Search

Malaria is a life-threatening parasitic disease which causes enormous morbidity and mortality in tropical African countries. Successful prevention and treatment of infected individuals heavenly depend on successful diagnosis using recommended techniques. These routine laboratory techniques have different performance indices. Therefore, this study aimed to evaluate the performance of Polymerase Chain Reaction and Microscopy in malaria diagnosis. A total of two hundred consented study subjects were randomly selected and enrolled for the research. Vein puncture technique was use to collect venus blood from the subjects and analysed using microscopy and Polymerase chain Reaction. DNA samples were extracted using Quick-DNA™ Miniprep Plus Kit with catalogue No. D4069. 18SrRNA gene of Plasmodium falciparum from chromosome 13 was amplified using the primers F5’AACAGACGGGTAGTCATGATTGAG3’ R5’GTATCTGATCGTCTTCACTCCC3’. Malaria prevalence of 167(83.50%) and 105(52.5%) were recorded using microscopy and Polymerase Chain Reaction. Microscopy had a sensitivity, specificity, Positive predictive value and negative predictive value of 84.91, 23.40, 55.53 and 57.89%, respectively, with an overall accuracy value of 0.81. Polymerase Chain Reaction had a sensitivity value of 53.89%, specificity of 54.54%, positive predictive value of 85.79% and Negative predictive value of 18.94% with an overall accuracy of 0.54. Microscopy and Polymerase Chain Reaction demonstrated significant accuracy and relatively good performance indices. Therefore Microscopy and Polymerase Chain Reaction are highly recommended as malaria diagnostic techniques, and further research should be carried out to determine the influence of some biological factors of both the parasite and the host on the outcome of the diagnosis using both Polymerase Chain Reaction and microscopy.

Deep learning; Malaria diagnosis; Microscopic examination Aprenentatge profund; Diagnòstic de malària; Examen microscòpic Aprendizaje profundo; Diagnóstico de malaria; Examen microscópico Malaria is an infectious disease caused by parasites of the genus Plasmodium spp. It is transmitted to humans by the bite of an infected female Anopheles mosquito. It is the most common disease in resource-poor settings, with 241 million malaria cases reported in 2020 according to the World Health Organization. Optical microscopy examination of blood smears is the gold standard technique for malaria diagnosis; however, it is a time-consuming method and a well-trained microscopist is needed to perform the microbiological diagnosis. New techniques based on digital imaging analysis by deep learning and artificial intelligence methods are a challenging alternative tool for the diagnosis of infectious diseases. In particular, systems based on Convolutional Neural Networks for image detection of the malaria parasites emulate the microscopy visualization of an expert. Microscope automation provides a fast and low-cost diagnosis, requiring less supervision. Smartphones are a suitable option for microscopic diagnosis, allowing image capture and software identification of parasites. In addition, image analysis techniques could be a fast and optimal solution for the diagnosis of malaria, tuberculosis, or Neglected Tropical Diseases in endemic areas with low resources. The implementation of automated diagnosis by using smartphone applications and new digital imaging technologies in low-income areas is a challenge to achieve. Moreover, automating the movement of the microscope slide and image autofocusing of the samples by hardware implementation would systemize the procedure. These new diagnostic tools would join the global effort to fight against pandemic malaria and other infectious and poverty-related diseases. The project is funded by the Microbiology Department of Vall d’Hebron Universitary Hospital, the Cooperation Centre of the Universitat Politècnica de Catalunya (CCD-UPC) and the Probitas Foundation.

Background Early malaria diagnosis and its profiling require the development of new sensing platforms enabling rapid and early analysis of parasites in blood or saliva, aside the widespread rapid diagnostic tests (RDTs). Methods This study shows the performance of a cost-effective optical fiber-based solution to target the presence of Plasmodium falciparum histidine-rich protein 2 (PfHRP2). Unclad multimode optical fiber probes are coated with a thin gold film to excite Surface Plasmon Resonance (SPR) yielding high sensitivity to bio-interactions between targets and bioreceptors grafted on the metal surface. Results Their performances are presented in laboratory conditions using PBS spiked with growing concentrations of purified target proteins and within in vitro cultures. Two probe configurations are studied through label-free detection and amplification using secondary antibodies to show the possibility to lower the intrisic limit of detection. Conclusions As malaria hits millions of people worldwide, the improvement and multiplexing of this optical fiber technique can be of great interest, especially for a future purpose of using multiple receptors on the fiber surface or several coated-nanoparticles as amplifiers.

Background Uganda's clinical management guidelines recommend a malaria laboratory test in all patients presenting with fever (history of fever or an axillary temperature ≥ 37.5 °C), and only those with a positive test receive anti-malarial treatment. However, the current practice in areas with declining malaria transmission remains unknown. This study assessed the clinicians’ diagnostic practices, the factors associated with recommending a test, and the risk of missing a malaria case when a test is not recommended in patients presenting with fever in Kampala, an area of declining malaria transmission in Uganda. Methods Between January and March 2020, 383 participants aged ≥ 12 years and presenting to Kisenyi Health Centre IV in Kampala district with fever were enrolled in the study. A questionnaire was administered during exit interviews, routine diagnostic practices were recorded from participant clinical notes, and a research blood slide was obtained for later reading. Results Of the enrolled participants, 356 (93%) had a malaria diagnostic test recommended by the clinician. Factors associated with increasing prevalence of having a test recommended included; history of overnight travel (adjusted prevalence ratio [aPR] 1.07, 95% confidence interval [CI] 1.02–1.13, p = 0.011), being married (aPR = 1.07, 95% CI 1.01–1.13, p = 0.022), and having tertiary education (aPR = 1.09 95% CI 1.01–1.17, p = 0.031). Among the 27 participants where a malaria diagnostic test was not recommended, 4 (14.8%) had a positive study smear. Conclusion Despite having significant declines in malaria transmission in Kampala in the last decade, clinicians at the study health facility highly adhered to the clinical management guidelines, recommending a malaria test in almost all patients presenting with fever. However, a significant proportion of malaria cases was missed when a test was not recommended. These results highlight the importance of laboratory testing for malaria in all patients who present with fevers and live in endemic settings even when the transmission has significantly declined.

Malaria rapid diagnosis test (RDT) is crucial for managing the disease, and the effectiveness of detection depends on parameters such as sensitivity and specificity of the RDT. Several factors can affect the performance of RDT. In this study, we focused on the pfhrp2 sequence variation and its impact on RDTs targeted by antigens encoded by Plasmodium falciparum histidine-rich protein 2 (pfhrp2). Field samples collected during cross-sectional surveys in Tanzania were sequenced to investigate the pfhrp2 sequence diversity and evaluate the impact on HRP2-based RDT performance. We observed significant mean differences in amino acid repeats between current and previous studies. Several new amino acid repeats were found to occur at different frequencies, including types AAY, AHHAHHAAN, and AHHAA. Based on the abundance of types 2 and 7 amino acid repeats, the binary predictive model was able to predict RDT insensitivity by about 69% in the study area. About 85% of the major epitopes targeted by monoclonal antibodies (MAbs) in RDT were identified. Our study suggested that the extensive sequence variation in pfhrp2 can contribute to reduced RDT sensitivity. The correlation between the different combinations of amino acid repeats and the performance of RDT in different malaria transmission settings should be investigated further.

Sıtma, tedavisiz olgularda ölümle sonuçlanabilen ve ciddi ateşli hastalığa yol açan bir enfeksiyon hastalığıdır. Bu yüzden bu hastalığın erken tanı ve tedavisi oldukça kritik öneme sahiptir. Gelişmiş teknolojilerle birlikte sıtma hastalığının teşhisine yönelik birçok klinik yöntem ve test kullanılmaktadır. Bu çalışmada Sıtma hastalığının teşhis edilmesi amacıyla son yıllarda doğal dil işleme alanında oldukça yüksek performans gösteren transformer yöntemlerden esinlenilerek önerilen Vision Transformer (ViT) yöntemi kullanılmaktadır. Elde edilen sonuçlar değerlendirildiğinde ViT yönteminin %97.22 gibi yüksek bir sınıflandırma performansı elde ettiği gözlemlenmiştir. Vit yöntemi ile elde edilen sonuçlar, literatürde uygulanan geleneksel ve derin öğrenme yöntemleri karşılaştırılmış ve bu sonuçlar karşılaştırmalı olarak tabloda sunulmuştur. Uygulanan ViT modelinin sıtma hastalığı tespitinde başarılı sonuç verdiği gözlemlenmiştir. Your Malaria is an infectious disease that can result in death in untreated cases and causes serious febrile illness. Therefore, early diagnosis and treatment of this disease is of critical importance. Along with advanced technologies, many clinical methods and tests are used for the diagnosis of malaria. In this study, the Vision Transformer (ViT) method, which has been inspired by the transformer methods that have shown very high performance in the field of natural language processing in recent years, is used to diagnose Malaria. When the obtained results were evaluated, it was observed that the ViT method achieved a high classification performance of 97.22%. The results obtained with the ViT method, traditional computer vision algorithms and deep learning methods applied in the literature were compared and the results were presented in a comparative table. It has been observed that the applied ViT model gives successful results in the detection of malaria.

