Search

Background Coronavirus disease 2019 (COVID-19) is often associated with mild thrombocytopenia and increased platelet reactivity. Objective The aim of the current study was to investigate the adenosine triphosphate (ATP) release kinetics of platelets in hospitalized SARS-CoV-2-infected patients. Methods We studied time-dependent platelet activation in whole blood by monitoring the ATP release kinetics upon stimulation with a PAR1 receptor agonist in 41 hospitalized critically ill COVID-19 patients, 47 hospitalized noncritically ill COVID-19 patients, and 30 healthy controls. Results Our study demonstrated that platelets of critically ill COVID-19 patients were hyper-responsive with a shorter platelet response time (PRT) and a reduced platelet granule release capacity (GRC), probably due to chronic activation. The median PRT of COVID-19 patients admitted to the critical care unit was 10 and 7 seconds shorter than the median PRT in healthy controls and noncritical COVID-19 patients, respectively. Both PRT and GRC were also associated with D-dimer (Spearman r [r s] = −0.51, p Conclusion Using an accessible agonist-induced platelet granule ATP release assay, we show that platelet hyper-responsiveness and reduced platelet GRC in COVID-19 patients were associated with critical illness and mortality.

Contains fulltext : 293477.pdf (Publisher’s version ) (Open Access) BACKGROUNDPeople living with HIV (PLHIV) receiving antiretroviral therapy (ART) exhibit persistent immune dysregulation and microbial dysbiosis, leading to development of cardiovascular diseases (CVDs). We initially compared plasma proteomic profiles between 205 PLHIV and 120 healthy control participants (HCs) and validated the results in an independent cohort of 639 PLHIV and 99 HCs. Differentially expressed proteins (DEPs) were then associated to microbiome data. Finally, we assessed which proteins were linked with CVD development in PLHIV.METHODSProximity extension assay technology was used to measure 1,472 plasma proteins. Markers of systemic inflammation (C-reactive protein, D-dimer, IL-6, soluble CD14, and soluble CD163) and microbial translocation (IFABP) were measured by ELISA, and gut bacterial species were identified using shotgun metagenomic sequencing. Baseline CVD data were available for all PLHIV, and 205 PLHIV were recorded for development of CVD during a 5-year follow-up.RESULTSPLHIV receiving ART had systemic dysregulation of protein concentrations, compared with HCs. Most of the DEPs originated from the intestine and lymphoid tissues and were enriched in immune- and lipid metabolism-related pathways. DEPs originating from the intestine were associated with specific gut bacterial species. Finally, we identified upregulated proteins in PLHIV (GDF15, PLAUR, RELT, NEFL, COL6A3, and EDA2R), unlike most markers of systemic inflammation, associated with the presence and risk of developing CVD during 5-year follow-up.CONCLUSIONOur findings suggest a systemic dysregulation of protein concentrations in PLHIV; some proteins were associated with CVD development. Most DEPs originated from the gut and were related to specific gut bacterial species.TRIAL REGISTRATIONClinicalTrials.gov NCT03994835.FUNDINGAIDS-fonds (P-29001), ViiV healthcare grant (A18-1052), Spinoza Prize (NWO SPI94-212), European Research Council (ERC) Advanced grant (grant 833247), and Indonesia Endowment Fund for Education.

Most coronavirus disease 2019 (COVID-19) patients are still experiencing persistent clinical symptoms even after being discharged from the hospital. Previous studies have reported the remaining symptoms in 29%–93% of patients. This condition can have a major impact on a patient’s ability to perform daily activities and have a deleterious effect on their quality of life (QoL). Objectives: This study aimed to evaluate persistent symptoms and QoL of COVID-19 patients 3 months after discharge from Dr. Kariadi Hospital Semarang, Central Java, Indonesia. Methods: Confirmed COVID-19 patients were enrolled in this prospective cohort study after discharge from Dr. Kariadi Hospital Semarang from March 1 to May 15, 2021. Telephone interviews were conducted each week in the first month, and every 2 weeks in the second and third months regarding persistent symptoms. EQ-5D-5L questionnaires were completed and evaluated every month for 3 months after hospital discharge. Results: Of the 104 patients enrolled, 55% were male, with a mean age of 48.96 years. The incidence of persistent symptoms in the first, second, and third months was 49%, 31.7%, and 25%, respectively. The most common persistent symptoms were fatigue, cough, shortness of breath, and nausea. The characteristics of the patients included being overweight/obese, having one or more comorbidities, having five or more symptoms classified as moderate COVID-19, and requiring supplemental oxygen during hospitalization. Based on the EQ-5D questionnaire, most patients reported worsening in the quality of their ability to perform usual activities, feelings of pain/discomfort, and anxiety/depression. The total values of the EQ-5D and EQ-VAS indices were lower than those of the Indonesian general population, indicating a decrease in QoL. Conclusions: The patients developed persistent symptoms and decreased quality of life during the 3-month following hospital discharge. Keywords: persistent symptoms, EQ-5D-5L, QoL

