Search

Angiotensin 2 impairs vascular function by activation of reactive oxygen species (ROS) production and development of endothelial dysfunction. Metformin, the first-line therapeutic agent for type 2 diabetes mellitus, has vascular protective properties, beyond its glucose lowering effects. The aim of the present study was to investigate the interaction between metformin and angiotensin 2 in human internal mammary arteries harvested from patients with coronary heart disease undergoing revascularization procedure, by evaluation of vascular function, reactive oxygen species (ROS) production and the gene expression of nitric oxide (NO) synthases (endothelial – eNOS, neuronal – nNOS and inducible – iNOS). To this aim, vascular samples were incubated with angiotensin 2 (Ang2, 12 h) with/without metformin (Metf, 10 μM) and used for ROS measurement (FOX assay), vascular reactivity in organ bath (contractility to phenylephrine, relaxation to acetylcholine, contractility to NG-nitro-L-arginine methyl ester/L-NAME) and RTPCT studies. Acute incubation of the vascular rings with Ang2 impaired vascular reactivity (increase contractility, decrease relaxation), increased ROS production, supressed eNOS/nNOS and increased iNOS mRNA expression. Ex vivo incubation with metformin at a clinically relevant concentration reversed all these effects. These data suggest that Metformin might be useful in alleviating endothelial dysfunction by improving the endothelial-dependent relaxation and mitigating oxidative stress in clinical setting associated with cardiovascular disease regardless the presence of impaired glucose metabolism.

The increasing pollution of surface and groundwater bodies by pharmaceuticals is a general environmental problem requiring routine monitoring. Conventional analytical techniques used to quantify traces of pharmaceuticals are relatively expensive and generally demand long analysis times, associated with difficulties in performing field analyses. Propranolol, a widely used β-blocker, is representative of an emerging class of pharmaceutical pollutants with a noticeable presence in the aquatic environment. In this context, we focused on developing an innovative, highly accessible analytical platform based on self-assembled metal colloidal nanoparticle films for the fast and sensitive detection of propranolol based on Surface Enhanced Raman Spectroscopy (SERS). The ideal nature of the metal used as the active SERS substrate was investigated by comparing silver and gold self-assembled colloidal nanoparticle films, and the improved enhancement observed on the gold substrate was discussed and supported by Density Functional Theory calculations, optical spectra analyses, and Finite-Difference Time-Domain simulations. Next, direct detection of propranolol at low concentrations was demonstrated, reaching the ppb regime. Finally, we showed that the self-assembled gold nanoparticle films could be successfully used as working electrodes in electrochemical-SERS analyses, opening the possibility of implementing them in a wide array of analytical applications and fundamental studies. This study reports for the first time a direct comparison between gold and silver nanoparticle films and, thus, contributes to a more rational design of nanoparticle-based SERS substrates for sensing applications.

Many promising applications of surface-enhanced Raman scattering (SERS), such as microfluidic SERS and electrochemical (EC)-SERS, require immersion of plasmonic nanostructured films in aqueous media. Correlational investigations of the optical response and SERS efficiency of solid SERS substrates immersed in water are absent in the literature. This work presents an approach for tuning the efficiency of gold films over nanospheres (AuFoN) as SERS substrates for applications in aqueous environment. AuFoN are fabricated by convective self-assembly of colloidal polystyrene nanospheres of various diameters (300–800 nm), followed by magnetron sputtering of gold films. The optical reflectance of the AuFoN and Finite-Difference Time-Domain simulations in both water and air reveal the dependence of the surface plasmon band on nanospheres’ diameter and environment. SERS enhancement of a common Raman reporter on AuFoN immersed in water is analyzed under 785 nm laser excitation, but also using the 633 nm line for the films in air. The provided correlations between the SERS efficiency and optical response in both air and water indicate the best structural parameters for high SERS efficiency and highlight a route for predicting and optimizing the SERS response of AuFoN in water based on the behavior in air, which is more practical. Finally, the AuFoN are successfully tested as electrodes for EC-SERS detection of the thiabendazole pesticide and as SERS substrates integrated in a flow-through microchannel format. The obtained results represent an important step toward the development of microfluidic EC-SERS devices for sensing applications.

Chronic kidney disease (CKD) has emerged as one of the most progressive diseases with increased mortality and morbidity. Metabolomics offers new insights into CKD pathogenesis and the discovery of new biomarkers for the early diagnosis of CKD. The aim of this cross-sectional study was to assess metabolomic profiling of serum and urine samples obtained from CKD patients. Untargeted metabolomics followed by multivariate and univariate analysis of blood and urine samples from 88 patients with CKD, staged by estimated glomerular filtration rate (eGFR), and 20 healthy control subjects was performed using ultra-high-performance liquid chromatography coupled with electrospray ionization-quadrupole-time of flight-mass spectrometry. Serum levels of Oleoyl glycine, alpha-lipoic acid, Propylthiouracil, and L-cysteine correlated directly with eGFR. Negative correlations were observed between serum 5-Hydroxyindoleacetic acid, Phenylalanine, Pyridoxamine, Cysteinyl glycine, Propenoylcarnitine, Uridine, and All-trans retinoic acid levels and eGFR. In urine samples, the majority of molecules were increased in patients with advanced CKD as compared with early CKD patients and controls. Amino acids, antioxidants, uremic toxins, acylcarnitines, and tryptophane metabolites were found in all CKD stages. Their dual variations in serum and urine may explain their impact on both glomerular and tubular structures, even in the early stages of CKD. Patients with CKD display a specific metabolomic profile. Since this paper represents a pilot study, future research is needed to confirm our findings that metabolites can serve as indicators of early CKD.