Fraol Jaleta,1 Getinet Garoma,2 Tadesse Gerenfes3 1Department of Research and Public Health Emergency Preparedness, Adama Public Health Research and Referral Laboratory Centre, Adama, Ethiopia; 2Department of Capacity Building and Quality Assurance, Adama Public Health Research and Referral Laboratory Centre, Adama, Ethiopia; 3Department of Molecular Biology, Adama Public Health Research and Referral Laboratory Centre, Adama, EthiopiaCorrespondence: Fraol Jaleta Email firanoljako1387@gmail.comBackground: Prompt and accurate malaria diagnosis is an essential strategy for effective malaria case management as well as the public health response to malaria. Diagnosis based on clinical grounds alone may lead to misdiagnosis and mistreatment. The objective of this study is to evaluate the performance of malaria microscopy diagnosis in public hospitals of Eastern and Central part Oromia, Ethiopia.Methods: A hospital-based cross-sectional study was conducted from March 2019 to May 2019 in 46 public hospitals of Eastern and Central parts of the Oromia region. Data were collected using structured checklists and pre-prepared known validated positive and negative slides. It was categorized and cleaned by Epi Info version 3.5.1 and analyzed by SPSS version 20 to identify factors associated with poor malaria microscopy diagnosis. The level of agreement was calculated by kappa statistics.Results: From the total of 46 hospitals, 31 (67.39%) had an acceptable quality performance with a cumulative grading score of > 80%. The overall percentage of agreement in detection and species identification was 80.45% (kappa=0.79) and 63.03% (kappa=0. 38). Laboratory professionals who had work experience greater than five years were 10.56 times better in detecting and identifying malaria parasite when compared to those who had work experience less than or equal to five years (AOR [95% CI]=10.56 [1.45– 76.73]). Laboratory professionals who were trained in malaria microscopy diagnosis were 6.12 times reported better quality results than those who were not trained (AOR, % 95CI=6.12 [1.5– 48.13]).Conclusion: The overall agreement of laboratory professionals in detection and species identification was with had substantial and fair agreement with kappa values of 0.79 and 0.38, respectively. Lack of training and low work experience of laboratory professionals were factors associated with malaria microscopy diagnostic performance. Hence, capacitating laboratory professionals is essential to ensure good performance of malaria microscopy which reduces misdiagnosis of malaria parasites and mistreatment of malaria suspected patients.Keywords: malaria diagnosis, level of agreement, mistreatment, Oromia

Background: Early recurrence of Plasmodium vivax is a challenge for malaria control in the field, particularly because this species is associated with lower parasitemia, which hinders diagnosis and monitoring through blood smear testing. Early recurrences, defined as the persistence of parasites in the peripheral blood despite adequate drug dosages, may arise from resistance to chloroquine. The objective of the study was to estimate early recurrence of P. vivax in the Brazilian Amazon by using a highly-sensitive detection method, in this case, PCR. Methods: An ultra-sensitive qPCR that targeted mitochondrial DNA was used to compare a standard qPCR that targeted 18S rDNA to detect early recurrence of P. vivax in very low densities in samples from patients treated with chloroquine. Results: Out of a total of 312 cases, 29 samples (9.3%) were characterized as recurrences, from which 3.2% (10/312) were only detected through ultra-sensitive qPCR testing. Conclusions: Studies that report the detection of P. vivax early recurrences using light microscopy may severely underestimate their true incidence.

Pathogens may change the odor and odor-related biting behavior of the vector and host to enhance pathogen transmission. In recent years, volatile biomarker investigations have emerged to identify odors that are differentially and specifically released by pathogens and plants, or the pathogen-infected or even cancer patients. Several studies have reported odors or volatile biomarkers specifically detected from the breath and skin of malaria-infected individuals. This review will discuss the potential use of these odors or volatile biomarkers for the diagnosis of malaria. This approach not only allows for the non-invasive mean of sample collection but also opens up the opportunity to develop a biosensor for malaria diagnosis in low-resource settings.

Malaria eradication has for decades been on the global health agenda, but the causative agents of the disease, several species of the protist parasite Plasmodium, have evolved mechanisms to evade vaccine-induced immunity and to rapidly acquire resistance against all drugs entering clinical use. Because classical antimalarial approaches have consistently failed, new strategies must be explored. One of these is nanomedicine, the application of manipulation and fabrication technology in the range of molecular dimensions between 1 and 100 nm, to the development of new medical solutions. Here we review the current state of the art in malaria diagnosis, prevention, and therapy and how nanotechnology is already having an incipient impact in improving them. In the second half of this review, the next generation of antimalarial drugs currently in the clinical pipeline is presented, with a definition of these drugs’ target product profiles and an assessment of the potential role of nanotechnology in their development. Opinions extracted from interviews with experts in the fields of nanomedicine, clinical malaria, and the economic landscape of the disease are included to offer a wider scope of the current requirements to win the fight against malaria and of how nanoscience can contribute to achieve them. © 2021 by the authors. Licensee MDPI, Basel, Switzerland.

BACKGROUND Malaria diagnosis remains a key issue in remote area. The gold standard microscopy has limitations of its own and the commonly used rapid diagnostic tests have variable results. An artificial intelligence based digital cytometry platform was assessed for its comparison with microscopy and rapid diagnostics test in terms of accuracy and feasibility. METHODS 100 patients with complaints of fever with chills were included in the study. They were screened for malaria infection by microscopy of thin peripheral smear, antigen based rapid diagnostic test and digital cytometry. RESULTS At higher malaria parasite concentration, the results between microscopy and digital cytometry were matching exactly. But at lower parasite concentration microscopy had lower sensitivity than digital cytometry. When compared to rapid diagnostic tests the digital cytometry had advantage of better species identification and better sensitivity. CONCLUSIONS In our study, digital cytometry has greater sensitivity at lower parasite concentration as compared to rapid diagnostic test and microscopy. It was more accurate in species identification as compared to rapid diagnostic test.

Detailed description of malaria in low transmission areas is crucial for elimination. The current study aimed to provide a comprehensive description for malaria transmission in Jazan, a low transmission district, southwestern Saudi Arabia. Patients at a tertiary care hospital were recruited in our study between August 2016 and September 2018. Malaria diagnosis was performed through a species-specific nested polymerase chain reaction (nested PCR), microscopy and Paramax-3TM rapid detection test (RDT). Malaria was detected in 30 patients by the PCR, with point prevalence of 10.9%. Of these malaria infections, 80% was imported, 26.6% was asymptomatic and 23.3% was sub-microscopic. Malaria was reported throughout the year, with February/March and September/October peaks. Infection was significantly more in males than in females (P=0.01). Likewise, infections were detected more in febrile than in non-febrile patients (P=0.01). Adult aged 15-24 years, fever and travel were identified as high-risk factors. Malaria was primarily attributed to Plasmodium falciparum mono-infections, followed by P. vivax mono-infections and lastly to falciparum/vivax mixed infections accounting 76.6%, 16.6%, and 6.6% of PCR-confirmed malaria cases, respectively. The nested PCR was superior to the smear microscopy (sensitivity 76.6%; specificity 100%) and the RDT (sensitivity 83.3%, specificity 94.2%). The overall percent agreement between microscopy and the RDT was 92.7% (kappa=0.63). High proportion of imported malaria including sub-microscopic and sub-patent cases were described. We suggest that incorporation of molecular tool into the conventional malaria diagnosis is beneficial in Jazan district.

Background Point-of-care glucose-6-phosphate dehydrogenase (G6PD) testing has the potential to make the use of radical treatment for vivax malaria safer and more effective. Widespread use of G6PD tests as part of malaria case management has been limited, in part due to due concerns regarding product usability, user training, and supervision. This study seeks to assess how well end users can understand the Standard™ G6PD Test (SD Biosensor, Suwon, South Korea) workflow, result output, and label after training. This will ultimately help inform test registration and introduction. Methods Potential G6PD test users who provide malaria case management at three sites in Brazil, Ethiopia, and India were trained on the use of the SD Biosensor Standard G6PD Test and assessed based on their ability to understand the test workflow and interpret results. The assessment was done through a questionnaire, designed to assess product usability against key technical product specifications and fulfill regulatory evidence requirements. Any participant who obtained 85% or above correct responses to the questionnaire was considered to adequately comprehend how to use and interpret the test. Results Forty-five participants, including malaria microscopists, laboratory staff, nurses, and community health workers took part in the study. Seventy-eight percent of all participants in the study (35/45) obtained passing scores on the assessment with minimal training. Responses to the multiple-choice questions indicate that most participants understood well the test intended use, safety claims, and warnings. The greatest source of error regarding the test was around the correct operating temperature. Most test results were also read and interpreted correctly, with the haemoglobin measurement being a more problematic output to interpret than the G6PD measurement. Conclusions These data results show how a standardized tool can be used to assess a user’s ability to run a point-of-care diagnostic and interpret results. When applied to the SD Biosensor Standard G6PD Test, this tool demonstrates that a range of users across multiple contexts can use the test and suggests improvements to the test instructions and training that can improve product usability, increase user comprehension, and ultimately contribute to more widespread effective use of point-of-care G6PD tests. Trial registration: NCT04033640