Phthalates exposure occurs in all areas, such as foods' plastic packaging, cosmetics, and others. Previous studies showed that phthalates are associated with the prevalence of T2DM. Type 2 Diabetes Mellitus (T2DM) is caused by a combination of defective insulin secretion by pancreatic β-cells and the insulin-resistance. This study aimed to investigate whether phthalate exposure is an environmental risk factor for T2DM. A case-control study was conducted among residents in the South Tangerang district from June 2020 to February 2021 using a purposive sampling technique. The cases were the patients diagnosed T2DM with HbA1c>6.5% random blood sugar>200 mg/dL, with history T2DM treatment. The respondents' urines were collected and evaluated using liquid chromatography/mass spectrometry (LC/MS). A total of 47 cases and 47 controls were recruited in the study. The lowest monomethyl phthalate (MEP) and mono (2-ethyl-5-hydroxyhexyl) phthalate (MEHHP) were 5.37 µg/L and 2.02 µg/L, respectively. On multivariable regression analysis, the high urinary MEP level (>131.91 µg/L) was independently associated with T2DM (OR: 3.754, 95% CI: 1.559–8.811, p-value: 0.002). MEP is an environmental risk factor for T2DM and likely has a significant impact on human health than MEHHP.

Background The immunopathogenesis of dengue virus (DENV) infection remains incompletely understood. To increase our understanding of inflammatory response in non-severe dengue, we assessed longitudinal changes in the inflammatory proteome in patients with an acute DENV infection. Methods Using a multiplex proximity extension assay (PEA), we measured relative levels of 368 inflammatory markers in plasma samples from hospitalized patients with non-severe DENV infection in the acute (n = 43) and convalescence (n = 35) phase of the infection and samples of healthy controls (n = 10). Results We identified 203 upregulated and 39 downregulated proteins in acute versus convalescent plasma samples. The upregulated proteins had a strong representation of interferon (IFN) and IFN-inducible effector proteins, cytokines (e.g. IL-10, IL-33) and cytokine receptors, chemokines, pro-apoptotic proteins (e.g. granzymes) and endothelial markers. A number of differentially expressed proteins (DEPs) have not been reported in previous studies. Functional network analysis highlighted a central role for IFNγ, IL-10, IL-33 and chemokines. We identified different novel associations between inflammatory proteins and circulating concentrations of the endothelial glycocalyx disruption surrogate marker syndecan-1. Conclusion: This unbiased proteome analysis provides a comprehensive insight in the inflammatory response in DENV infection and its association with glycocalyx disruption.

HIV prevalence in Indonesia is increasing, and only 64% of infected individuals know their status. In a prospective cohort of 1,453 hospitalized patients with unexplained fever, 46 (3.2%) had HIV, including 15 (1.1%) patients without a prior HIV diagnosis. Among 31 subjects previously known to have HIV, 21 (68%) had been receiving combination antiretroviral therapy (cART) at the time of enrollment. Of 39 HIV cases with HIV RNA levels ≥ 100 copies/mL, sequencing for genotype analysis and resistance testing was successful in 30 (77%) subjects. The most common HIV subtypes were AE (90%) and B (10%). Five (16.7%) subjects had resistance mutations to nucleoside and non-nucleoside reverse transcriptase inhibitors, and all of them were on cART. No evidence of transmitted drug resistance was found in newly diagnosed individuals. Hospital-based screening may be an efficient method to expand HIV testing and identify a significant number of new cases. Access to care, close monitoring, expansion of anti-retroviral options, and ensuring availability of CD4 determinations, viral load testing, and genotyping are crucial to control of the epidemic in Indonesia.