Preeclampsia (PE) is a major complication of pregnancy with partially elucidated pathophysiology. Placental mitochondrial dysfunction has been increasingly studied as major pathomechanism in both early- and late-onset PE. Impairment of mitochondrial respiration in platelets has recently emerged as a peripheral biomarker that may mirror organ mitochondrial dysfunction in several acute and chronic pathologies. The present study was purported to assess mitochondrial respiratory dys/function in both platelets and placental mitochondria in PE pregnancies. To this aim, a high-resolution respirometry SUIT (Substrate-Uncoupler-Inhibitor-Titration) protocol was adapted to assess complex I (glutamate + malate)- and complex II (succinate)-supported respiration. A decrease in all respiratory parameters (basal, coupled, and maximal uncoupled respiration) in peripheral platelets was found in preeclamptic as compared to healthy pregnancies. At variance, placental mitochondria showed a dichotomous behavior in preeclampsia in relation to the fetal birth weight. PE pregnancies with fetal growth restriction were associated with decreased in coupled respiration (oxidative phosphorylation/OXPHOS capacity) and maximal uncoupled respiration (electron transfer/ET capacity). At variance, these respiratory parameters were increased for both complex I- and II-supported respiration in PE pregnancies with normal weight fetuses. Large randomized controlled clinical studies are needed in order to advance our understanding of mitochondrial adaptive vs. pathological changes in preeclampsia.

Preeclampsia (PE) is a major complication of pregnancy with both mother and fetal adverse outcomes. Pregnancy is a state of increased oxidative stress that has been reported to be exacerbated when complicated with preeclampsia. However, conflicting data are available in literature regarding the systemic oxidative stress in PE pregnancies. The present pilot study was purported to assess systemic oxidative stress in preeclamptic vs healthy pregnancies. To this aim plasma derived compounds of reactive oxygen metabolites (d-ROMs) and the biological antioxidant potential (BAP) were determined in mild and severe preeclamptic pregnancies using the Diacron equipment. Both healthy and preeclamptic pregnancies showed high levels of systemic oxidative stress. Paradoxically, significantly higher values of d-ROMs were found in healthy pregnancies as compared to the PE ones. At variance, in preeclamptic pregnancies, a major increase in the plasma antioxidant capacity occurred. In this pilot study, we report an increase in the systemic antioxidant capacity in preeclamptic pregnancies.

Mitochondria are central organelles in the homeostasis of the cardiovascular system via the integration of several physiological processes, such as ATP generation via oxidative phosphorylation, synthesis/exchange of metabolites, calcium sequestration, reactive oxygen species (ROS) production/buffering and control of cellular survival/death. Mitochondrial impairment has been widely recognized as a central pathomechanism of almost all cardiovascular diseases, rendering these organelles important therapeutic targets. Mitochondrial dysfunction has been reported to occur in the setting of drug-induced toxicity in several tissues and organs, including the heart. Members of the drug classes currently used in the therapeutics of cardiovascular pathologies have been reported to both support and undermine mitochondrial function. For the latter case, mitochondrial toxicity is the consequence of drug interference (direct or off-target effects) with mitochondrial respiration/energy conversion, DNA replication, ROS production and detoxification, cell death signaling and mitochondrial dynamics. The present narrative review aims to summarize the beneficial and deleterious mitochondrial effects of common cardiovascular medications as described in various experimental models and identify those for which evidence for both types of effects is available in the literature.

Preeclampsia (PE) is the most severe complication of pregnancy with substantial burden of morbidity and mortality for mother and neonate. The increased placental oxidative stress (OS) has been involved as central pathomechanism, yet the sources of reactive oxygen species (ROS) are partially elucidated. Monoamine oxidase (MAO) with 2 isoforms, A and B, at the outer mitochondrial membrane has emerged as a constant source of ROS in cardiometabolic pathologies. The present pilot study was purported to assess as follows: (i) the magnitude of placental OS in relation to the site of sampling and (ii) the expression of placental MAO in the setting of PE. To this aim, central and placental samples were harvested during cesarean section from mild and severe PE versus healthy pregnancies. ROS generation (dihydroethidium staining) and MAO expression were assessed (confocal microscopy). MAO gene transcript was evaluated by RT-PCR. The main findings are as follows: (i) a significant increase in placental OS was found in severe (but not in mild) PE with no regional differences between central and peripheral areas and (ii) placental MAO-A and B (gene and protein) were significantly increased in severe preeclampsia. The signal transduction of the latter finding, particularly in relation with mitochondrial dysfunction, is worth further studying.

In this work surface-enhanced Raman spectra of nucleic acids from in vitro grown Solanum tuberosum L. cultivars and populations (Buzau population, Lazarea population, Patraque d'Auvergne, RFA Roclas Clone 2.6 Ferma, Vitelotte Negresse, Roclas Clone C, Blue Congo) were measured with 532 nm laser line. Main surface-enhanced Raman modes of these DNAs have been analyzed. Also, DNA from two grapevine (Vitis vinifera L.) varieties were studied at acidic pHs by surface-enhanced Raman spectroscopy. Modified SERS intensities and wavenumber shifts of nucleic acids bands were observed upon lowering the pH, being a proof of binding affinity changes of DNA with silver nanoparticles (AgNPs) and of structural modifications induced at acidic pHs in DNA molecular groups. Furthermore, the (sub)picosecond surface dynamics of DNA extracted from leaf tissues of grapevine (Vitis vinifera L.) varieties was investigated. In this work, the bands full widths at half-maximum (FWHMs) have values in the wavenumber range from 8 to 34 cm

Diet-induced metabolic diseases, such as obesity, metabolic syndrome, and type 2 diabetes (T2DM) are the global threatening epidemics that share cardiovascular oxidative stress as common denominator. Monoamine oxidase (MAO) has recently emerged as a constant source of reactive oxygen species (ROS) in DM. Metformin, the first-line drug in T2DM, elicits cardiovascular protection via pleiotropic effects. The present study was aimed to assess the contribution of MAO to the early cardiac oxidative stress in a rat model of high-calorie junk food (HCJF) diet-induced obesity and prediabetes and whether metformin can alleviate it. After 6 months of HCJF, rats developed obesity and hyperglycemia. Hearts were isolated and used for the evaluation of MAO expression and ROS production. Experiments were performed in the presence vs absence of metformin (10 µM) and MAO-A and B inhibitors (clorgyline and selegiline, 10 µM), respectively. Both MAO isoforms were overexpressed and led to increased ROS generation in cardiac samples harvested from the obese animals. Acute treatment with metformin and MAO inhibitors was able to mitigate oxidative stress. More important, metformin downregulated MAO expression in the diseased samples. In conclusion, MAO contributes to oxidative stress in experimental obesity and can be targeted with metformin.