Background Deletion of pfhrp2 and/or pfhrp3 genes cause false negatives in malaria rapid diagnostic test (RDT) and threating malaria control strategies. This systematic review aims to assess the main methodological aspects in the study of pfhrp2 and pfhrp3 gene deletions and its global epidemiological status, with special focus on their distribution in Africa; and its possible impact in RDT. Methods The systematic review was conducted by examining the principal issues of study design and methodological workflow of studies addressing pfhrp2 deletion. Meta-analysis was applied to represent reported prevalences of pfhrp2 and pfhrp3 single and double deletion in the World Health Organization (WHO) region. Pooled-prevalence of deletions was calculated using DerSimonnian-Laird random effect model. Then, in-deep analysis focused on Africa was performed to assess possible variables related with these deletions. Finally, the impact of these deletions in RDT results was analysed combining reported information about RDT sensitivity and deletion prevalences. Results 49 articles were included for the systematic review and 37 for the meta-analysis, 13 of them placed in Africa. Study design differs significantly, especially in terms of population sample and information reported, resulting in high heterogeneity between studies that difficulties comparisons and merged conclusions. Reported prevalences vary widely in all the WHO regions, significantly higher deletion were reported in South-Central America, following by Africa and Asia. Pfhrp3 deletion is more prevalent (43% in South-Central America; 3% in Africa; and 1% in Asia) than pfhrp2 deletion (18% in South-Central America; 4% in Africa; and 3% in Asia) worldwide. In Africa, there were not found differences in deletion prevalence by geographical or population origin of samples. The prevalence of deletion among false negatives ranged from 0 to 100% in Africa, but in Asia and South-Central America was only up to 90% and 48%, respectively, showing substantial relation between deletions and false negatives. Conclusion The concerning prevalence of pfhrp2, pfhrp3 and pfhrp2/3 gene deletions, as its possible implications in malaria control, highlights the importance of regular and systematic surveillance of these deletions. This review has also outlined that a standardized methodology could play a key role to ensure comparability between studies to get global conclusions.

BackgroundA new more highly sensitive rapid diagnostic test (HS-RDT) forPlasmodium falciparummalaria (Alere™/Abbott Malaria Ag P.f RDT [05FK140], now calledNxTek™Eliminate Malaria Ag Pf) was launched in 2017. The test has already been used in many research studies in a wide range of geographies and use cases.MethodsIn this study, we collate all published and available unpublished studies that use the HS-RDT and assess its performance in (i) prevalence surveys, (ii) clinical diagnosis, (iii) screening pregnant women, and (iv) active case detection. Two individual-level data sets from asymptomatic populations are used to fit logistic regression models to estimate the probability of HS-RDT positivity based on histidine-rich protein 2 (HRP2) concentration and parasite density. The performance of the HS-RDT in prevalence surveys is estimated by calculating the sensitivity and positive proportion in comparison to polymerase chain reaction (PCR) and conventional malaria RDTs.ResultsWe find that across 18 studies, in prevalence surveys, the mean sensitivity of the HS-RDT is estimated to be 56.1% (95% confidence interval [CI] 46.9–65.4%) compared to 44.3% (95% CI 32.6–56.0%) for a conventional RDT (co-RDT) when using nucleic acid amplification techniques as the reference standard. In studies where prevalence was estimated using both the HS-RDT and a co-RDT, we found that prevalence was on average 46% higher using a HS-RDT compared to a co-RDT. For use in clinical diagnosis and screening pregnant women, the HS-RDT was not significantly more sensitive than a co-RDT.ConclusionsOverall, the evidence presented here suggests that the HS-RDT is more sensitive in asymptomatic populations and could provide a marginal improvement in clinical diagnosis and screening pregnant women. Although the HS-RDT has limited temperature stability and shelf-life claims compared to co-RDTs, there is no evidence to suggest, given this test has the same cost as current RDTs, it would have any negative impacts in terms of malaria misdiagnosis if it were widely used in all four population groups explored here.

Background Malaria is a potentially lethal parasitic disease due to infection by Plasmodium parasites, transmitted by Anopheles mosquito vectors. Various preventative measures may be recommended for travellers who visit endemic areas. The diagnosis is generally evoked in the context of a febrile patient returning from an endemic zone. Nevertheless, symptoms and clinical signs may be difficult to interpret, and fatal cases may only be diagnosed retrospectively with laboratory techniques, specific pathological features and patient history. The present work reports a case of fatal cerebral malaria diagnosed post-mortem, along with the techniques that allowed identification of the causative agent. Case presentation A 29 year-old male was found dead in his rental home during a vacation in Southern France. In the absence of explainable cause, an autopsy was performed, which did not retrieve major lesions. In the context of frequent business-related travels in tropical Africa, several samples were adressed for parasitological examination. Microscopy techniques, along with immunochromatographic and molecular biology assays, led to post-mortem diagnosis of fatal cerebral malaria. It was discovered in retrospect that the patient had not used preventative measures against malaria when travelling in endemic zones, and had not been provided with proper travel medicine counseling prior to his travel. Conclusion A vast proportion of imported malaria cases reported in France concerns patients who did not use preventive measures, such as bed nets, repellents or chemoprophylaxis. Given the wide availability of prevention tools in developed countries, and the important number of declared imported malaria cases, there is no doubt traveller awareness still needs to be raised. Moreover, healthcare professionals should always question travel history in febrile patients. The authors advocate for recurrent information campaigns for travellers, and physician training for a better prevention and diagnosis of malaria cases.

Background Prompt detection and appropriate treatment of malaria prevents severe disease and death. The quality of care for adult malaria in-patients is not well documented in sub-Saharan Africa, particularly in Uganda. The study sought to describe the patterns of malaria diagnosis and treatment among adult in-patients admitted to the medical and gynaecological wards of Uganda’s 1790-bed Mulago National Referral Hospital from December 2013 to April 2014. Methods A prospective cohort of 762 consented in-patients aged ≥ 18 years was assembled. Proportions of in-patients who received preadmission and in-hospital anti-malarials, missed Day 1 dosing of hospital-initiated anti-malarials and/or had malaria microscopy done were determined. Multivariable logistic regression was used to identify risk-factors for missed Day 1 dosing of anti-malarials. Results One in five (19%, 146/762) in-patients had an admission or discharge malaria diagnosis or both; with median age of 29 years (IQR, 22–42 years). Microscopy was requested in 77% (108/141) of in-patients with an admission malaria diagnosis; results were available for 46% (50/108), of whom 42% (21/50) tested positive for Plasmodium falciparum malaria parasitaemia. Only 13% (11/83) of in-patients who received in-hospital injectable artesunate (AS) or quinine (Q) received follow-up oral artemether-lumefantrine (AL); 2 of 18 severe malaria cases received follow-up oral AL. Injectable AS only (47%, 47/100) was the most frequent hospital-initiated anti-malarial treatment followed by injectable Q only (23%, 23/100) amongst in-patients who received in-hospital anti-malarials. A quarter (25%, 25/100; 95% CI: 17–35%) of in-patients missed Day 1 dosing of hospital-initiated anti-malarials. Each additional admission diagnosis was more than two-fold likely to increase the odds of missed Day 1 dosing of in-hospital anti-malarials (aOR = 2.6, 95% CI: 1.52–4.56; P-value = 0.001). Conclusions Half the malaria microscopy results were not available; yet, the rate of testing was high. The majority of in-patients initiated on injectable AS or Q did not receive the recommended follow-up oral AL. One in four in-patients delayed to initiate hospital anti-malarials by at least one calendar day. The hospital should encourage prompt availability of malaria test-results to promote the timely initiation and completion of anti-malarial treatment, thereby improving the quality of care for hospitalized malaria patients in Uganda.

We thank the Shirley Boyde Trust for their generous support through a Shirley Boyde Foundation Grant to J.A.T. and acknowledge Institut Pasteur funding to M.H., A.H., P.R., and F.L.-A.. J.A.T. acknowledges The University of Hong Kong Outstanding Young Researcher Award 2015-16, The University of Hong Kong Outstanding Research Student Supervisor Award 2016-2017, and The University of Hong Kong Seed Fund for Basic Research grants 201711159185 and 201611159269. We thank the staff of the platform for production and purification of recombinant proteins of Institut Pasteur for technical assistance during the expression and purification of the proteins steps and the staff of the crystallography platform at Institut Pasteur for carrying out robot-driven crystallization screening. We acknowledge synchrotron SOLEIL (Saint-Aubin, France) for granting access to their facility and the staff of Proxima1 for helpful assistance during the data collection.; International audience; for the overall study design and data interpretation. Y.W.C. performed all cubamer selections, characterized the cubamers and oversaw all application experiments. A.W.C.W., Y.L., and A.B.K. were involved in aspects of cubamer characterization and in assay design. F.L.-A. expressed and purified the proteins and performed the biochemical characterization of the triphosphate. P.R. performed all chemical syntheses and was involved in aspects of experimental design of cubamer structural analysis. P.R. was also significantly involved in all data interpretation. G.P.S. was involved in steps of synthesis relating to cubanes and advised on study design.

Malaria is one of the leading causes of death worldwide. According to the World Health Organization’s (WHO’s) world malaria report for 2018, there were 228 million cases and 405,000 deaths worldwide. This paper reviews and highlights the importance of accurate, sensitive and affordable diagnostic methods in the fight against malaria. The PubMed online database was used to search for publications that examined the different diagnostic tests for malaria. Currently used diagnostic methods include microscopy, rapid diagnostic tests (RDT), and polymerase chain reaction (PCR). Upcoming methods were identified as loop-mediated isothermal amplification (LAMP), nucleic acid sequence-based amplification (NASBA), isothermal thermophilic helicase-dependent amplification (tHDA), saliva-based test for nucleic-acid amplification, saliva-based test for Plasmodium protein detection, urine malaria test (UMT), and transdermal hemozoin detection. RDT, despite its increasing false negative, is still the most feasible diagnostic test because it is easy to use, fast, and does not need expensive equipment. Noninvasive tests that do not require a blood sample, but use saliva or urine, are some of the recent tests under development that have the potential to aid malaria control and elimination. Emerging resistance to anti-malaria drugs and to insecticides used against vectors continues to thwart progress in controlling malaria. Therefore, future innovation will be required to enable the application of more sensitive and affordable methods in resource-limited settings.

