 10% of total) nitrogen-bearing crystals from Zeleny Yar contain nitrogen mainly in the A- and B-forms (four nitrogen atoms arranged around a carbon vacancy) with predominance of B. According to existing theory this indicates higher temperatures or longer Mantle residence times of such diamonds compared with those from Samotkan. Most of the Yakutian diamonds studied (∼95%) contain nitrogen-bearing defects. The curve fitting analysis shows a wide range of N B /N total ratios which suggests a wide range of Mantle residence temperatures. With respect to the temperatures, the Yakutian diamonds may be regarded as intermediate between those from Samotkan and Zeleny Yar.

Treatment of styrenes (I) with Togni reagent (I) and CuCN in the presence of PCy3 as catalyst leads to desired trifluoromethyl nitriles (IV) in moderate yields.

A copper(I)-mediated trifluoromethylation of substituted quinones via C-H activation and by using a hypervalent iodine reagents as trifluoromethylene-source is reported.

Quinones undergo copper-mediated C–H trifluoromethylation reactions using a hypervalent iodine reagent. The reactions have a broad synthetic scope involving naphtho, alkyl, chloro and methoxy quinones.

The reaction of the hypervalent iodine reagent (I) with alkynes proceeds with complete stereoselectivity.

Regio- and stereoselective Cu-catalyzed addition of the above hypervalent iodine reagent to alkynes and alkenes was achieved. In the presence of CuI, the reaction is suitable to perform trifluoromethyl-benzoyloxylation and trifluoromethyl-halogenation of alkenes and alkynes. Electron-donating substituents accelerate the process, and alkenes react faster than alkynes emphasizing the electrophilic character of the addition reaction.