Characterization of mitochondrial respiration in peripheral blood cells has recently emerged as a potential biomarker for the assessment of the severity of hematological malignancies (HM) in adults. Whether changes in platelet respiratory function occur in children with or without HM it is unknown. The present pilot study was double-aimed: (i) to investigate whether platelet respiration is age-dependent in non-HM children and (ii) to assess the platelet mitochondrial respiration in children with newly diagnosed acute lymphoblastic leukemia (ALL). Blood samples obtained from age-grouped children (10–11, 13–14 and 16–17 years) with non-HM and children with ALL (10–11 years) were used to isolate platelets via differential centrifugation. High-resolution respirometry studies of isolated platelets were performed according to a protocol adapted to evaluate complex I and II-supported respiration. An age-related decrease in respiration was observed in the non-HM pediatric population and had comparable values for the 13–14 and 16–17 years. groups. In children with ALL, a significant increase in C I-supported active respiration and decrease in maximal noncoupled respiration were found at the disease onset. In conclusion, in a pediatric population, platelet mitochondrial respiration is age-dependent. Platelet respiratory dysfunction occurs in children with newly-diagnosed ALL, an observation that warrants further investigation of this change as a disease biomarker.

The discovery of surface enhanced Raman scattering (SERS) from an electrochemical (EC)-SERS experiment is known as a historic breakthrough. Five decades have passed and Raman spectroelectrochemistry (SEC) has developed into a common characterization tool that provides information about the electrode–electrolyte interface. Recently, this technique has been successfully explored for analytical purposes. EC was found to highly improve the performances of SERS sensors, providing, among others, controlled adsorption of analytes and increased reproducibility. In this review, we highlight the potential of EC-SERS sensors to be implemented for point-of-need (PON) analyses as miniaturized devices, and their ability to revolutionize fields like quality control, diagnosis or environmental and food safety. Important developments have been achieved in Raman spectroelectrochemistry, which now represents a promising alternative to conventional analytical methods and interests more and more researchers. The studies included in this review open endless possibilities for real-life EC-SERS analytical applications.

Open-heart surgery with cardiopulmonary bypass (CPB) remains the standard approach for complex cardiac pathologies, such as advanced coronary heart disease and severe valvular defects. Platelet dysfunction has been widely reported, with both structural and functional changes being elicited by the CPB circuit. Succinate is a mitochondrial substrate that is metabolized through complex II (CII) but is impermeable to cellular membranes when given exogenously. Cell-permeable succinates are novel prodrugs developed to support mitochondrial electron transport (ET) and prevent energy depletion in various pathologies. The aim of the present pilot study was to investigate the role of NV118 (diacetoxymethyl succinate), a cell-permeable succinate, on platelet respiration in a pilot group of patients undergoing CPB. Blood samples (20 mL) were collected from participants before (prior to heparin administration) and after CPB (within 10 min after protamine sulphate administration). Platelets were isolated through a two-step centrifugation protocol. Mitochondrial respiration was analyzed by means of high-resolution respirometry in the presence of NV118 or its solvent (DMSO). The main respiratory parameters recorded were as follows: ROUTINE respiration, LEAK respiration, and maximal uncoupled respiration for both CI and CII (ET capacity) and for CII solely after CI inhibition (ET CII capacity). Here, we report that NV118 elicited a global increase in platelet respiration both pre- and post-CPB. In conclusion, NV118, a cell-permeable succinate, improved platelet bioenergetics in the setting of cardiopulmonary bypass. Whether the compound can support platelet function and/or provide organ protection at the mitochondrial level during CPB are clearly worthy and important areas for future investigation.

The Emissions Database for Global Atmospheric Research (EDGAR) compiles anthropogenic emissions data for greenhouse gases (GHGs), and for multiple air pollutants, based on international statistics and emission factors. EDGAR data provide quantitative support for atmospheric modelling and for mitigation scenario and impact assessment analyses as well as for policy evaluation. The new version (v4.3.2) of the EDGAR emission inventory provides global estimates, broken down to IPCC-relevant source-sector levels, from 1970 (the year of the European Union's first Air Quality Directive) to 2012 (the end year of the first commitment period of the Kyoto Protocol, KP). Strengths of EDGAR v4.3.2 include global geo-coverage (226 countries), continuity in time, and comprehensiveness in activities. Emissions of multiple chemical compounds, GHGs as well as air pollutants, from relevant sources (fossil fuel activities but also, for example, fermentation processes in agricultural activities) are compiled following a bottom-up (BU), transparent and IPCC-compliant methodology. This paper describes EDGAR v4.3.2 developments with respect to three major long-lived GHGs (CO2, CH4, and N2O) derived from a wide range of human activities apart from the land-use, land-use change and forestry (LULUCF) sector and apart from savannah burning; a companion paper quantifies and discusses emissions of air pollutants. Detailed information is included for each of the IPCC-relevant source sectors, leading to global totals for 2010 (in the middle of the first KP commitment period) (with a 95 % confidence interval in parentheses): 33.6(±5.9) Pg CO2 yr−1, 0.34(±0.16) Pg CH4 yr−1, and 7.2(±3.7) Tg N2O yr−1. We provide uncertainty factors in emissions data for the different GHGs and for three different groups of countries: OECD countries of 1990, countries with economies in transition in 1990, and the remaining countries in development (the UNFCCC non-Annex I parties). We document trends for the major emitting countries together with the European Union in more detail, demonstrating that effects of fuel markets and financial instability have had greater impacts on GHG trends than effects of income or population. These data (https://doi.org/10.5281/zenodo.2658138, Janssens-Maenhout et al., 2019) are visualised with annual and monthly global emissions grid maps of 0.1∘×0.1∘ for each source sector.