Latar belakang: Leptospirosis merupakan zoonosis penting di dunia, yang masih sering terjadi salah diagnosis. Deteksi laboratorium Leptospira menjadi tantangan karena bakterimea cukup singkat untuk dideteksi molekuler, namun antibodi juga muncul sangat lambat. Urine dapat menjadi sampel alternatif untuk deteksi PCR pada leptospirosis. Pengerjaan PCR membutuhkan DNA berkualitas dan andal, dan diperoleh dari metode ekstraksi DNA yang baik. Penelitian bertujuan untuk mengetahui metode ekstraksi DNA Leptospira terbaik untuk sampel urin, serta mengevaluasi pengaruh waktu penyimpanan dan suhu terhadap kestabilan DNA. Metode: Penelitian ini menggunakan tiga metode isolasi DNA yang berbeda; berbasis silika dengan spin kolom, kromatografi spin column menggunakan resin sebagai matriks pemisah, dan metode larutan dengan guanidine isothiocyanate. Hasil ekstraksi diperiksa konsentrasi dan kemurniannya. Gen SecY pada Leptospira dideteksi dengan PCR real-time. Pengaruh suhu dan lama penyimpanan DNA juga dilihat. Hasil: Hasil isolasi DNA menggunakan resin menunjukkan konsentrasi tertinggi (7,94 + 2,11 μg / mL) dan jumlah salinan amplifikasi DNA Leptospira tertinggi (50167,92 + 1,19). Suhu penyimpanan pada suhu 4°C, -20°C, dan -80°C dan umur simpan 91 hari tidak berpengaruh terhadap kualitas dan kuantitas DNA Leptospira hasil isolasi spike urin. Kesimpulan: Isolasi DNA menggunakan spin column chromatography dengan resin sebagai matriks separasi memiliki kualitas dan kuantitas terbaik berdasarkan kemurnian dan konsentrasi DNA serta jumlah gen SecY yang teramplifikasi. Kata kunci: Leptospira, Leptospirosis, ekstraksi DNA, sampel urin, penyimpanan sampel. Abstract Background: Leptospirosis is a worldwide zoonotic disease, which is still often misdiagnosed. Laboratory detection of Leptospira is challenging since the bacteraemia is quite short for molecular detection, however, the rise of the antibody is late to post the infection. Urine can be a potential alternative sample for PCR detection in leptospirosis. The PCR method requires a reliable DNA template, which is obtained from good DNA extracting methods. The study aimed to determine the best method of extraction Leptospira DNA from the urine sample, as well as evaluating the effect of time storage and temperature for its DNA stability. Methods: This study was utilizing three different DNA isolation methods; silica based with spin column, spin column chromatography using resin as separation matrix, and solution method with guanidine isothiocyanate. The yields were examined for its concentration and purity. Leptospira’s SecY gene was detected with realtime PCR. The influences of storage temperature and the life time of the DNA were also studied. Results: The yield of DNA isolation using resin showed the highest concentration (7.94+2.11 μg/mL) and highest Leptospira DNA amplification copy number (50167.92+1.19). Storage temperature at 4°C, -20°C, and -80°C and life time of 91 days did not have any effect on the quality and quatnity of Leptospira DNA isolated from spiked urine. Conclusions: DNA isolation using spin column chromatography with resin as separation matrix has the best quality and quantity based on the purity and concentration of DNA and the higher number of amplified SecY gene. Keywords: Leptospira, Leptospirosis, DNA extraction, urine sample, sample storage

Background The burden of leptospirosis in Indonesia is poorly understood. Data from an observational study conducted from 2013 to 2016 in seven cities across Indonesia was used to estimate the incidence of leptospirosis and document its clinical manifestations in patients requiring hospitalization. Methods Specimens from patients hospitalized with acute fever were collected at enrollment, 14–28 days, and 3 months. Demographic and clinical information were collected during study visits and/or retrieved from medical records and double-entered into clinical report forms. After initially screening for dengue virus and other pathogens, specimens were tested at a central Reference Laboratory for anti-Leptospira IgM using commercial ELISA kits and for Leptospira DNA using an in-house quantitative real-time PCR assay. Results Of 1464 patients enrolled, 45 (3.1%) confirmed cases (by PCR and/or sero-coversion or four-fold increase of IgM) and 6 (0.4%) probable cases (by high titer IgM) of leptospirosis were identified by the Reference Laboratory. Disease incidence at sites ranged from 0 (0%) cases in Denpasar to 17 (8.9%) cases in Semarang. The median age of patients was 41.2 years (range of 5.3 to 85.0 years), and 67% of patients were male. Twenty-two patients (43.1%) were accurately diagnosed at sites, and 29 patients (56.9%) were clinically misdiagnosed as having another infection, most commonly dengue fever (11, 37.9%). Clinically, 20 patients (39.2%) did not present with hyperbilirubinemia or increased creatinine levels. Two patients (3.9%) died, both from respiratory failure. Fifteen patients (29.4%) clinically diagnosed with leptospirosis at sites were negative based on IgM ELISA and/or PCR at the Reference Laboratory. Conclusions Leptospirosis remains an important cause of hospitalization in Indonesia. It can have diverse clinical presentations, making it difficult to differentiate from other common tropical infections. PCR combined with ELISA is a powerful alternative to the cumbersome gold-standard microscopic agglutination test, particularly in resource-limited settings.

Background: People living with HIV (PLHIV) exhibit dysregulation of tryptophan metabolism. Altered gut microbiome composition in PLHIV might be involved. Mechanistic consequences within the 3 major tryptophan metabolism pathways (serotonin, kynurenine, and indoles), and functional consequences for platelet, immune and behavioral functions are unknown. We investigated plasma tryptophan metabolites, gut microbiome composition, and their association with platelet function, inflammation, and psychiatric symptoms. Methods: This study included 211 PLHIV on long-term antiretroviral treatment (ART). Plasma tryptophan pathway metabolites were measured using time-of-flight mass spectrometry. Bacterial composition was profiled using metagenomic sequencing. Platelet reactivity and serotonin levels were quantified by flowcytometry and ELISA, respectively. Circulating inflammatory markers were determined using ELISA. Symptoms of depression and impulsivity were measured by DASS-42 and BIS-11 self-report questionnaires, respectively. Results: Plasma serotonin and indole metabolites were associated with gut bacterial composition. Notably, species enriched in PLHIV were associated with 3-methyldioxyindole. Platelet serotonin concentrations were elevated in PLHIV, without effects on platelet reactivity. Plasma serotonin and indole metabolites were positively associated with plasma IL-10 and TNF-α concentrations. Finally, higher tryptophan, serotonin, and indole metabolites were associated with lower depression and anxiety, whereas higher kynurenine metabolites were associated with increased impulsivity. Conclusion: Our results suggest that gut bacterial composition and dysbiosis in PLHIV on ART contribute to tryptophan metabolism, which may have clinical consequences for immune function and behavior.