Background: In rural areas of Indonesia, where parasitological tests are not always available, a knowledge of significant symptoms and non-symptom-related factors is crucial for clinical diagnosis of malaria in order to take appropriate actions for treatment. Malaria diagnosis at early stages can avoid a progression in severity of the conditions and possible transmission of the disease. With insufficient knowledge of significant malaria symptoms and non-symptom-related factors for clinical diagnosis of malaria, medical doctors may presumptively treat febrile patients, which leads to an increase in resistance to antimalarial drugs.Methods: The study involves five stages. First, medical records are collected from patients suffering from malaria and other febrile diseases such as dengue fever, typhoid fever, respiratory tract infection, dyspepsia, pneumonia, common cold and gastritis. The records are obtained from two public hospitals in endemic regions in Indonesia’s East Nusa Tenggara Province, East Sumba and Lembata. Second, interviews with eight Indonesian medical doctors are conducted to understand the symptoms and non-symptom-related factors they use for clinical diagnosis of malaria. Third, symptoms and non-symptom-related factors from 472 collected medical records are selected and ranked using the correlation matrix method. Fourth, the 17 feature sets extracted from the ranked features are used to develop and compare various malaria classifiers using three machine-learning techniques, including logistic regression, support vector machines and k-nearest neighbors. Fifth, the most significant symptoms and non-symptom-related factors are identified for malaria diagnosis using the malaria classifiers developed. In addition, further experiments and comparisons are conducted to examine the performance of malaria classifiers using various feature sets.Results: (a) Out of 17 features identified from medical records, six significant symptoms (duration of fever, headache, nausea and vomiting, heartburn, pain and severe symptoms), and two non-symptom-related factors (history of malaria and age) contribute most to malaria diagnosis. These significant features can be used for malaria diagnosis with an average 85% accuracy. (b) As a symptom, duration of fever is more significant than temperature or fever for distinguishing malaria from other febrile diseases. (c) Trios malaria symptoms (fever, shivering and sweating) are shown to be less significant than other symptoms in endemic regions.Conclusions: The findings of this study can be used to raise the public awareness of significant malaria symptoms and non-symptom-related factors within societies vulnerable to malaria. These findings can also be used for helping unexperienced medical doctors with clinical diagnosis of malaria especially in rural areas, where the availability of parasitological tests is scarce.

Background Sampling of saliva for diagnosing Plasmodium falciparum infections is a safe, non-invasive alternative to sampling of blood. However, the use of saliva presents a challenge because lower concentrations of parasite DNA are present in saliva compared to peripheral blood. Therefore, a sensitive method is needed for detection of parasite DNA in saliva. This study utilized two recently reported “ultra-sensitive” PCR assays based on detection of the P. falciparum mitochondrial cox3 gene and the multi-copy nuclear varATS gene. The ultra-sensitive assays have an advantage over standard 18S rRNA gene-based PCR assay as they target genes with higher copy numbers per parasite genome. Stored saliva DNA samples from 60 Cameroonian individuals with infections previously confirmed by 18S rRNA gene PCR in peripheral blood were tested with assays targeting the cox3 and varATS genes. Results Overall, the standard 18S rRNA gene-based PCR assay detected P. falciparum DNA in 62% of the stored saliva DNA samples, whereas 77 and 68% of the samples were positive with assays that target the cox3 and varATS genes, respectively. Interestingly, the ultra-sensitive assays detected more P. falciparum infections in stored saliva samples than were originally detected by thick-film microscopy (41/60 = 68%). When stratified by number of parasites in the blood, the cox3 assay successfully detected more than 90% of infections using saliva when individuals had > 1000 parasites/μl of peripheral blood, but sensitivity was reduced at submicroscopic parasitemia levels. Bands on electrophoresis gels were distinct for the cox3 assay, whereas faint or non-specific bands were sometimes observed for varATS and 18S rRNA that made interpretation of results difficult. Assays could be completed in 3.5 and 3 h for the cox3 and varATS assays, respectively, whereas the 18S rRNA gene assays required at least 7 h. Conclusions This study demonstrates that a PCR assay targeting the cox3 gene detected P. falciparum DNA in more saliva samples than primers for the 18S rRNA gene. Non-invasive collection of saliva in combination with the proposed cox3 primer-based PCR assay could potentially enhance routine testing of P. falciparum during disease surveillance, monitoring, and evaluation of interventions for malaria elimination. Electronic supplementary material The online version of this article (10.1186/s41182-018-0100-2) contains supplementary material, which is available to authorized users.

Molecular techniques have been introduced for malaria diagnosis because they offer greater sensitivity and specificity than microscopic examinations. Therefore, DNA isolation methods have been developed for easy preparation and cost effectiveness. The present study described a simple protocol for Plasmodium DNA isolation from EDTA-whole blood. This study demonstrated that after heating infected blood samples with Tris-EDTA buffer and proteinase K solution, without isolation and purification steps, the supernatant can be used as a DNA template for amplification by PCR. The sensitivity of the extracted DNA of Plasmodium falciparum and Plasmodium vivax was separately analyzed by both PCR and semi-nested PCR (Sn-PCR). The results revealed that for PCR the limit of detection was 40 parasites/μl for P. falciparum and 35.2 parasites/μl for P. vivax, whereas for Sn-PCR the limit of detection was 1.6 parasites/μl for P. falciparum and 1.4 parasites/μl for P. vivax. This new method was then verified by DNA extraction of whole blood from 11 asymptomatic Myanmar migrant workers and analyzed by Sn-PCR. The results revealed that DNA can be extracted from all samples, and there were 2 positive samples for Plasmodium (P. falciparum and P. vivax). Therefore, the protocol can be an alternative method for DNA extraction in laboratories with limited resources and a lack of trained technicians for malaria diagnosis. In addition, this protocol can be applied for subclinical cases, and this will be helpful for epidemiology and control.

Background Since 2004, Kenya’s national malaria treatment guidelines have stipulated artemisinin-based combination therapy (ACT) as first-line treatment for uncomplicated malaria, and since 2014, confirmatory diagnosis of malaria in all cases before treatment has been recommended. A number of strategies to support national guidelines have been implemented in the public and private sectors in recent years. A nationally-representative malaria outlet survey, implemented across four epidemiological zones, was conducted between June and August 2016 to provide practical evidence to inform strategies and policies in Kenya towards achieving national malaria control goals. Results A total of 17,852 outlets were screened and 2271 outlets were eligible and interviewed. 78.3% of all screened public health facilities stocked both malaria diagnostic testing and quality-assured ACT (QAACT). Sulfadoxine–pyrimethamine (SP) for intermittent preventive treatment in pregnancy was available in 70% of public health facilities in endemic areas where it is recommended for treatment. SP was rarely found in the public sector outside of the endemic areas (

Background Malaria case management continues to experience dynamic changes. Building community capacity is instrumental in both prevention and treatment of malaria. The World Health Organization (WHO) recommends utilization of well-trained and supervised community health workers (CHWs) to reduce the burden of malaria deaths among children under-5 years of age in Africa. Longitudinally-tracked information on utilization of CHWs by communities in terms of trends in diagnosis of malaria in children under-5 years of age is essential in influencing national and local malaria control policies and strategies. Methods A desktop review was carried out of a database consisting of confirmed uncomplicated malaria cases in 10 villages using CHWs and out-patient departments of 10 health facilities in children under-five for the period of 3 years between January 2013 and December 2015. Analyses of association between the diagnosed cases and satellite-based rainfall, village and time (months and years) were carried out using a Poisson regression model. Results Analysis of malaria diagnoses made by CHWs showed the following trends: (i) the incidence of reported documented malaria-positive fever cases increased with time (2013–2015) and the difference over the years was statistically significant (P 0.1). Looking at the number of diagnoses made at the health facilities, (i) The number of reported malaria-positive fever cases decreased with time (2013–2015) and the difference among the years was not statistically significant (P = 0.399), (ii) The long-term monthly sequence starting from highest to lowest number of reported malaria-positive fever cases was July, June, May, April, January, August, March, February, September, November, October and December, and the difference between the months was statistically significant (P

In this article we introduce a malaria infected microscopic images dataset for contrast enhancement which assist for malaria diagnosis more accurately. The dataset contains around two hundred malaria infected, normal, species and various stages of microscopic blood images. We propose and experimentally demonstrate a contrast enhancement technique for this dataset. This simple technique increases the contrast of an image and hence, reveals significant information about malaria infected cells. Experiments on the dataset show the superior performance of our proposed method for contrast enhancement of malaria microscopic imaging. Keywords: Malaria diagnosis, Low contrast images, Histogram equalization, Microscopic RGB blood images, Contrast enhancement

