Search

A number of new N-alkylated derivatives of N-acylhydrazones have been prepared via one pot three-component reaction between hydrazide, aldehyde, and α,β-unsaturated ester using 1,4-diazabicyclo[ 2,2,2]octane (DABCO), as an inexpensive base and tetrabutylammonium bromide (TBAB), an ionic organic salt media, under solvent-free conditions. In case of 2-hydroxy benzaldehyde, the reaction proceeds with the exclusive formation of the N-alkyl derivative without any concurrent O-alkylation side reaction.

Additional file 1: Table 1. Association of Stage I and Stage II/III Periodontitis With Myopia

Additional file 1. Table S1. Clinical Characteristics of the Healthy, the Localized Stage I Periodontitis and the Localized Stage II/III Periodontitis. Table S2. Multiple Logistic Regression Analyses for Localized Stage I and Stage II/III Periodontitis with Erythrocyte Indices.

application/pdf

The performance of electrocardiographic (ECG) voltage criteria to identify left and right ventricular hypertrophy (LVH and RVH) in young Asian female adults have not been clarified so far. In a sample of 255 military young female adults, aged 25.2 years on average, echocardiographic LVH was respectively defined as the left ventricular mass (LVM) indexed by body surface area (BSA) (≥88 g/m2) and by height2.7 (≥41 g/m2.7), and RVH was defined as anterior right ventricular wall thickness >5.2 mm. The performance of ECG voltage criteria for the echocardiographic LVH and RVH were assessed by area under curve (AUC) of receiver operating characteristic (ROC) curve to estimate sensitivity and specificity. For the Sokolow-Lyon (the maximum of SV1 or SV2 + RV5 or RV6) and Cornell (RaVL + SV3) voltage criteria with the LVM/BSA ≥88 g/m2, the AUC of ROC curves were 0.66 (95% confidence intervals [CI]: 0.52–0.81, P = .039) and 0.61 (95% CI: 0.44–0.77, P = .18), respectively. For these 2 ECG voltage criteria with the LVM/height2.7 ≥41 g/m2.7, the AUC of ROC curves were 0.64 (95% CI: 0.52–0.75, P = 0.11) and 0.73 (95% CI: 0.61–0.85, P = 0.0074), respectively. The best cut-off points selected for the Sokolow-Lyon and Cornell voltage criteria with echocardiographic LVH in young Asian females were 26 mm and 6 mm, respectively. In contrast, all the AUC of ROC curves were less than 0.60 and not significant according to the Sokolow-Lyon (the maximum of RV1 + SV5 or V6) and Myers’ voltage criteria (eg, the voltage of R wave in V1 and the ratios of R/S in V1, V5 and V6) with echocardiographic RVH. There was a suggestion that the ECG voltage criteria to screen the presence of LVH should be adjusted for the young Asian female adults, and with regard to RVH, the ECG voltage criteria were found ineffective.