Background Thrombocytopenia, bleeding and plasma leakage are major complications of dengue. Activation of endogenous sialidases with desialylation of platelets and endothelial cells may underlie these complications. We aimed to assess the effects of the neuraminidase inhibitor oseltamivir on platelet recovery and plasma leakage in dengue. Methods We performed a phase 2, double-blind, multicenter, randomized trial in adult dengue patients with thrombocytopenia (, Author summary Moderate to severe thrombocytopenia is common in the febrile and/or critical phase of dengue virus infection. Platelets are important for preservation of vascular integrity, especially during inflammation, and low platelet counts may contribute to plasma leakage. Currently, no therapeutic intervention that targets the pathogenic pathway is available for DENV infection, including therapies to prevent or reduce thrombocytopenia or plasma leakage. Oseltamivir phosphate is widely used for prevention and treatment of influenza by inhibiting viral neuraminidase. However, oseltamivir may also inhibit human endogenous neuraminidase involved in sialic acid metabolism, and as such extend the lifespan of platelets. In the phase 2 TOTO trial (Treatment Of Thrombocytopenia with Oseltamivir in acute dengue virus infection: a randomized, placebo controlled, multicenter trial) we investigated the potential of oseltamivir phosphate to shorten the time to platelet recovery and reduce plasma leakage in patients with DENV infection. In this trial involving 70 adult thrombocytopenic patients, hospitalized with acute DENV infection, adjunctive therapy with oseltamivir phosphate did not shorten platelet recovery time compared with placebo. The trial also did not show an effect of adjunctive oseltamivir on plasma leakage parameters. The reasons that oseltamivir had no apparent effect on platelet counts, markers of plasma leakage and glycocalyx distortion in this study remain speculative, but may involve one or more of the following; first, dengue-associated thrombocytopenia and plasma leakage are both multifactorial in origin and targeting neuraminidase alone may be insufficient to impact these processes. Second, oseltamivir phosphate was designed to inhibit viral neuraminidase, and data of its inhibitory actions on human neuraminidases are inconclusive. The finding in this study also suggest that while laboratory works may lead to hypotheses for novel treatment, proof of concept studies are essential to test them in a clinical setting.

BackgroundEndothelial hyper-permeability with plasma leakage and thrombocytopenia are predominant features of severe dengue virus infection. It is well established that heparanase, the endothelial glycocalyx degrading enzyme, plays a major role in various diseases with vascular leakage. It is yet to be elucidated whether heparanase activity plays a major role in dengue-associated plasma leakage. Moreover, the major source of heparanase secretion and activation in dengue remains elusive. Since a relatively high amount of heparanase is stored in platelets, we postulate that heparanase released by activated platelets contributes to the increased plasma heparanase activity during dengue virus infection.MethodsHeparanase activity (plasma and urine), and heparan sulfate and syndecan-1 (plasma levels) were measured in dengue patients with thrombocytopenia in acute phase (n=30), during course of disease (n=10) and in convalescent phase (n=25). Associations with clinical parameters and plasma leakage markers were explored. Platelets from healthy donors were stimulated with dengue non-structural protein-1, DENV2 virus and thrombin to evaluate heparanase release and activity ex vivo.ResultsHeparanase activity was elevated in acute dengue and normalized during convalescence. Similarly, glycocalyx components, such as heparan sulfate and syndecan-1, were increased in acute dengue and restored during convalescence. Increased heparanase activity correlated with the endothelial dysfunction markers heparan sulfate and syndecan-1, as well as clinical markers of plasma leakage such as ascites, hematocrit concentration and gall-bladder wall thickening. Notably, platelet number inversely correlated with heparanase activity. Ex vivo incubation of platelets with thrombin and live DENV2 virus, but not dengue virus-2-derived non-structural protein 1 induced heparanase release from platelets.ConclusionTaken together, our findings suggest that the increase of heparanase activity in dengue patients is associated with endothelial glycocalyx degradation and plasma leakage. Furthermore, thrombin or DENV2 activated platelets may be considered as a potential source of heparanase.