Background Epidemiological surveys of malaria currently rely on microscopy, polymerase chain reaction assays (PCR) or rapid diagnostic test kits for Plasmodium infections (RDTs). This study investigated whether mid-infrared (MIR) spectroscopy coupled with supervised machine learning could constitute an alternative method for rapid malaria screening, directly from dried human blood spots. Methods Filter papers containing dried blood spots (DBS) were obtained from a cross-sectional malaria survey in 12 wards in southeastern Tanzania in 2018/19. The DBS were scanned using attenuated total reflection-Fourier Transform Infrared (ATR-FTIR) spectrometer to obtain high-resolution MIR spectra in the range 4000 cm−1 to 500 cm−1. The spectra were cleaned to compensate for atmospheric water vapour and CO2 interference bands and used to train different classification algorithms to distinguish between malaria-positive and malaria-negative DBS papers based on PCR test results as reference. The analysis considered 296 individuals, including 123 PCR-confirmed malaria positives and 173 negatives. Model training was done using 80% of the dataset, after which the best-fitting model was optimized by bootstrapping of 80/20 train/test-stratified splits. The trained models were evaluated by predicting Plasmodium falciparum positivity in the 20% validation set of DBS. Results Logistic regression was the best-performing model. Considering PCR as reference, the models attained overall accuracies of 92% for predicting P. falciparum infections (specificity = 91.7%; sensitivity = 92.8%) and 85% for predicting mixed infections of P. falciparum and Plasmodium ovale (specificity = 85%, sensitivity = 85%) in the field-collected specimen. Conclusion These results demonstrate that mid-infrared spectroscopy coupled with supervised machine learning (MIR-ML) could be used to screen for malaria parasites in human DBS. The approach could have potential for rapid and high-throughput screening of Plasmodium in both non-clinical settings (e.g., field surveys) and clinical settings (diagnosis to aid case management). However, before the approach can be used, we need additional field validation in other study sites with different parasite populations, and in-depth evaluation of the biological basis of the MIR signals. Improving the classification algorithms, and model training on larger datasets could also improve specificity and sensitivity. The MIR-ML spectroscopy system is physically robust, low-cost, and requires minimum maintenance.

Surveillance and diagnosis of Plasmodium falciparum malaria relies predominantly on rapid diagnostic tests (RDTs). However, false-negative RDT results are known to occur for a variety of reasons, including operator error, poor storage conditions, pfhrp2/3 gene deletions, poor performance of specific RDT brands and lots, and low-parasite-density infections. We used RDT and microscopy results from 85,000 children enrolled in Demographic Health Surveys and Malaria Indicator Surveys from 2009 to 2015 across 19 countries to explore the distribution of and risk factors for false-negative RDTs in Sub40 Saharan Africa, where malaria’s impact is greatest. We sought to (i) identify spatial and demographic patterns of false-negative RDT (FN-RDT) results, defined as a negative RDT but positive gold-standard microscopy test, and (ii) estimate the percentage of infections missed within community-based malaria surveys due to FN-RDT results. Across all studies, 19.9% [95% CI: 19.0 – 20.9] of microscopy-positive subjects were negative by RDT. The distribution of FN-RDT results was spatially heterogeneous. The variance in FN-RDT results was best explained by the prevalence of malaria, with an increase in FN46 RDT results observed at lower transmission intensities, among younger subjects, and in urban areas. The observed proportion of FN-RDT results was not predicted by differences in RDT brand or lot performance alone. These findings characterise how the probability of detection by RDTs varies in different transmission settings and emphasize the need for careful interpretation of prevalence estimates based on surveys employing RDTs alone. Further studies are needed to characterise the cost-effectiveness of improved malaria diagnostics (e.g. PCR or highly sensitive RDTs) in community52 based surveys, especially in regions of low transmission intensity or high urbanicity.

The accuracy, reliability, speed and cost of the methods used for malaria diagnosis are key to the diseases&rsquo, treatment and eventual eradication. However, improvement in any one of these requirements can lead to deterioration of the rest due to their interdependence. We propose an optical method that provides fast detection of malaria-infected red blood cells (RBCs) at a lower cost. The method is based on the combination of deconvolution, topography and three-dimensional (3D) refractive index reconstruction of the malaria-infected RBCs by use of the transport of intensity equation. Using our method, healthy RBCs were identified by their biconcave shape, quasi-uniform spatial distribution of their refractive indices and quasi-uniform concentration of hemoglobin. The values of these optical and biochemical parameters were found to be in agreement with the values reported in the literature. Results for the malaria-infected RBCs were significantly different from those of the healthy RBCs. The topography of the cells and their optical and biochemical parameters enabled identification of their stages of infection. This work introduces a significant method of analyzing malaria-infected RBCs at a lower cost and without the use of fluorescent labels for the parasites.

Surveillance and diagnosis of Plasmodium falciparum malaria relies predominantly on rapid diagnostic tests (RDT). However, false-negative (FN) RDT results are known to occur for a variety of reasons, including operator error, poor storage conditions, pfhrp2/3 gene deletions, poor performance of specific RDT brands and lots, and low-parasite density infections. We used RDT and microscopy results from 85 000 children enrolled in Demographic Health Surveys and Malaria Indicator Surveys from 2009 to 2015 across 19 countries to explore the distribution of and risk factors for FN-RDTs in sub-Saharan Africa, where malaria’s impact is greatest. We sought to (1) identify spatial and demographic patterns of FN-RDT results, defined as a negative RDT but positive gold standard microscopy test, and (2) estimate the percentage of infections missed within community-based malaria surveys due to FN-RDT results. Across all studies, 19.9% (95% CI 19.0% to 20.9%) of microscopy-positive subjects were negative by RDT. The distribution of FN-RDT results was spatially heterogeneous. The variance in FN-RDT results was best explained by the prevalence of malaria, with an increase in FN-RDT results observed at lower transmission intensities, among younger subjects, and in urban areas. The observed proportion of FN-RDT results was not predicted by differences in RDT brand or lot performance alone. These findings characterise how the probability of detection by RDTs varies in different transmission settings and emphasise the need for careful interpretation of prevalence estimates based on surveys employing RDTs alone. Further studies are needed to characterise the cost-effectiveness of improved malaria diagnostics (eg, PCR or highly sensitive RDTs) in community-based surveys, especially in regions of low transmission intensity or high urbanicity.

In this issue of the Biomedical Journal, we explore the powerful immunosuppressive properties of tolerogenic dendritic cells and discuss their potential to bring about lifelong tolerance in transplantation and autoimmune disease. We also highlight an exciting new development in the field of malaria diagnosis that could facilitate early detection of the disease.

Background Early and accurate diagnosis of malaria is critical to the success of malaria elimination. However, the current mainstay of malaria diagnosis in the field, such as light microscopy and rapid diagnostic tests (RDTs), have limitations due to low parasite density or mutation in diagnostic markers. Methods We evaluated an inexpensive, robust, rapid, malaria diagnostic device, called Gazelle, that employs magneto-optical detection to identify haemozoin crystals (Hz) produced by all species of human malaria parasites in infected individuals. A beam of polarised light is passed through the lysed diluted blood sample under the influence of high (~.55T) and low magnetic fields. The difference in light transmission through the sample between the high and low magnetic fields indicates presence of Hz, suggesting possible malarial infection. A total of 300 febrile patients were screened at the malaria clinic of Indian Council of Medical Research-National Institute of Research in Tribal Health (ICMR-NIRTH), Jabalpur, India, from August 2018 to November 2018. Malaria diagnosis was done using four diagnostic methods: Gazelle, light microscopy, RDT, and malaria specific Polymerase Chain Reaction (PCR). Measures of diagnostic accuracy were compared. Findings Out of 300 febrile patients enroled and tested for the presence of malaria parasites, 262 patient samples were included in the final analysis. The sensitivity and specificity of Gazelle was 98% and 97% in comparison to light microscopy, 82% and 99% to PCR and 78% and 99% to RDT, respectively. The results of the four diagnostic methods were comparable and statistically no significant differences in sensitivity or specificity was observed between these methods. Enhanced diagnostic accuracy of Gazelle in malaria patients with no prior history of malaria treatment was observed in this study. Interpretation The diagnostic ability of Gazelle was comparable to light microscopy and better than RDTs even in low parasitemia and in presence of pfhrp2/3 deletion mutant parasites. Gazelle may be a novel valuable diagnostic tool in resource poor settings where (i) microscopy is not feasible and (ii) pfhrp2/3gene deleted parasite are present. Its speed, cost-efficiency, and alternative to lack of microscopists makes it an important adjunct in field settings. Funding HemexDx, India.

Objective Rapid diagnostic tests have been of tremendous help in malaria control in endemic areas, helping in diagnosis and treatment of malaria cases. It is heavily relied upon in many endemic areas where microscopy cannot be obtained. However, caution should be taken in the interpretation of its result in clinical setting due to its limitations and inherent weakness. This paper seeks to present the varying malaria RDT test results, the possible interpretations and explanation of these results common in endemic regions. Published works on malaria RDT studies were identified using the following search terms “malaria RDT in endemic areas”, “Plasmodium falciparum and bacterial coinfection” “Plasmodium falciparum RDT test results in children in endemic areas” in Google Scholar and PubMed. Results The review results show that RDT positive results in febrile patients can either be true or false positive. True positive, representing either a possible single infection of Plasmodium or a co-infection of bacteria and P. falciparum. False RDT negative results can be seen in febrile patient with P. falciparum infection in prozone effect, Histidine rich protein 2 (HRP2) gene deletion and faulty RDT kits. Hence, a scale up of laboratory facilities especially expert microscopy and other diagnostic tools is imperative.