In this work structural and (sub)picosecond surface dynamical changes of genomic DNA isolated from different medicinal plants (Hyssopus officinalis, Majorana hortensis, Melissa officinalis, Mentha piperita, Mentha piperita cv "Cristal", Monarda didyma and Matricaria chamomilla), as probed with surface-enhanced Raman spectroscopy (SERS), are discussed upon modifying the acidic pH of mixtures consisting of silver colloidal suspension and DNA samples, respectively. Binding affinity changes of DNA with silver NPs and nucleic acids protonation are supposed to take place upon lowering the pH. A small percentage of Hoogsteen GC basepairs was found in Mentha piperita cv "Cristal" DNA, at low acidic pH. As a general observation, the global relaxation times corresponding to different functional groups of the investigated genomic DNAs, respectively, show a decrease of their values upon lowering the pH.

Graphene/AgNPs-based surface dynamics of native DNA functional groups at different acidic pH values was discussed using surface-enhanced Raman spectroscopy (SERS). Also, ab initio dynamics of Verlet type was investigated for nucleic acid nitrogenous bases adsorbed on a graphene surface, respectively. The experimental dynamical parameters were given in terms of full widths at half-maximum (FWHMs) and (sub)picosecond global relaxation times, associated with SERS bands. Furthermore, using density functional theory (DFT) as implemented in SIESTA and the velocity autocorrelation function (VACF), we have obtained the vibrational density of states (VDOS) for each of the four DNA bases placed on a pristine graphene layer. Graphical abstract Top: computed VbDOS for guanine. Bottom: Verlet temperature as a function of time.

Dynamical properties of functional groups in 2�-deoxyadenosine-5�-monophosphate (dAMP) compound, were identified by UV resonance Raman spectroscopy (UVRR), upon varying nucleotide concentration in aqueous solution (200-600 μM). The studied full-widths at half-maximum (fwhm�s) were found between 13 - 21 cm-1 and the corresponding global relaxation times were faster than 0.817 ps and slower than 0.506 ps. Also, the band around 1430 cm-1 (C4N9-δC8H) in the UV resonance Raman spectrum of dAMP molecule at 400 μM concentration in aqueous solution, was selected for vibrational band shape analysis through time correlation function (CF) concept. Current theories developed for vibrational dephasing (Kubo-Rothschild and Oxtoby) have been applied to this profile and relevant relaxation parameters have been obtained and discussed. The best fit parameters for this dissipation channel of the vibrational excitation energy were established. To our knowledge this is the first UVRR study on nucleotide vibrational band shape analysis through time correlation function concept.

The genetic relationship among three Streptocarpus parents and twelve F1 hybrids was assessed using sequence-related amplified polymorphism (SRAP) molecular markers and Fourier-transform infrared (FT-IR) spectroscopy. Both methods were able to discriminate F1 hybrids and parents as revealed by cluster analysis. For hybrid identification, the type III SRAP marker was the most effective due to the presence of male-specific bands in the hybrids. Different behaviors in the biochemical variability of DNA samples have been observed by FT-IR spectral analysis, which might be attributed to the inherent nature of the genomic DNA from parents and their F1 progenies. Mantel test was also carried out to compare morphological, SRAP, and FT-IR results based on genetic distances. The highest correlation coefficient was found between morphological and SRAP marker distances (R = 0.607, p &le, 0.022). A lower correlation was observed between the morphological and FT-IR distance matrix (R = 0.231, 0.008). Moreover, a positive correlation was found between the distances generated with SRAP and FT-IR analyses (R = 0.026) but was not statistically significant. These findings show that both SRAP and FT-IR techniques combined with morphological descriptions can be used effectively for nonconventional breeding programs for Streptocarpus to obtain new and valuable varieties.

Vibrational properties and structural behavior upon ultraviolet (UV) irradiation are reported here for DNAs isolated from three serovars of Salmonella bacteria, respectively (S. enteritidis, S. infantis and S. typhimurium) by using Fourier transform infrared spectroscopy (FT-IR). The FT-IR absorbance spectra were recorded for bacterial DNAs, control and UV irradiated samples (30 min, 1 h, 1 h 30 min), respectively, and are presented in the wavenumber ranges from 800 to 1800 cm−1 and from 3000 to 4000 cm−1, respectively. Molecular specific structural information has been found based on DNA marker bands, which were monitored primarily in terms of intensity changes. As a general remark, a serovar’s dependent nonlinear behavior has been detected for some FT-IR band intensities corresponding to Salmonella DNAs, as a function of irradiation time. Particularly, alterations in DNA functional groups and molecular geometry have been observed. Chemometric analysis such as principal component analysis (PCA) and hierarchical clustering analysis (HCA) were successfully applied for the identification of inter- and intra- serovar differences between DNA spectra, before and after UV irradiation. The elucidation of the main spectral features characteristic to pathogenic bacterial DNAs offers further opportunity for bacteria identification and for establishing the mechanisms of infections, leading to the development of innovative diagnosis tools and more effective therapies. Particularly, DNA-damaging agents are most effective in cancer therapy.

Potential medical application of UV laser pulses for cancer treatment is one of the main motivations behind this study. Surface-enhanced Raman signatures-based structural and (sub)picosecond dynamical characterization of genomic DNAs from different medicinal plants are presented. Moreover, structural and surface dynamical changes induced in genomic DNAs from selected medicinal plants species by UV femtosecond laser pulses (λ=280 nm, 170 fs) were investigated between 300 and 1800 cm−1. As a general observation, after nucleic acids irradiation some modes became higher in intensity especially in the wavenumber range between 1050 cm−1–1650 cm−1 or new profiles appeared in this interval in the surface-enhanced Raman spectroscopy (SERS) characteristics. Changes in the structure of dA, dG, dC dT residues, nucleic acid backbone and deoxyribose or unstacking of DNA bases were found. Large wavenumber shifts of the marker bands, which appear in the SERS spectra upon nucleic acids irradiation might be associated with loss of essential structural organization of DNA. As far as surface dynamics of DNA is concerned, for control nucleic acids functional groups, the global relaxation times varied between 0.39–1.77 ps and for UV femtosecond laser pulses-irradiated DNAs, this parameter was slower than 0.35 ps and faster than 1.63 ps. A decrease of the limit values of global relaxation times variation interval is to be observed upon UV treatment of nucleic acids. This faster surface dynamics might be explained by the presence of broken bonds (lesions) in DNA systems after laser pulses irradiation.