Blood culturing remains the “gold standard” for bloodstream infection (BSI) diagnosis, but the method is inaccessible to many developing countries due to high costs and insufficient resources. To better understand the utility of blood cultures among patients in Indonesia, a country where blood cultures are not routinely performed, we evaluated data from a previous cohort study that included blood cultures for all participants. An acute febrile illness study was conducted from July 2013 to June 2016 at eight major hospitals in seven provincial capitals in Indonesia. All participants presented with a fever, and two-sided aerobic blood cultures were performed within 48 hours of hospital admission. Positive cultures were further assessed for antimicrobial resistance (AMR) patterns. Specimens from participants with negative culture results were screened by advanced molecular and serological methods for evidence of causal pathogens. Blood cultures were performed for 1,459 of 1,464 participants, and the 70.6% (1,030) participants that were negative by dengue NS1 antigen test were included in further analysis. Bacteremia was observed in 8.9% (92) participants, with the most frequent pathogens being Salmonella enterica serovar Typhi (41) and Paratyphi A (10), Escherichia coli (14), and Staphylococcus aureus (10). Two S. Paratyphi A cases had evidence of AMR, and several E. coli cases were multidrug resistant (42.9%, 6/14) or monoresistant (14.3%, 2/14). Culture contamination was observed in 3.6% (37) cases. Molecular and serological assays identified etiological agents in participants having negative cultures, with 23.1% to 90% of cases being missed by blood cultures. Blood cultures are a valuable diagnostic tool for hospitalized patients presenting with fever. In Indonesia, pre-screening patients for the most common viral infections, such as dengue, influenza, and chikungunya viruses, would maximize the benefit to the patient while also conserving resources. Blood cultures should also be supplemented with advanced laboratory tests when available.

Background Chikungunya virus (CHIKV) is often overlooked as an etiology of fever in tropical and sub-tropical regions. Lack of diagnostic testing capacity in these areas combined with co-circulation of clinically similar pathogens such as dengue virus (DENV), hinders CHIKV diagnosis. To better address CHIKV in Indonesia, an improved understanding of epidemiology, clinical presentation, and diagnostic approaches is needed. Methodology/Principal findings Acutely hospitalized febrile patients ≥1-year-old were enrolled in a multi-site observational cohort study conducted in Indonesia from 2013 to 2016. Demographic and clinical data were collected at enrollment; blood specimens were collected at enrollment, once during days 14 to 28, and three months after enrollment. Plasma samples negative for DENV by serology and/or molecular assays were screened for evidence of acute CHIKV infection (ACI) by serology and molecular assays. To address the co-infection of DENV and CHIKV, DENV cases were selected randomly to be screened for evidence of ACI. ACI was confirmed in 40/1,089 (3.7%) screened subjects, all of whom were DENV negative. All 40 cases initially received other diagnoses, most commonly dengue fever, typhoid fever, and leptospirosis. ACI was found at five of the seven study cities, though evidence of prior CHIKV exposure was observed in 25.2% to 45.9% of subjects across sites. All subjects were assessed during hospitalization as mildly or moderately ill, consistent with the Asian genotype of CHIKV. Subjects with ACI had clinical presentations that overlapped with other common syndromes, atypical manifestations of disease, or persistent or false-positive IgM against Salmonella Typhi. Two of the 40 cases were possibly secondary ACI. Conclusions/Significance CHIKV remains an underdiagnosed acute febrile illness in Indonesia. Public health measures should support development of CHIKV diagnostic capacity. Improved access to point-of-care diagnostic tests and clinical training on presentations of ACI will facilitate appropriate case management such as avoiding unneccessary treatments or antibiotics, early response to control mosquito population and eventually reducing disease transmission., Author summary Chikungunya virus (CHIKV) is often-overlooked as an etiology of fever in tropical and sub-tropical regions. Lack of diagnostic testing capacity in these areas combined with co-circulation of clinically similar pathogens such as dengue virus (DENV), hinders CHIKV diagnosis. The present study characterized the epidemiology, clinical presentation, and diagnostic approaches to better understand the CHIKV in Indonesia. We screened blood samples collected from children and adults with acute fever admitted to 8 hospitals in Indonesia from 2013–2016. Blood samples negative for DENV infection and a subset blood samples from confirmed DENV cases were then screened for acute CHIKV infection (ACI). ACI was confirmed in 40/1,089 (3.7%) screened patients, of whom initially received other diagnoses such as dengue fever, typhoid fever, and leptospirosis. All patients were considered as mildly or moderately ill, consistent with the Asian genotype of CHIKV. Given the unspecific clinical presentations of ACI, public health measures should support development of CHIKV diagnostic capacity. Improved access to point-of-care diagnostic tests will facilitate appropriate case management, such as avoiding unnecessary treatments or antibiotics, early response to control mosquito population, and eventually reducing disease transmission.

Background Reports of human rickettsial infection in Indonesia are limited. This study sought to characterize the epidemiology of human rickettsioses amongst patients hospitalized with fever at 8 tertiary hospitals in Indonesia. Methods Acute and convalescent blood from 975 hospitalized non-dengue patients was tested for Rickettsia IgM and IgG by ELISA. Specimens from cases with seroconversion or increasing IgM and/or IgG titers were tested for Rickettsia IgM and IgG by IFA and Rickettsia genomes using primers for Rickettsia (R.) sp, R. typhi, and Orientia tsutsugamushi. Testing was performed retrospectively on stored specimens; results did not inform patient management. Results R. typhi, R. rickettsii, and O. tsutsugamushi IgG antibodies were identified in 269/872 (30.8%), 36/634 (5.7%), and 19/504 (3.8%) of samples, respectively. For the 103/975 (10.6%) non-dengue patients diagnosed with acute rickettsial infection, presenting symptoms included nausea (72%), headache (69%), vomiting (43%), lethargy (33%), anorexia (32%), arthralgia (30%), myalgia (28%), chills (28%), epigastric pain (28%), and rash (17%). No acute rickettsioses cases were suspected during hospitalization. Discharge diagnoses included typhoid fever (44), dengue fever (20), respiratory infections (7), leptospirosis (6), unknown fever (6), sepsis (5), hepatobiliary infections (3), UTI (3), and others (9). Fatalities occurred in 7 (6.8%) patients, mostly with co-morbidities. Conclusions Rickettsial infections are consistently misdiagnosed, often as leptospirosis, dengue, or Salmonella typhi infection. Clinicians should include rickettsioses in their differential diagnosis of fever to guide empiric management; laboratories should support evaluation for rickettsial etiologies; and public policy should be implemented to reduce burden of disease.