Background Community health workers (CHWs) were trained to identify children with malaria who could not take oral medication, treat them with rectal artesunate (RA) and refer them to the closest healthcare facility to complete management. However, many children with such symptoms did not seek CHWs’ care. The hypothesis was that the cost of referral to a health facility was a deterrent. The goal of this study was to compare the out-of-pocket costs and time to seek treatment for children who sought CHW care (and received RA) versus those who did not. Methods Children with symptoms of severe malaria receiving RA at CHWs and children with comparable disease symptoms who did not go to a CHW were identified and their parents were interviewed. Household out-of-pocket costs per illness episode and speed of treatment were evaluated and compared between RA-treated children vs. non-RA treated children and by central nervous symptoms (CNS: repeated convulsions, altered consciousness or coma). Results Among children with CNS symptoms, costs of RA-treated children were similar to those of non-RA treated children ($5.83 vs. $4.65; p = 0.52), despite higher transport costs ($2.74 vs. $0.91; p

Background Rapid diagnostic tests based on histidine-rich protein 2 (HRP2) detection are the primary tools used to detect Plasmodium falciparum malaria infections. Recent conflicting reports call into question whether α-HRP2 antibodies are present in human host circulation and if resulting immune complexes could interfere with HRP2 detection on malaria RDTs. This study sought to determine the prevalence of immune-complexed HRP2 in a low-transmission region of Southern Zambia. Methods An ELISA was used to quantify HRP2 in patient sample DBS extracts before and after heat-based immune complex dissociation. A pull-down assay reliant on proteins A, G, and L was developed and applied for IgG and IgM capture and subsequent immunoprecipitation of any HRP2 present in immune complexed form. A total of 104 patient samples were evaluated using both methods. Results Immune-complexed HRP2 was detectable in 17% (18/104) of all samples evaluated and 70% (16/23) of HRP2-positive samples. A majority of the patients with samples containing immune-complexed HRP2 had P. falciparum infections (11/18) and were also positive for free HRP2 (16/18). For 72% (13/18) of patients with immune-complexed HRP2, less than 10% of the total HRP2 present was in immune-complexed form. For the remaining samples, a large proportion (≥ 20%) of total HRP2 was complexed with α-HRP2 antibodies. Conclusions Endogenous α-HRP2 antibodies form immune complexes with HRP2 in the symptomatic patient population of a low-transmission area in rural Southern Zambia. For the majority of patients, the percentage of HRP2 in immune complexes is low and does not affect HRP2-based malaria diagnosis. However, for some patients, a significant portion of the total HRP2 was in immune-complexed form. Future studies investigating the prevalence and proportion of immune-complexed HRP2 in asymptomatic individuals with low HRP2 levels will be required to assess whether α-HRP2 antibodies affect HRP2 detection for this portion of the transmission reservoir. Electronic supplementary material The online version of this article (10.1186/s12936-018-2400-8) contains supplementary material, which is available to authorized users.

Malaria affects over half of the world’s population and causes half a million deaths annually, especially in Sub-Saharan Africa. Four species of the apicomplexan Plasmodium parasite (P. falciparum, P. ovale, P. malariae and P. vivax) are responsible for malaria in Africa. Both parasite and host factors contribute to heterogeneity in the risk of developing malaria, clinical manifestation of the disease as well as the number of treatments required to clear parasites. The epidemiology of the different species, and the role of exposure to mixed-species Plasmodium co-infections in generating heterogeneity remains poorly studied. Being an obligate intracellular parasite the blood-stage life cycle of the Plasmodium parasite takes place in the erythrocytes of the human host. The surfaces of these erythrocytes are the medically important ABO blood group antigens that have been reported to influence the susceptibility or otherwise of an individual developing severe malaria. In this thesis I have considered the contributions of the species of Plasmodium parasites and the ABO blood group of the host in driving heterogeneity in human malaria. The aims of this thesis were to determine: (i) the seroepidemiology of the different Plasmodium species in two mesoendemic African populations (Zimbabwe and Sudan); (ii) to determine if heterogeneity in clinical presentations of malaria (history of fever, body temperature and parasitaemia) and response to drug treatment is related to exposure to single vs. mixed-Plasmodium species infection; (iii) the spatial and temporal dynamics of malaria prevalence and Plasmodium species distribution in a mesoendemic village in eastern Sudan; (iv) gene expression changes in 3D7 P. falciparum parasites as they infect erythrocytes of different ABO blood group donors. For aims (i to iii) I developed an enzyme-linked immunosorbent assay using antigens derived from Plasmodium merozoite surface protein 1, also known as MSP-119, to detect IgG antibodies to all four malaria parasite species in Zimbabwean and Sudanese populations. In the Zimbabwean study, plasma samples from 100 individuals each (aged 5-18 years) from three villages (Burma Valley, Mutoko and Chiredzi) were screened for exposure to Plasmodium parasites. In Daraweesh, Sudan, plasma samples from 333 individuals (aged 1-74 years) who had experienced a first malaria episode between 1990 and 2000 were recruited into the study. For study aim (iv) I cultured a single clone of 3D7 P. falciparum parasite using erythrocytes of individuals of different ABO blood group types, harvested parasite RNA and sequenced it to determine gene expression changes in the different hosts. I showed that human IgG antibodies to MSP-119 antigens of the four Plasmodium species are species-specific and do not cross-react. In both study populations almost all antibody responses involved P. falciparum, and single-species responses were almost exclusively directed against P. falciparum antigens. Mixed-species responses accounted for more than a third of responses, and were associated with chloroquine treatment failure, with significantly high proportion of individuals with mixed-species infections requiring repeated treatment with chloroquine/sulfadoxine-pyrimethamine for parasite clearance. This finding highlights the need for a sensitive method for detecting mixed-species malaria infections to enable the assessment of the true prevalence and magnitude of the disease burden caused by the non-falciparum species in endemic populations. Drug treatment failures associated with mixed species infections have significant impact on malaria morbidity and mortality. Treatment failure or partial parasite clearance has the potential to allow dormant liver stages of P. vivax and P. ovale to become a source of parasite reservoir for onward transmission. Furthermore, untreated low-grade chronic infections caused by P. malariae have been reported to cause systemic diseases many years after the primary infection. Spatial analysis of malaria epidemiology showed that malaria parasite transmission in Daraweesh was focal, and that infections are not randomly distributed in the village. Two space-time clusters of significantly increased malaria risk were identified (1993- 1999, and 1998-1999) with marked variations between households, but little or no variation in the species of Plasmodium over time. Similarly, multiple significant clusters were identified for the parasite species; three for P. falciparum, two for P. vivax and P. malariae, and one for P. ovale. These clusters had overlapping time frames, with some of the species significantly infecting the same households. This suggests that even in a small geographic area malaria transmission shows heterogeneity, and that such data can provide useful information to guide malaria control efforts. Finally, I demonstrated that 3D7 P. falciparum parasite growth was similar in the erythrocytes of different blood group donors, and provide preliminary data to show that the non-coding RNA gene, PF3D7_1370800, is differentially expressed in blood group A donors relative to blood groups B and O donors. Further research is needed to better understand the role of this gene in malaria pathology. All together, these findings will aid malaria researchers and other stakeholders in making informed choices about tools for diagnosing Plasmodium species, and control programmes targeting eradication of malaria caused by all Plasmodium species, as is the case of incorporating these findings into current malaria research in Sudan.

Background:To ascertain species-specific 18S rRNA gene amplification, in order to detect the sequence variation in Plasmodium Vivax parasite. Methods: Blood samples from 150 suspected malaria cases were collected . Microscopically diagnosed cases of malaria were subjected to nested PCR amplification for genus and species confirmation. The 18S rRNA gene was amplified from 34 P.vivax positive cases. The obtained PCR products were subjected to sequence analysis, phylogenetic study and multiple sequence alignment. Results: The genus specific-positive malaria cases along with the mixed species done by nested PCR were 40.7 % (61 out of 150) while microscopy results revealed malaria positive cases to be 32.6 % (49 out of 150). The difference in detection of malaria parasite by PCR was more sensitive as compared to microscopy (two-tailed p.value = 0.0015).Among the nested PCR malaria-positive cases, P. vivax, was isolated in 55.7% (34 of 61) .Samples and P. falciparum were isolated in 34.4% (21 of 61) samples and mixed infection were detected in 9.8% (6 of 61) cases. While among the microscopy -positive malaria cases, P. vivax, was isolated in 57.1% (28 of 49) . P. falciparum were isolated in 32.7% (16 of 49) samples and mixed infection were detected in 10.2% (5 of 49) cases. Phylogenetic analysis and multiple alignment of the 18S rRNA was done on 13 selected cases of P.vivax isolates which revealed vast genetic diversity and variation in Single Nucleotide Proteins (SNPs) including deletion, substitution and insertions. All isolates appeared to be highly polymorphic. Conclusion: Detection of Plasmodium species with nested PCR is effective way to identify the individual Plasmodium species and mix infection in low parasitemia for proper treatment option. The phylogenic studies and bio informative tools are reliable methods to identify the relatedness of human malarial parasites and zoonotic e.g. P. knowlesi.