Cryptes utzoni Lin, Kondo & Cook sp. n. (Fig. 4) urn:lsid:zoobank.org:act: 8509AE5F-35CB-4546-9E78-2217 ED214152 Material examined. Holotype. Adult female (ID: LGC02307 f6). Yeo Lake Nature Reserve, WA,/ Australia. - 28.08° S, 124.32° E./ ex Acacia aneura, 1.x.2013,/ L. G. Cook (WAM: 1 female on 1 slide). GenBank accession numbers: 18S: MH 844470; 28S: MH 886632; COI: MH 886618; EF-1 α: MH 886635. Paratype. Adult female (ID: LGC02307 f4). Same data as for holotype (WAM: 1 female on 1 slide). GenBank accession numbers: 18S: MH 844468; 28S: MH 886630; COI: MH 886616; EF-1 α: MH 886633. Paratype. Adult female (ID: LGC02307 f5). Same data as for holotype (ANIC: 1 female on 1 slide). GenBank accession numbers: 18S: MH 844469; 28S: MH886631; COI: MH886617; EF-1 α: MH886634. Paratypes. Adult females (ID: LGC02307 f1, LGC02307 f2). Same data as for holotype (WAM: 2 females on 2 slides). Paratypes. Adult females (ID: LGC02307 f3, LGC02307 f7, LGC02307 f8). Same data as for holotype (ANIC: 3 females on 3 slides). Diagnosis. Adult females of C. utzoni can be identified and distinguished from C. baccatus and A. hakearum by the following combination of morphological character states (the contrasting states for the other two species are given in Table 3): (i) live adult female with a pale linear stripe with irregular black borders running longitudinally from head to area anterior to anal plates on mid dorsum; slide-mounted female with (ii) dorsal setae of two sizes; (iii) tubular ducts abundant on body margin and submargin on dorsum; on venter, present throughout more abundant near margin, but absent from anterior to mouthparts (iv) each anal plate almost half-circular in shape, appearing crescentic when open, with three apical setae and two discal setae; (v) marginal setae setose, often with slightly curved apices; (vi) sclerotised areas on derm near stigmatic spines absent; (vii) anterior stigmatic areas each with two stigmatic spines, posterior stigmatic areas each with a single stigmatic spine; (viii) anal cleft shallow; (ix) each antenna 8-segmented; (x) cup-shaped invaginations of ventral tubular ducts of two sizes; (xi) tibio-tarsal articulatory sclerosis absent; (xii) claw denticle present; and (xiii) both claw digitules slender. Cryptes utzoni differs from C. baccatus at the following DNA sequence positions (mapped to the GenBank reference sequence listed for each gene). Dashes (-) represent deletions. 18S: Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH844467. Site# 156 (A), 171 (T), 252 (T), 314 (T). 28S: Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH886629. Site# 11 (T), 29 (G), 31–53 (TGGTCGTCGCGCTCGCGCGACGG), 55–56 (TT), 146 (C), 155 (A), 162–163 (GT), 176–193 (ACGTTTAGGCGTGCGTGG), 195 (T), 209 (A), 249 (A), 275 (G), 277–288 (TG), 280–281 (GT), 283 (A), 285 (G), 289–296 (AAAT----), 298–300 (TTA), 303–305 (CGC), 337 (C), 420 (A), 429–430 (--), 437–445 (--- ------), 4 47–450 (----), 453 (G), 456–459 (---A), 461 (A), 467 (A), 469–470 (AA), 477 (C), 485 (G), 554 (C), 572 (G), 576 (C), 598 (T), 600 (A), 604 (A), 607–608 (CT), 617 (G), 649–650 (AT), 661 (C), 677–688 (TGCTTTTCGGAG), 694–695 (CG), 701 (A). COI: Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH886615. Site# 6 (T), 9 (G), 27 (T), 32 (T), 64 (T), 66 (A), 69 (C), 90 (C), 96 (G), 108 (C), 120 (A), 126 (A), 133 (A), 135 (T), 142 (A), 159 (C), 177 (T), 207 (T), 221–223 (CAA), 227 (T), 234 (G), 241–242 (AC), 245–246 (GA), 248–249 (GA), 252 (G), 257 (A), 264 (G), 273 (A), 279 (T), 282–283 (AT), 288 (C), 300 (T), 303 (T), 306 (T), 342–343 (TA), 351 (A), 355 (T), 363 (T), 366 (G), 380–381 (GG), 387–388 (AT), 390 (G), 397 (A), 399 (T), 404 (G), 408 (G), 410 (A), 412 (A), 415–417 (TAT), 420 (T), 423–426 (AAGA), 435 (C), 438 (G), 447 (T), 453 (T), 456 (A), 459 (A), 466 (G), 477 (C), 489 (A), 492 (G), 534 (G), 543 (C), 546–547 (CT), 558 (A), 573 (C), 579 (T). EF-1α: Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH886640. Site# 15 (G), 66 (C), 87 (C), 102–103 (AC), 107 (G), 111 (C), 113 (C), 117–119 (TGG), 124 (T), 128 (A), 130–132 (TGT), 136–137 (AG), 143–144 (GT), 151 (C), 153 (T), 157 (A), 161 (C), 195 (C), 207 (C), 219 (T), 222 (A), 258 (C), 267 (C), 279 (C), 300 (T), 321 (G), 339 (C), 369 (G), 372 (T), 378–379 (TT), 399 (T), 408 (C), 423 (G), 426 (T), 451 (T), 455 (A), 458 (C), 463 (T), 467–470 (TTGT), 474–475 (GC), 483 (G), 486 (A), 490–491 (GT), 495 (C), 500 (A), 508–510 (TCT), 516 (C), 522 (C), 561 (T), 573 (T), 597 (T), 600 (T), 609 (T). Description. Adult female (Figs 4, 1B) (drawing and measurements based on eight specimens: LGC02307 f1 to LGC02307 f8, all in good condition). Unmounted specimens. Live adult female (Fig. 1B) body highly convex, truncated dorsally, yellowish to light brown in colour; with a white longitudinal stripe with irregular black border that