Clostridium difficile has not been studied in detail in Asia, particularly Southeast Asia. We thus performed a prevalence study across four hospitals in Central Java province, Indonesia. Stool samples were collected from patients with diarrhoea and tested by enzyme immunoassay for glutamate dehydrogenase (GDH) and toxin A/B (C DIFF QUIK CHEK COMPLETE, TechLab). Specimens were cultured and molecular typing was performed. In total, 340 samples were tested, of which 70 (20.6%) were GDH positive, with toxin detected in 19 (5.6%). Toxigenic C. difficile was isolated from 37 specimens (10.9%), while a further 36 (10.6%) nontoxigenic isolates were identified. The most common strain was ribotype 017 (24.3% of 74 isolates), followed by nontoxigenic types QX 224 (9.5%), and QX 238 and QX 108 (both 8.1%). The high prevalence of C. difficile highlights a need for ongoing surveillance of C. difficile infection in Indonesia.

Background Severe acute respiratory infection (SARI) accounts for a large burden of illness in Indonesia. However, epidemiology of SARI in tertiary hospitals in Indonesia is unknown. This study sought to assess the burden, clinical characteristics, and etiologies of SARI and concordance of clinical diagnosis with confirmed etiology. Methods Data and samples were collected from subjects presenting with SARI as part of the acute febrile Illness requiring hospitalization study (AFIRE). In tertiary hospitals, clinical diagnosis was ascertained from chart review. Samples were analyzed to determine the “true” etiology of SARI at hospitals and Indonesia Research Partnership on Infectious Diseases (INA‐RESPOND) laboratory. Distribution and characteristics of SARI by true etiology and accuracy of clinical diagnosis were assessed. Results Four hundred and twenty of 1464 AFIRE subjects presented with SARI; etiology was identified in 242 (57.6%), including 121 (28.8%) viruses and bacteria associated with systemic infections, 70 (16.7%) respiratory bacteria and viruses other than influenza virus, and 51 (12.1%) influenza virus cases. None of these influenza patients were accurately diagnosed as having influenza during hospitalization. Conclusions Influenza was misdiagnosed among all patients presenting with SARI to Indonesian tertiary hospitals in the AFIRE study. Diagnostic approaches and empiric management should be guided by known epidemiology. Public health strategies to address the high burden of influenza should include broad implementation of SARI screening, vaccination programs, clinician education and awareness campaigns, improved diagnostic capacity, and support for effective point‐of‐care tests.

Background The epidemiology of acute febrile illness, a common cause of hospitalization in Indonesia, has not been systematically studied. Methodology/Principal findings This prospective observational study enrolled febrile patients (temperature ≥38°C) aged ≥1 year from July 2013 until June 2016 at eight government referral teaching hospitals in seven provincial capitals in Indonesia. Patients were managed according to the hospital standard-of-care (SOC), and blood samples were drawn for molecular and serological assays. Clinical data, laboratory results, and specimens for additional tests were collected at enrollment, days 14–28, and at three months. Regular follow-up visits were then scheduled for every three months either until symptoms resolved or until one year. In total, this study included 1,486 adult and pediatric patients presenting with multi-organ (768, 51.7%), gastrointestinal (497, 33.0%), respiratory (114, 7.7%), constitutional (62, 4.2%), skin and soft-tissue (24, 1.6%), central nervous system (17, 1.1%), or genitourinary (4, 0.3%) manifestations. Microbiological diagnoses were found in 1,003/1,486 (67.5%) participants, of which 351/1,003 (35.0%) were not diagnosed during hospitalization using SOC diagnostic tests. Missed diagnoses included all cases caused by Rickettsia spp., chikungunya, influenza, and Seoul virus. The most common etiologic agents identified were dengue virus (467, 46.6%), Salmonella spp. (103, 10.3%), and Rickettsia spp. (103, 10.3%). The overall mortality was 89 (5.9%). Conclusions/Significance Febrile illness in Indonesia has various microbiologic etiologies and substantial overall mortality. Diagnostic limitations and lack of epidemiologic data resulted in potentially treatable, and at times fatal, diseases being missed., Author summary In tropical countries like Indonesia, fever due to infectious disease is the most common reason for hospitalization. However, diagnoses are mostly unconfirmed, as diagnostic tests are not available or are not performed due to budget constraints. Consequently, many patients are only treated based on clinical syndromes. To gain a better understanding of the epidemiology of acute fever in Indonesia, we conducted a study at eight hospitals in the seven largest cities from 2013–2016. We enrolled 1,486 subjects aged ≥1 year with acute fever ≥38°C. Blood cultures were mandatory for all subjects, while cultures of other biological specimens, microscopic examinations, and rapid tests for specific pathogens were based on clinical judgment and availability. Retrospectively, we performed molecular and serological testing for a panel of bacterial and viral pathogens for systemic, respiratory, and diarrheal diseases. We found six pathogens to be the most prevalent: dengue virus (47%), Salmonella Typhi/Paratyphi (10%), Rickettsia typhi (10%), influenza virus (7%), Leptospira spp. (5%), and chikungunya virus (4%). Rickettsia typhi, influenza, and chikungunya had not been considered in the differential diagnosis of any subject at the hospitals. Thus, multiple pathogens were associated with acute febrile illnesses, and a subset of treatable cases were missed. This may have resulted in increased overall mortality.