Background Malaria is one of the most important parasitic infectious diseases for which almost half of the world’s population is at risk. Although several diagnostic methods are now available to detect the infection, more sensitive and applicable tests are still required in the field. The loop-mediated isothermal amplification (LAMP) method is a DNA amplification tool in which the DNA amplification can be achieved by incubation at a stable temperature. A malaria detection kit based on this methodology has already been commercialized and is being used in some countries. The kit includes two reaction tubes: one targeting the common Plasmodium genus (Pan tube) and the other specifically targeting Plasmodium falciparum (Pf tube). In parallel, a simple DNA extraction method, the procedure for ultra rapid extraction (PURE), which can produce a DNA solution suitable for the LAMP reaction without the use of a centrifuge, has also become available. In this study, the sensitivity of the combination of the PURE and LAMP methods (PURE–LAMP) was evaluated with archived dried clinical blood samples of imported malaria cases, including P. falciparum, Plasmodium vivax, Plasmodium ovale, and Plasmodium malariae. Results Using a nested PCR as the reference, 117 samples including 46 P. falciparum, 7 P. vivax, 9 P. ovale, 4 P. malariae, and 51 negative cases were tested. The PURE–LAMP Pan correctly identified 64 of the 66 positives and the 51 negatives. Among the Pan-positive samples 45 P. falciparum were also detected with the PURE–LAMP Pf. The PURE–LAMP Pan and PURE–LAMP Pf had respective sensitivities of 96.96% (95% CI 89.47–99.63) and 97.82% (95% CI 88.47–99.94) and common specificity of 1. Conclusion The PURE–LAMP system is accurate when used with dried blood spots and extendable to the field. Electronic supplementary material The online version of this article (10.1186/s12936-018-2527-7) contains supplementary material, which is available to authorized users.

Background Monitoring the impact of case management strategies at large scale is essential to evaluate the public health benefit they confer. The use of methodologies relying on objective and standardized endpoints, such as drug levels in the blood, should be encouraged. Population drug use, diagnosis and treatment appropriateness in case of fever according to patient history and anti-malarials blood concentration was evaluated. Methods A cross-sectional survey took place between May and August 2015 in three regions of Tanzania with different levels of malaria endemicity. Interviews were conducted and blood samples were collected by dried blood spots through household surveys for further anti-malarial measurements. Appropriate testing when individuals attended care was defined as a patient with history of fever being tested for malaria and appropriate treatment as (i) having anti-malarial in the blood if the test result was positive (ii) having anti-malarial in the blood if the person was not tested, and (iii) no anti-malarial in the blood when the test result was negative. Results Amongst 6391 participants included in the anti-malarial analysis, 20.8% (1330/6391) had anti-malarial drug detected in the blood. Only 28.0% (372/1330) of the individuals with anti-malarials in their blood reported the use of anti-malarials within the previous month. Amongst all participants, 16.0% (1021/6391) reported having had a fever in the previous 2 weeks and 37.5% of them (383/1021) had detectable levels of anti-malarials in the blood. Of the individuals who sought care in health facilities, 69.4% (172/248) were tested and 52.0% (129/248) appropriately treated. When other providers were sought, 6% (23/382) of the persons were appropriately tested and 44.2% (169/382) appropriately treated. Overall, the proportion of individuals treated was larger than that being tested [47.3% (298/630) treated, 31.0% (195/630) tested]. Conclusion This study showed high prevalence of circulating anti-malarial drug in the sampled population. Efforts should be made to increase rapid diagnostic tests use at all levels of health care and improve compliance to test result in order to target febrile patients that are sick with malaria and reduce drug pressure. Objective drug measurements collected at community level represent a reliable tool to evaluate overall impact of case management strategies on population drug pressure.

In malaria elimination areas, malaria cases are sporadic and consist predominantly of imported cases. Plasmodium knowlesi cases have been reported throughout Southeast Asia where long-tailed and pig-tailed macaques and Anopheles leucosphyrus group mosquitoes are sympatric. The limitation of microscopic examination to diagnose P. knowlesi is well known. In consequence, no P. knowlesi case has previously been reported from routine health facility-based case finding activities in Indonesia. This report describes two clusters of unexpected locally acquired P. knowlesi cases found in an area where Plasmodium falciparum and Plasmodium vivax infection had been eliminated in Sabang Municipality, Aceh, Indonesia. The difficulties in diagnosis and response illustrate challenges that Southeast Asian countries will increasingly face as the formerly common malaria parasites P. falciparum and P. vivax are gradually eliminated from the region.

Background Rapid diagnosis of malaria using acridine orange (AO) staining and a light microscope with a halogen lamp and interference filter was deployed in some malaria-endemic countries. However, it has not been widely adopted because: (1) the lamp was weak as an excitation light and the set-up did not work well under unstable power supply; and, (2) the staining of samples was frequently inconsistent. Methods The halogen lamp was replaced by a low-cost, blue light-emitting diode (LED) lamp. Using a reformulated AO solution, the staining protocol was revised to make use of a concentration gradient instead of uniform staining. To evaluate this new AO diagnostic system, a pilot field study was conducted in the Lake Victoria basin in Kenya. Results Without staining failure, malaria infection status of about 100 samples was determined on-site per one microscopist per day, using the improved AO diagnostic system. The improved AO diagnosis had both higher overall sensitivity (46.1 vs 38.9%: p = 0.08) and specificity (99.0 vs 96.3%) than the Giemsa method (N = 1018), using PCR diagnosis as the standard. Conclusions Consistent AO staining of thin blood films and rapid evaluation of malaria parasitaemia with the revised protocol produced superior results relative to the Giemsa method. This AO diagnostic system can be set up easily at low cost using an ordinary light microscope. It may supplement rapid diagnostic tests currently used in clinical settings in malaria-endemic countries, and may be considered as an inexpensive tool for case surveillance in malaria-eliminating countries. Electronic supplementary material The online version of this article (10.1186/s12936-018-2214-8) contains supplementary material, which is available to authorized users.

Rapid diagnostic tests (RDTs) have been considered as an ideal alternative for light microscopy to detect malaria parasites especially in remote areas. The development and improvement of RDTs is an area of intensive research in the last decade. To date, few parasite proteins have been targeted in RDTs which are known to have certain deficiencies and made the researchers to look for other promising candidates to address this problem. Plasmodium falciparum thioredoxin peroxidase 1 (PfTPx-1) is abundantly expressed in the cytoplasm of the parasite and well conserved across Plasmodium species, making this antigen a promising target for malaria diagnosis. Several monoclonal antibodies (mAbs) were produced against PfTPx-1. The binding affinities of mAbs were measured. Several immunochromatographic tests (ICTs) were developed using different combination of mAbs. All mAbs showed promising affinities to be used for diagnosis. The sensitivities of ICTs were evaluated using recombinant PfTPx-1 whose results lead us to the preparation of 4 different ICTs. These tests showed positive reaction with P. falciparum in vitro culture supernatant indicating the release of PfTPx-1 during schizont rupture. Altogether, these findings suggest that PfTPx-1 is a promising biomarker to diagnose P. falciparum infection. However, the diagnostic performance of this antigen should be further validated using clinical samples., Experimental Parasitology, 154, pp.62-66; 2015

BACKGROUND: Malaria is currently the most important human parasitic disease in the world responsible for high morbidity and mortality. Appropriate diagnostic methods are essential for early detection. Microscopy examination remains the gold standard, although molecular techniques have higher sensitivity and are very useful in cases of low parasitaemia and mixed infections. The objective of this study was to evaluate a new commercial molecular diagnostic technique. METHODS: A prospective, observational, multicentre study was performed between January 2015 and April 2017. All participants were immigrants from malaria-endemic areas, who were divided into two groups: asymptomatic group and symptomatic. Samples from both groups were evaluated by a rapid diagnostic test (ImmunoQuick® Malaria + 4 RDT), microscopy examination, and two commercial molecular malaria tests (FTD Malaria and FTD Malaria Differentiation), then compared against an in-house reference PCR technique. RESULTS: In all, 250 patients were included: 164 (65.6%) in the asymptomatic group, and 86 (34.4%) in the symptomatic group. There were seven cases of asymptomatic parasitaemia (prevalence = 2.8%) that were detected only by molecular methods. In the symptomatic group, there were seven cases of submicroscopic malaria. The main species detected was Plasmodium falciparum (96.6%). The commercial molecular technique had higher sensitivity than the other methods (S = 96%) and a high rate of concordance with the in-house reference PCR technique (Kappa score = 0.93). CONCLUSIONS: The molecular techniques, although slower than microscopy, have adequate diagnostic accuracy and are very useful for the detection of P. falciparum in cases with low parasitaemia. This work was funded by projects PI17/1791 and PI14CIII/00014, from the Instituto de Salud Carlos III (Ministry of Economy, Industry and Competitiveness) and cofounded by the European Regional Development Fund, and approved by the Ethics Committee of our Institution. There was no funding from the PCR manufacturers; they did not play any role in data analysis or in the reporting of the results. Sí

BackgroundArtemisinin-resistant malaria (ARM) remains a significant threat to malaria elimination. In the Greater Mekong subregion, the prevalence of ARM in certain regions has reached greater than 90%. Artemisinin-resistant malaria is clinically identified by delayed parasite clearance and has been associated with mutations in the propeller domain of the kelch 13 gene. C580Y is the most prevalent mutation. The detection of ARM currently relies on labor-intensive and time-consuming methods such as clinical phenotyping or in vitro susceptibility testing.MethodsWe developed a novel single-nucleotide polymorphism loop mediated isothermal amplification (SNP-LAMP) test method for the detection of the C580Y mutation using a novel primer design strategy.ResultsThe SNP-LAMP was 90.0% sensitive (95% confidence interval [CI], 66.9–98.3) and 91.9% specific (95% CI, 82.6–96.7) without knowledge of the parasite load and was 100% sensitive (95% CI, 79.9–100) and 97.3% specific (95% CI, 89.7–99.5) when the parasitemia was within the assay dynamic range. Tests with potential application near-to-patient such as SNP-LAMP may be deployed in low- and middle-income and developed countries.ConclusionsSingle-nucleotide polymorphism LAMP can serve as a surveillance tool and guide treatment algorithms for ARM in a clinically relevant time frame, prevent unnecessary use of additional drugs that may drive additional resistance, and avoid longer treatment regimens that cause toxicity for the patient.