Building sector focuses on surpassing challenges linked to energy efficiency and mitigation measures related to greenhouse gas emissions, in consequence, it needs to improve building performance in the interest of decreasing impact over environment. Buildings with reduced long-term operating cost, environmental-friendly and moderate construction costs can be achieved only by multi-object optimization and cross-disciplinary analysis, embodying a holistic approach. Following the main principles of the holistic sustainable design approach, the paper presents a sustainable experimental modular laboratory involving various strategy in regard with sustainable building, as resource, cost and material efficiency, health and well-being, environmentally conscious design, life cycle design, modular design, reusable/recyclable element, environment-friendly demolition method, safety design, consideration of life cycle cost, materials cost and waste disposal cost. Besides the installation of renewable energy sources and conservation of energy, the holistic construction of laboratory included also an integrated design with consideration for technology, operation and maintenance, which involved the implementation of a monitored energy management system. The system provides an accurate overview of the building’s performance during operational phase. Although the monitoring is still in an incipient phase, recordings showed promising results regarding the behaviour of recycled-PET thermal wadding used for insulation and indoor comfort conditions.

Vibrational band shape analysis through time correlation function concept is widely used to obtain experimental information on the molecular dynamics of medium-size molecules in different environments. Interesting details are revealed by extending this technique to biomolecules such as functional groups of the nucleic acids in media approaching the physiological conditions. In this work a study into the UV resonance Raman (UVRR) vibrational half bandwidths of functional groups in LacDNA, upon lowering the pH (pH 6.4, pH 3.45) and in the presence of Mn2+ and Ca2+ ions, respectively, was of interest. The corresponding global relaxation times have been derived. Also, the 793 cm–1 UVRR band, corresponding to ν (backbone O–P–O, dT) oscillator of LacDNA in aqueous solutions, was selected for band shape-analysis. Vibrational relaxation appears as the dominant relaxation process for this mode, with vibrational dephasing being the most efficient for this oscillator. Current theories developed for vibrational depha...

In this work, Raman total half bandwidths and the corresponding global relaxation times of seven nucleic acid constituents (adenosine, guanosine hydrate, cytidine, thymidine, uridine, adenosine 5′-monophosphate disodium salt and 2′-deoxyadenosine-5′-monophosphate) have been identified, respectively. In our study, we have established that the full widths at half-maximum for the Raman bands of the investigated compounds are typically in the wavenumber range from 9 to 27 cm−1. Moreover, the molecular relaxation processes studied in this work are characterized by global relaxation times with values smaller than 1.18 ps and larger than 0.39 ps. Here, we can suppose that the dominant relaxation mechanism is the vibrational one.

A better understanding of the discrepancies in multi-scale inventories could give an insight into their approaches and limitations as well as provide indications for further improvements; international, national, and plant-by-plant data are primarily obtained to compile those inventories. In this study we develop a high-resolution inventory of Hg emissions at 0.05° × 0.05° for Jiangsu, China, using a bottom-up approach and then compare the results with available global/national inventories. With detailed information on individual sources and the updated emission factors from field measurements applied, the annual Hg emissions of anthropogenic origin in Jiangsu in 2010 are estimated at 39 105 kg, of which 51, 47, and 2 % were Hg0, Hg2+, and Hgp, respectively. This provincial inventory is thoroughly compared to three downscaled national inventories (NJU, THU, and BNU) and two global ones (AMAP/UNEP and EDGARv4.tox2). Attributed to varied methods and data sources, clear information gaps exist in multi-scale inventories, leading to differences in the emission levels, speciation, and spatial distributions of atmospheric Hg. The total emissions in the provincial inventory are 28, 7, 19, 22, and 70 % larger than NJU, THU, BNU, AMAP/UNEP, and EDGARv4.tox2, respectively. For major sectors, including power generation, cement, iron and steel, and other coal combustion, the Hg contents (HgC) in coals/raw materials, abatement rates of air pollution control devices (APCDs) and activity levels are identified as the crucial parameters responsible for the differences in estimated emissions between inventories. Regarding speciated emissions, a larger fraction of Hg2+ is found in the provincial inventory than national and global inventories, resulting mainly from the results by the most recent domestic studies in which enhanced Hg2+ were measured for cement and iron and steel plants. Inconsistent information on large power and industrial plants is the main source of differences in spatial distribution of emissions between the provincial and other inventories, particularly in southern and northwestern Jiangsu, where intensive coal combustion and industry are located. Quantified with Monte Carlo simulation, uncertainties in the provincial inventory are smaller than those of the NJU national inventory, resulting mainly from the more accurate activity data of individual plants and the reduced uncertainties in HgC in coals/raw materials.