textabstractObjective To determine the involvement of coagulation in bleeding and poor outcome in patients with severe leptospirosis. Methods In a prospective study, parameters of the coagulation system were measured on admission and during follow-up in 52 consecutive patients with severe leptospirosis. Results All patients showed coagulation disorders, such as prolonged prothrombin time (PT) and activated partial thromboplastin time, marked procoagulant activity [thrombin-antithrombin (TAT) complexes, prothrombin fragment 1+2, D-dimer], reduced levels of anticoagulant markers (protein C, antithrombin) and increased (anti-) fibrinolytic activity [plasmin-antiplasmin (PAP) complexes, plasminogen activator inhibitor-1]. These disorders were more pronounced in patients who died eventually. PT prolongation was associated with mortality (OR 1.4, 95% CI: 1.0-1.8, P = 0.04). Bleeding occurred in 31 subjects (60%). Of these, 24 had mild bleeding and seven had severe haemorrhages. Thrombocytopenia (platelets ≤100 × 109/l) was significantly associated with clinical bleeding (OR 4.6, 95% CI: 1.3-16). A subanalysis of patients with and without severe bleeding revealed a more pronounced imbalance of the coagulation system in patients with severe bleeding, as reflected by a significant association with PT (OR 1.4, 95% CI: 1.0-1.8, P = 0.05) and the TAT/PAP ratio (OR 1.3, 95% CI: 1.0-1.6, P = 0.05), which is an indicator of the balance between coagulation and fibrinolysis. Overt disseminated intravascular coagulation (DIC) was found in 10 (22%) of the 46 patients for whom the score could be calculated. There was no significant association between DIC scores, bleeding diathesis or poor outcome. Conclusion The coagulation system was strongly activated in patients with leptospirosis. This was more pronounced in the deceased and in patients with severe bleeding than in than the survivors and in those without severe bleeding.

Leptospirosis is a zoonosis of worldwide distribution, spread by the urine of infected animals. It is a major public health problem, especially in developing countries, where circumstances for transmission are most favourable. The clinical picture varies from mild disease to a severe illness with haemostatic derangements and multiorgan failure eventually leading to death. Although the haemorrhagic complications of severe disease are serious, the pathophysiology is scarcely elucidated. The complex mechanisms involved in inflammation-induced coagulation activation are extensively studied in various infectious diseases, i.e. Gram-negative sepsis. Tissue factor-mediated coagulation activation, impairment of anticoagulant and fibrinolytic pathways in close concert with the cytokine network are thought to be important. But for human leptospirosis, data are limited. Because of the growing interest in this field, the impact of leptospirosis, and the availability of new therapeutic strategies, we reviewed the evidence regarding the role of coagulation in leptospirosis and provide suggestions for future research.

Background Acute febrile illness is a common reason for hospitalization in many developing countries, including Indonesia. While patients can often be categorized and managed based on clinical presentations, diagnostic capacity in these countries remains limited, leading to poor patient outcomes. For patients with central nervous system (CNS) infections, identifying the underlying etiologies is particularly important to prevent lifelong neurological complications and death. Methods As part of a study conducted at 8 top-referral hospitals across Indonesia from 2013 to 2016, 114 of 1,486 enrolled subjects presented with an acute fever and a CNS syndrome. To identify the etiologies and clinical manifestations of these infections, as well as the management of febrile patients at the hospitals, demographic and clinical data were collected at enrollment, and blood samples were collected for diagnostic testing at enrollment, once during days 14–28, and at 3 months after enrollment. Results Subject ages ranged from 1 to 63.2 years old (median of 4.9 years old), and underlying diseases were reported in 35 (30.7%) subjects. Standard-of-care, molecular, and serological testing identified pathogens in 56 (49.1%) cases, as detailed in the table. Of the 19 subjects who died, 18 presented with decreased consciousness and 5 were infected with Rickettsia typhi, which was clinically misdiagnosed in each case. Conclusion The findings from this study will improve the diagnosis and treatment of patients presenting with CNS syndromes in Indonesia. Additionally, the discovery of misdiagnosed, fatal etiologies highlights the general need for greater diagnostic testing capacity to aid clinicians and inform public health policy makers. Disclosures All authors: No reported disclosures.