Background As in other countries of the Greater Mekong Sub-region (GMS), the private health sector constitutes a significant avenue where malaria services are provided and presents a unique opportunity for public–private collaboration. In September 2008, a public–private mix (PPM) strategy was launched initially in four northern and southern provinces in Lao PDR to increase access to rapid diagnostic tests (RDTs) and artemisinin-based combination therapy (ACT), improve quality of care, and collect routine malaria data from the private sector. Throughout the process, key stakeholders were involved in the planning, monitoring and supervision of project sites. Following an initial assessment in 2009, the PPM initiative expanded to an additional 14 district sites to a total of 245 private pharmacies and 16 clinics covering 8 provinces and 22 districts. By June 2016, a total of 317 pharmacies, 30 clinics in 32 districts of the 8 provinces were participating in the PPM network and reported monthly malaria case data. Methods This descriptive study documented the process of initiating and maintaining the PPM network in Lao PDR. Epidemiological data reported through the routine surveillance system from January 2009 to June 2016 were analyzed to illustrate the contribution of case reporting from the private sector. Results A total of 2,301,676 malaria tests were performed in the PPM districts, which included all the PPM pharmacies and clinics (176,224, 7.7%), proportion of patients tested from 14,102 (4.6%) in 2009 to 29,554 (10.4%) in 2015. Over the same period of 90 months, a total of 246,091 positive cases (10.7%) were detected in PPM pharmacies and clinics (33,565; 13.6%), in the same districts as the PPM sites. The results suggest that the PPM sites contributed to a significant increasing proportion of patients positive for malaria from 1687 (7.4%) in 2009 to 5697 (15.8%) in 2015. Conclusions Ensuring adequate and timely supplies of RDTs and ACT to PPM sites is critical. Frequent refresher training is necessary to maintain data quality, motivation and feedback. In the context of malaria elimination, the PPM initiative should be expanded further to ensure that all febrile cases seen through the private sector in malaria transmission areas are tested for malaria and treated appropriately. Results from the PPM must be integrated into a centralized registry of malaria cases that should prompt required case and foci investigations and responses to be conducted as part of elimination efforts.

Background Plasmodium knowlesi is primarily responsible for zoonotic malaria in several Southeast Asian countries. Precise identification of the parasite in the blood of patients presently relies on an expensive and elaborate PCR procedure because microscopic examination of blood and other available field identification techniques lack adequate specificity. Therefore, the use of a simple and inexpensive dual-colour fluorescence in situ hybridization (FISH) assay, analogous to FISH assays recently described for Plasmodium falciparum and Plasmodium vivax, was investigated as a potential tool for identifying P. knowlesi. Results A P. knowlesi 18S rDNA sequence-based DNA probe was used to test thin blood smears of P. knowlesi by FISH, and fluorescence viewed in a light microscope fitted with a light emitting diode light source and appropriate emission and barrier filters. The limit of detection in the P. knowlesi FISH assay was 84 parasites per μl in infected monkey blood and 61 parasites per μl for P. knowlesi cultured in human blood. The P. knowlesi-specific FISH probe detected only P. knowlesi and not P. falciparum, Plasmodium malariae, Plasmodium ovale, P. vivax or a panel of other human blood-borne pathogens. A previously described Plasmodium genus-specific probe used simultaneously in the P. knowlesi FISH assay reacted with all tested Plasmodium species. Conclusions To our knowledge, this is the first description of a FISH assay for P. knowlesi that is potentially useful for diagnosing infections in remote laboratories in endemic countries. Electronic supplementary material The online version of this article (doi:10.1186/s13071-017-2273-7) contains supplementary material, which is available to authorized users.

Malaria is still a major problem in many parts of the world. Accurate diagnosis, crucial in disease control, currently relies on the microscopic detection of parasites in blood samples. This technique is invasive, increases risk of blood-borne disease transmission, and is uncomfortable for the patient. Non-invasive approaches to detect antibodies against malaria, malarial antigens, and malarial DNA in non-blood samples, i.e. saliva, urine and buccal mucosa, have been developed to overcome these problems. This review summarizes the techniques that have been used to detect malaria in non-blood samples, their sensitivities and specificities as well as the factors influencing them. The provided information may be useful for further development of highly efficient non-invasive malaria detection methods.

Malaria due to Plasmodium falciparum is a life-threatening disease that requires prompt diagnosis for its management. As a result, Rapid Diagnostic Test (RDT) was provided because it is simple to use and provides quick result without the need for good microscopy equipment and operators. Although blood is the specimen most frequently used for RDT, urine has been suggested as an alternative specimen. The study compares the performance of Urine-based RDT (uRDT) with Microscopy and Blood-based RDT (bRDT) in malaria diagnosis. This study was conducted using blood and urine specimens collected from 350 humans that attended Primary Health Centres at Amansea and Igbariam in Awka North and Anambra East LGAs of Anambra State respectively. Care-start® and Fyodor® test kits were used for malaria rapid diagnosis while Giemsa stained thick and thin blood films were used as standard. Malaria parasite prevalence in the study was 57.1% by microscopy, 22.0% by bRDT and 11.1% by uRDT (p120 to < 430) parasites/μl and ≥ 430 parasites/μl of blood, bRDT recorded increasing higher prevalence values than the uRDT that followed the same pattern. There was significant weak positive correlation between malaria parasite density of microscopy and the RDTs. Among the febrile and non-febrile subjects who tested positive for malaria using uRDT, 92.0% and 71.4% respectively had thick line shown (p>0.05). Using the Receiver-Operator Characteristic (ROC) curves, the uRDT can be used to diagnose malaria infection even when the parasitaemia level is as low as 260 parasites/μl of blood at 76.9% sensitivity and 82.5% specificity. bRDT can detect malaria parasites at the same level but with sensitivity level of 85.9% and specificity level of 77.5% for febrile and non-febrile conditions. In conclusion, the uRDT followed similar pattern of malaria parasite diagnosis with microscopy and bRDT though with lower performance.Keywords: Malaria diagnosis; urine-based RDT; blood based RDT; microscopy; febrile; non-febrile

Introduction Parasitological confirmation before administration of antimalarial treatment has been recommended by the World Health Organization in everyone presenting with symptoms suggestive of malaria at all levels of the health system. Methods The authors assessed the performance of a histidine-rich protein 2-based malaria rapid diagnostic test used by community health workers in the context of an integrated approach to diagnosis and treatment for malaria and pneumonia. A total of 525 children below 5 years of age were recruited into the study. Children with fever/history of fever within the last 24 h were tested with the rapid diagnostic test (RDT) and a blood smear was obtained for delayed reading. Results Overall, the FirstSign™ Malaria Pf (Unimed International Inc, South San Francisco, USA) has shown a high sensitivity profile of 97.9% (95% CI 96.3–98.8), but a low specificity of 53.4% (95% CI 49.1–57.7). The specificity was significantly lower during the high transmission season at 25.4% (95% CI 20.5–31.0) compared to 63.7% (95% CI 57.6–69.4%) at the low transmission season. The negative predictive value (NPV) was 95.4% (95% CI 93.2–96.9) and positive predictive value was 71.7% (95% CI 67.7–75.4). The NPV was significantly higher during the low transmission season at 98.2% (95% CI 95.7–99.3) than compared to 80.0% (95% CI 74.7–84.4) at the high transmission season. Conclusion With such a low specificity, caution should be exercised when using these RDTs for community case management of malaria.

Malaria diagnosis and speciation still rely on microscopic identification in many settings. But, microscopy is tedious and lack sensitivity, particularly in areas under advanced eradication programs where low-density infections are increasingly reported. Species-specific molecular techniques are highly sensitive and reliable alternatives for Plasmodium parasites detection and speciation. Nevertheless, the efficacy of molecular techniques is directly affected by the purity and quality of isolated DNA templates. A Plasmodium species-specific multiplex-nested-PCR was assessed using DNA templates prepared separately by phenol-chloroform method, a DNA-precipitation commercial kit, and a chromatographic commercial kit from 126 EDTA-preserved whole blood samples. 115 samples were collected from malaria suspicious febrile patients in endemic southern region and 11 malaria positive samples from foreign and national visitors of non-endemic western region of Saudi Arabia. In total, 89 specimens were found malaria positive by at least one diagnostic method, out of which 82 (92%) were detected by microscopy. P. multiplex-N-PCR revealed 89 (100%), 77 (86.5%), and 85 (95.5%) positive samples using DNA templates extracted by the chromatographic kit, the DNA-precipitation kit, and phenol-chloroform standard method, respectively. P. falciparum parasites were detected in 86 samples and P. vivax in three samples from foreign visitors. Thus, P. multiplex-N-PCR applied to DNA templates isolated by chromatographic method achieved the highest sensitivity and was particularly useful for submicroscopic malaria cases in the endemic area where intensive elimination efforts are being deployed.