Steel façade systems follow the actual tendencies in construction offering robust and sustainable solutions, able to answer to actual conditions and to offer adequate interior thermal comfort. The modern sandwich panels provided by the current façade system producers combine the required thermal resistance by varying the thermal insulation material and its thickness with the required structural demands. In addition, the façade layer could be over-coated with different materials, thus offering the required architectural aspect. Other advantages of the systems rely on industrialized prefabrication, fast installation and adaptability. They could also be disassembled and reused. The study presents an analysis of some envelope solutions existing on the market for buildings made of thin-walled cold-formed steel structural systems. The study consists in an annual energetic analysis of Mineral Wool (MW)-based system and a more sustainable recycled-PET thermal wadding-system. The analysis includes for input the own-produced energy by power grids and additional national grid energy while for output heating / cooling and electric appliances are considered. The study is completed by a life-cycle environmental analysis. The study revealed that when the thermal insulations have nearly the same U-value, the environmental impact of the recycled-PET thermal wadding-based system is smaller than that of MW-based system. Although the environmental impact of the recycled-PET thermal wadding is higher in the production stage, the insulation quantity of the material needed for PET-recycled thermal wadding to accomplish the required thermal resistance is much smaller than that of MW. Moreover, the original material for the recycled-PET thermal wadding is 100% recycled which implies a certain benefit of circularity to the material. The study also proves that the glazing ratio has also an impact on the thermal performances of studied systems: by reducing the overall glazing ratio of the envelope, the solar gain drops significantly, which leads to an increased heating energy demand, in order to meet indoor thermal comfort.

Clinical symptoms of hemoptysis, chest pain, dyspnea, night sweats and weight loss seen in a patient known for 14 years with pulmonary tuberculosis with sequelae lesions, will always guide the diagnose to a reactivated pulmonary tuberculosis. Yet, in this case, the latest pulmonary radiography revealed newly emerging bilateral lesions with the appearance of a macronodular opacity of medium intensity, discreetly non-homogeneous, located apical-sub-clavicular on the right side, but also with an apical-sub-clavicular cavity lesion on the left side, well defined, with uniform opaque content, and clear-cut outline. Complementary examinations, computed tomography and biopsy bronchoscopy, confirmed the diagnosis of upper right lobe pulmonary tumor with suspicion of aspergilloma in the upper left lobe.

The dynamics of genomic DNA and its nucleobases at a silver surface were explored using surface-enhanced Raman spectroscopy (SERS) and ab initio Verlet-type dynamics, respectively. The bands observed had full widths at half-maximum (FWHMs) in the wavenumber range 10–29 cm−1. (Sub)picosecond molecular dynamics with global relaxation times of 0.37–1.06 ps were noted. Furthermore, the on-surface ab initio dynamics of the DNA bases were examined using DFT with a Verlet-type algorithm. The results attained for these ergodic dynamic systems describe real systems quite well and could therefore be correlated with corresponding experimental data.

In this work the surface-enhanced Raman total half band widths of seven genomic DNAs from leaves of chrysanthemum (Dendranthema grandiflora Ramat.), common sundew (Drosera rotundifolia L.), edelweiss (Leontopodium alpinum Cass), Epilobium hirsutum L., Hypericum richeri ssp. transsilvanicum (Čelak) Ciocârlan, rose (Rosa x hybrida L.) and redwood (Sequoia sempervirens D. Don. Endl.) have been measured. We have shown that surface-enhanced Raman spectroscopy (SERS) can be used to study the fast subpicosecond dynamics of DNA in the proximity of a metallic surface. The dependencies of the total half band widths and the global relaxation times, on the DNA molecular subgroup structure and on the type of genomic DNA, are reported. In our study, the full widths at half-maximum (FWHMs) for the SERS bands of genomic DNAs from different leaf tissues are typically in the wavenumber range from 15 to 55 cm(-1). Besides, it can be observed that molecular relaxation processes studied in this work have a global relaxation time smaller than 0.71 ps and larger than 0.19 ps. A comparison between different ranges of FT-Raman and SERS band parameters, respectively, corresponding to DNA extracted from leaf tissues is given. It is shown that the interaction between DNA and a metallic surface has the potential to lead to a shortening of the global relaxation times, as compared with molecular dynamics in solution. We have found that the surface dynamics of molecular subgroups in plant DNA is, in some cases, about two times faster than the solution dynamics of nucleic acids. This can be rationalized in a qualitative manner by invoking the complex landscape of the interaction energy between the molecule and the silver surface.

Significance: Diabetic cardiomyopathy (DCM) is a frequent complication occurring even in well-controlled asymptomatic diabetic patients, and it may advance to heart failure (HF). Recent Advances: The diabetic heart is characterized by a state of “metabolic rigidity” involving enhanced rates of fatty acid uptake and mitochondrial oxidation as the predominant energy source, and it exhibits mitochondrial electron transport chain defects. These alterations promote redox state changes evidenced by a decreased NAD+/NADH ratio associated with an increase in acetyl-CoA/CoA ratio. NAD+ is a co-substrate for deacetylases, sirtuins, and a critical molecule in metabolism and redox signaling; whereas acetyl-CoA promotes protein lysine acetylation, affecting mitochondrial integrity and causing epigenetic changes. Critical Issues: DCM lacks specific therapies with treatment only in later disease stages using standard, palliative HF interventions. Traditional therapy targeting neurohormonal signaling and hemodynamics failed to improve mortality rates. Though mitochondrial redox state changes occur in the heart with obesity and diabetes, how the mitochondrial NAD+/NADH redox couple connects the remodeled energy metabolism with mitochondrial and cytosolic antioxidant defense and nuclear epigenetic changes remains to be determined. Mitochondrial therapies targeting the mitochondrial NAD+/NADH redox ratio may alleviate cardiac dysfunction. Future Directions: Specific therapies must be supported by an optimal understanding of changes in mitochondrial redox state and how it influences other cellular compartments; this field has begun to surface as a therapeutic target for the diabetic heart. We propose an approach based on an alternate mitochondrial electron transport that normalizes the mitochondrial redox state and improves cardiac function in diabetes.