Background Infectious diseases remain a significant healthcare burden in the developing world. In Indonesia, clinicians often manage and treat patients solely based on clinical presentations since the diagnostic testing capacities of hospitals are limited. Unfortunately, the most common infections in this tropical environment share highly similar manifestations, complicating the identification of etiologies and leading to the misdiagnosis of illness. When pathogen-specific testing is available, generally at top-tier specialist hospitals, the limited range of tests and slow turnaround times may never lead to a definitive diagnosis or improved patient outcomes. Methods To identify clinical parameters that can be used for differentiating the most common causes of fever in Indonesia, we evaluated clinical data from 1,486 acute febrile patients enrolled in a multi-site observational cohort study during 2013 to 2016. Results From the 66% of subjects with confirmed etiologies, the six most common infections were dengue virus (455), Salmonella spp. (124), Rickettsia spp. (109), influenza virus (64), Leptospira spp. (53), and chikungunya virus (37). The accompanying figure shows the clinical signs and symptoms (A) and hematology and blood chemistry results (B) for the color-coded pathogens. Comparing the profiles of all infected subjects reveals parameters that are uniquely associated with particular pathogens, such as leukopenia with dengue virus. Conclusion These observations will assist clinicians in healthcare systems with limited diagnostic testing capacities and may be useful in formulating diagnostic algorithms for Indonesia and other developing countries. Disclosures All authors: No reported disclosures.

Active Cytomegalovirus (CMV) infection has been realated to immunocompromise conditions (malignancy, HIV-AIDS, longterm use of corticosteroids, transplant patient). Nowadays, severa studies have shown that immunocompetent critically ill patients were suffered from active CMV infection. Alteration of immune system in critically immunocompetent patient (without clear history of immunocompromise condition), might become the most possible reason enderlying this event. To document the prevalence of active CMV infection in critically ill immunocompetent patient; and to find out the difference in the degree of severity between groups of patients with and without active CMV infection, admitted in the ICU (Intensive Care Unit) . A cross sectional study was conducted from Appril 1st until June 30th 2013. Subjects were patient aged ≥ 14 years, hospitalized in ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Patients having a history of malignancy, HIV-AIDS, longterm use of corticosteroids, and receiving transplatation were excluded from the study. The degree of severity was calculated (using APACHE II score) in the first 24 hours in ICU. EDTA sample for qualitative PCR examination (procedure as described elsewhere) was collected after 4 days of treatment. Primer for CMV were as follow CMV-F: CATGAAGGTCTTTGCCCAGTAC, CMV-R: GGCCAAAGTGTAGGCTACAATAG. Finally, datas ware analyzed using bivariate analysis. From 50 subjects included, 16 patients had active CMV infection. The degree of severity due to APACHE II score were normally distributed with mean 11.8±6.43. The mean of APACHE II score in group with active CMV infection was higher than group without .tive CMV infection, but not differ significantly (12.75 vs. 11.47; p=0,510). The Prevalence of active CMV infection in critically ill immunocompetent patient is relatively high (16/50; 32%) in ICU of Dr. Kariadi Hospital Semarang and the degree of severity due to APACHE II score was higher in group with active CMV infection than group without active CMV infection. A qualitative PCR testing was useful in the diagnosis of active CMV among immunocompeten critically-ill patients in the ICU. Key Words: Immunocompetent, critically ill, active CMV infection, PCR

Background : TLR4 Asp299Gly and TNF-α -308G/A polymorphisms have been shown to be associated with increased susceptibility and severity of infection. TLR4 Asp299Gly polymorphism could affect the host’s ability to respond to leptospira sp. TNF-α -308G/A polymorphism, is associated with the high producer of TNF-α.Methods : Total of 36 leptospirosis patients (IgM anti leptospira and MAT positive) and healthy individual with the equal number were included. The polymorphisms were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using site spesific restriction enzyme.Results : Distribution of homozygous wild-type TLR4 Asp299Gly polymorphism was higher in both of groups ( 94.5:97.2%.) and homozygous mutant allele was absent. There was not significantly difference of TLR4 Asp299Gly in leptospirosis patients and healthy group ( ρ=1.00; OR 0.5; 95%CI, 0.04-5.6) and between mild and severe leptospirosis (ρ=0.54; OR 1.54 ; 95% CI, 1.20-1.98). The presence of homozygous wild-type TNF-α -308G/A polymorphism was higher between leptospirosis patients and healthy group (100:94.5%) andhomozygous mutant allele was not found in both of the groups. No significantly different of TNF-α -308G>A polymorphism between leptospirosis patient and healthy group (ρ=0.49).Conclusions : In this study, the polymorphisms of TLR4 Asp299Gly and TNF-α -308G/A were not associated with the susceptibility and severity of leptospirosis. Keywords : Leptospirosis, TLR4 Asp299Gly polymorphism, TNF-α -308G/A polymorphism