Today, more than half of the urban population in Romania lives in collective housing units based on standard typologies built from large prefabricated reinforced concrete panels. These units were built on a large scale between the early 60s and 90s in order to rapidly provide housing for a large number of workers coming from the rural areas due to the intense expansion of the industries near the cities. With the evolution of technology and social routines, these housing units are now outdated and consume significant amounts of energy for heating, cooling and ventilation while, not being able to meet modern living needs. Based on the main aspects of sustainable development, a retrofitting scenario of these building is proposed, i.e.: (1) social, by rethinking the space configuration within the apartments, accessibility and transforming the inner courtyards, now occupied by cars, into a positive space; (2) economic, by offering a new building envelope based on a ventilated facade system and by improving the existing facilities for heating, ventilation and cooling; (3) environment, by integrating renewable energy systems and passive design strategies - a new extension module is placed on top of the buildings that behaves as an active core and house a solar panel array and energy distribution networks. With the transition of the existing power grids to the so-called “smart grids”, such buildings can become, consumers as well as suppliers, and the possible energy losses on the grid to be eliminated.

More than half of the urban population in Romania lives today in residential buildings made out of large prefabricated reinforced concrete panels. Since their initial design was made in the 1960’s, these housing units are now being technically and morally outdated, consuming large amounts of energy for heating, cooling, ventilation and lighting, while failing to meet the needs of the contemporary life-style. Due to their widespread use, the design of a system that improves their energy efficiency would have a real impact, not only on the energy consumption of the residential sector, but also on the quality of life that it offers. Furthermore, with the transition of today’s existing power grid to a “smart grid”, buildings could become an active element for future electricity networks by contributing in micro-generation and energy storage. One of the most addressed issues today is to find locally adapted strategies that can be applied considering the 20-20-20 EU policy criteria and to offer sustainable and innovative solutions for the cost-optimal energy performance of buildings adapted on the existing local market. This paper presents a possible adaptive design scenario towards sustainable retrofitting of these housing units. The apartments are transformed in order to meet the current living requirements and additional extensions are placed on top of the building, replacing the unused roof space, acting not only as housing units, but as active solar energy collection systems. An adaptive building envelope is ensured in order to achieve overall air-tightness and an elevator system is introduced to facilitate access to the upper levels., {"references":["A. Botici., V. Ungureanu., A. Ciutina, A. Botici, D. Dubina., Sustainable Retrofitting of Large Prefabricated Concrete Residential Buildings, Central Europe towards Sustainable Building, 2013.","L. A. Fülöp , M. J. Riihimäki, Opportunities in Sustainably Retrofitting the Large Panel Reinforced Concrete Building Stock in East Europe, Opportunities and challenges in sustainably retrofitting the large panel concrete building stock, 2014, pp. 1-8, Oizonturi Universitare Press, Timsoara, Romania.","S. S. Lewin, C. Goodman, Transformative Renewal and Urban Sustainability. Journal of Green Building: Fall 2013, Vol. 8, No. 4, pp. 17-38.","M. Popov, M. Szitar, M. Sămânță, An Integrated Approach - Retrofitting the Blocks of Flats Made of Prefabricated Panels, Opportunities and challenges in sustainably retrofitting the large panel concrete building stock, 2014, pp. 131-144, Oizonturi Universitare Press, Timsoara, Romania.","M. Szitar, D. Grecea, M. Popov, M. Adam, M. Sămânță, Sustainable retrofitting of blocks of flats: environmental, economic and social aspects, Recent Advances in Civil and Mining Engineering 2013, ISBN: 978-960-474-337-7.","M. Economidou. & all. (2011). Europe's Buildings Under The Microscope – A Country-by-Country Review of the Energy Performance of Buildings: 26-53, BPIE: Buildings Performance Institute of Europe, 2011 pp.98-122.","2020 European Commission, EU Climate and Energy Package, 2012, online at: http://ec.europa.eu/clima/policies/strategies/2020/documentation_en.htm last accessed on 26.08.2016.","M. Popov, M. Szitar, M. Sămânță, An Integrated Approach - Retrofitting the Blocks of Flats Made of Prefabricated Panels, RESPIRE Seminar - Opportunities and challenges in sustainably retrofitting the large panel concrete building stock, 2013, online at http://virtual.vtt.fi/virtual/respire/Seminar%20%282%29/10_Popov.pdf, last accessed on 25.08.2016.","M. Iacovou, A. Skew (2011). Population and Social Conditions. EU: Eurostat Statistics in focus 52:1-8.\n[10]\tA. Botici., V. Ungureanu., A. Ciutina, A. Botici, D. Dubina., Structural Interventions for Rehabilitation of Precast Large Concrete Panels for Residential Buildings, Proc. of the 2nd International Conference on Protection of Historical Constructions, 2014 Antalya, Turkey, pp. 133-139.\n[11]\tȘtefana Bădescu, Radu Radoslav, Urban Sustainable Strategies, Opportunities and challenges in sustainably retrofitting the large panel concrete building stock, 2014, pp. 9-22, Oizonturi Universitare Press, Timsoara, Romania.\n[12]\tM. Popov, M. Sămânță, Team Uptim - Project Manual #3, Material submitted to Solar Decathlon Europe 2014 Competition on 22nd November, 2013, online at: http://www.arh.upt.ro/?page_id=576, last accessed on 23.08.2016.\n[13]\tJ. Ekanayake, K. Liyanage, J. Wu, A. Yokoyama, N. Jenkins,Smart Grid. Technology and Applications, 2012, pp. 6-9, John Wiley & Sons, Ltd. ISBN: 978-0-470-97409-4.\n[14]\tPassive House Institute, Criteria for the Passive House, Enerphit and Phi Low Energy Building Standard, 2015, Darmstatd\n[15]\tVlad Gaivoronschi, Patterns of the Traditional Space, 2002, Paideia Press, Bucharest, Romania.\n[16]\tJeremy Faludi, Michael D. Lepech, and George Loisos (2012) Using Life Cycle Assessment Methods to Guide Architectural Decision-Making for Sustainable Prefabricated Modular Buildings. Journal of Green Building: Summer 2012, Vol. 7, No. 3, pp. 151-170.\n[17]\tInternational Living Future Institute, Living Building Challenge 2.1- A Visionary Path to a Restorative Future, May 2012."]}

The classical methods of genomic identification rely on PCR and DNA sequencing, techniques that are destructive and time consuming. Instead, the new advances in the spectroscopic field bring in a more rapid approach for identification at strain level. Raman spectroscopy and more recently, surface-enhanced Raman spectroscopy (SERS) are used to create “molecular fingerprints” for accurate, non-intrusive genomic identification, being also used in DNA studies of plant species (Muntean CM et al., J Raman Spectrosc 44(6):817–822, 2013; Muntean CM, et al., J Raman Spectrosc 42(11):1925–1931, 2011). The essential information from complex spectroscopic patterns is usually extracted by using chemometrics, such as PCA (Heraud P, et al., J Chemom 20(5):193–197, 2006). However, the discrimination using PCA on SERS spectra collected from plant extracted DNA samples is scarcely reported in the literature so far (Qiu L et al., Vib Spectrosc 72:134–141, 2014).

In this work, Fourier transform infrared (FT-IR) spectra of seven untreated and UV irradiated genomic DNAs extracted from leaves of different in vitro grown plant species, respectively, have been analyzed in the 800–1800 cm −1 spectral range, in order to investigate their screening characteristic features and their structural response to UV treatment at 253.7 nm. As far as the untreated genomic plant DNAs are concerned, both A and B backbone vibrational modes were detected. A low amount of Z-DNA was also found in the untreated nucleic acids, especially for DNA from Rosa . Besides, in vitro grown plant species dependent UV degradation of DNA has been observed. The major UV influence on nucleic acids from leaf tissues was observed in the case of DNA isolated from Drosera , Hypericum , Leontopodium and Rosa , respectively. It seems, that in a lesser extent is affected Sequoia DNA by UV irradiation at 253.7 nm. Particularly, alterations in nucleic acid bases, base pairing and base stacking have been found. Also, changes in DNA conformation and sugar groups were detected. The DNA conformation seems to be in our cases, a mixture of conformational states. However, A-form DNA is the predominant conformation in both non-irradiated and irradiated samples.

Over the last decade, Romania has faced a rapid expansion in the residential sector. The need for housing has increased significantly next to the ever-developing urban areas. One of the main targets for our country is to reduce the total energy consumption stipulated by the Energy Performance of Building Directive (EPBD). The main purpose of the study is to determine a comparative solution of the building envelope for a single-family house with a given net area and interior volume suited for a family with two adults and two children. The study is applied on a masonry two story house with continuous concrete foundations and a flat roof. This kind of scenario fits the local seismic building codes and currently, is the most accessible solution on the market. According to the national energy efficiency building requirements two different envelope systems are considered: monolithic wall (autoclaved aerated blocks) and multi-layered wall (large ceramic blocks with additional insulation), both having the same U value required by the above-mentioned code. Because the monolithic wall solution should have a shorter execution period than a multi-layered component, we intent to compare cost-efficiency scenarios of the two systems given local building standards. In both cases, the masonry acts as the main structural component of the system with similar concrete components. Because, in Romania, the most used thermal envelope system is based on polystyrene (EPS), a material with high embodied energy, the paper studies alternative solutions for residential buildings, with lower impact on the surrounding environment.

UV (275 nm) resonance Raman spectra of LacDNA 22-mer duplex [d(TAATGTGAGTTAGCTCACTCAT) · d(ATGAGTGAGCTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn2+ and Ca2+ metal ions, respectively. Also, the UV (275 nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti-sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned. Large changes in the UV (275 nm) resonance Raman spectra of LacDNA duplex were observed at pH 3.45 as compared with the corresponding spectrum at pH 6.4, in the absence of divalent metal ions and at low concentrations of Ca2+ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn2+ and Ca2+) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn2+ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493 cm−1. Copyright © 2013 John Wiley & Sons, Ltd.

In this work, the surface-enhanced Raman scattering (SERS) spectra of seven genomic DNAs from leaves of chrysanthemum (Dendranthema grandiflora Ramat.), common sundew (Drosera rotundifolia L.), edelweiss (Leontopodium alpinum Cass), Epilobium hirsutum L., Hypericum richeri ssp. transsilvanicum (Celak) Ciocârlan, rose (Rosa x hybrida L.) and redwood (Sequoia sempervirens D. Don. Endl.), respectively, have been analyzed in the wavenumber range 200–1800 cm−1. The surface-enhanced Raman vibrational modes for each of these cases, spectroscopic band assignments and structural interpretations of genomic DNAs are reported. A high molecular structural information content can be found in the SERS spectra of these DNAs from leaf tissues. Based on this work, specific plant DNA–ligand interactions or accurate local structure of DNA might be further investigated using surface-enhanced Raman spectroscopy. Besides, this study will generate information which is valuable in the development of label-free DNA detection for chemical probing in living cell. Copyright © 2013 John Wiley & Sons, Ltd.

In this work the Raman total half band widths of five nucleic acids nitrogenous bases (adenine, guanine, cytosine, thymine and uracil) have been measured, respectively. Raman scattering can be used to study the fast subpicosecond dynamics of purinic and pyrimidinic nucleic acids bases in solid state. The dependencies of the total half band widths and of the corresponding global relaxation times, on atomic groups and on the type of free nucleic acids bases, are reported. In our study, the full widths at half-maximum (FWHMs) for the Raman bands of nucleic acids bases, are typically in the wavenumber range from 9.5 to 22 cm−1. Besides, it can be observed that molecular relaxation processes studied in this work, have a global relaxation time value smaller than 1.06 ps and larger than 0.46 ps. We have found that the band centered at 941 cm−1 of adenine, the profiles near 1232 cm−1, 1678 cm−1, in the case of guanine, the band around 1116 cm−1 attributed to cytosine, the profiles at 1490, 1673 cm−1 attributed to thymine and several Raman bands corresponding to atomic groups in uracil, respectively, are suitable for further studying the dynamical behavior of molecular fragments in nucleic acids bases.

There is a growing body of evidence pointing to the role of purinergic signaling in the development and progression of various conditions that have inflammation as a common pathogenetic denominator. The aim of the present study was to assess the involvement of P