is composed of pigments (which disappear during slide-mounting processes) running longitudinally from head to area anterior to anal plates on mid dorsum (Fig. 1); with some small, raised, irregularly-rounded black spots on the dorsum of unmounted specimens. Part of body margin covered by a thin layer of white wax, with ventral and upper part of body devoid of wax, at least on young females. All specimens were found on the stems of the host plant. Slide-mounted specimens. Body of young adult female (Fig. 4) circular, 2.0– 3.6 mm long, 1.5–3.4 mm wide. Dorsum. Dorsum mostly membranous but sclerotised around anal plates on older specimens (not illustrated on Figure 4 as drawing was based on a young adult female). Dorsal setae setose and of 2 sizes: (i) shorter setae each 8–10 Μ m long, sparsely scattered throughout dorsum except absent medially from end of head to anal plates; and (ii) longer setae each 20–40 Μ m long, restricted to a broad band submedially on each side. Dorsal tubular ducts of 1 type, each with a cup-shaped invagination 5–7 Μ m wide, a broad outer ductule 25–40 Μ m long, a narrow inner ductule 13–20 Μ m long, with a well-developed terminal gland; abundant in a broad marginal to submedial band around dorsum. Dorsal pores flat, simple and ovoid, each about 3–4 Μ m in maximum dimension, scattered throughout dorsum. Dorsal microducts, dorsal tubercles and preopercular pores absent. Anal plates each half- circular, 145–165 Μ m long, 50–65 Μ m wide; with 3 setae apically on each plate plus 2 discal setae, each seta 45–55 Μ m long. Ano-genital fold probably with 2 pairs of setae on anterior margin and 5 pairs laterally. Anal ring well sclerotised, 45–50 Μ m in diameter, probably bearing 5 pairs of setae, each about 125 Μ m long (but only 1 female, LGC02307 f5, could be measured). Margin. Marginal setae setose and often with apex slightly bent, 30–55 Μ m long, arranged in a single marginal row; with 11–18 setae on head between stigmatic areas, 2–5 on each side between anterior and posterior stigmatic areas, and 10–14 on each side of abdomen; marginal setae at apex of abdomen not differentiated from others. Anal cleft present, shallow. Stigmatic cleft absent; stigmatic spines each 21–30 Μ m long with a rounded apex, some with apex slightly bent; sometimes bifurcated in anterior stigmatic area (e.g., on specimen LGC02307 f7); with 2 spines in each anterior stigmatic area and with 1 in each posterior stigmatic area. No eyespots detected. Venter. Derm entirely membranous; segmentation visible on mid-areas of thorax and abdomen. Ventral setae setose, each 10–15 µ m long, sparsely scattered across venter. Pregenital segment (VII) with a single pair of pregenital setae, each seta 23–33 Μ m long. Multilocular disc-pores each about 8 Μ m in diameter and with 8–10 loculi; abundant around genital opening, becoming progressively less frequent across preceding abdominal segments where present in irregular transverse rows, plus in submedial clusters on each abdominal and meta- and mesothoracic segments. Each stigmatic furrow with a band of spiracular disc-pores, each pore mostly with 5 loculi and about 6 Μ m in diameter, with 22–25 pores present between each spiracle and body margin. Ventral microducts each with an outer ductule 3 Μ m wide and an inner ductule that divides into 2–4 long filaments; sparsely scattered throughout venter but abundant on head between antennae and posterior to labium. Ventral tubular ducts each with a broad outer ductule 25–33 Μ m long, and a narrow inner ductule 13–15 Μ m long with a well-developed terminal gland; ducts of two types: one with a cup-shaped invagination 5–7 Μ m wide, mostly present in a broad marginal to submarginal band and sparsely present in median areas of abdomen and thorax but absent from the area immediately anterior to mouthparts; and another with a cup-shaped invagination 4–5 Μ m wide present medially on thorax, especially near mouthparts. Spiracles well developed: anterior spiracle + peritreme 102–114 Μ m long, peritreme 48–66 Μ m wide; posterior spiracle + peritreme 108–120 Μ m long, peritreme 60–66 Μ m wide. Legs well developed; each with tibio-tarsal articulation but no articulatory sclerosis; each claw 33–36 Μ m long, with a denticle; both claw digitules fine and slightly shorter than thin tarsal digitules; trochanter + femur 1 50–180 Μ m and tibia + tarsus 150–180 Μ m. Antennae each with 8 segments, total length 210–252 Μ m; scape and pedicel each with about 2 setae, segments III and IV without setae, segment V with 1 short seta and 2 longer setae, segment VI with 1 fleshy seta, segment VII with 1 fleshy and 2 setose setae, and segment VIII with a pair of fleshy setae, about 4 stiff setae and 3 setose setae. Clypeolabral shield 192–210 Μ m long, 186–210 Μ m wide. Labium 66–72 Μ m long, 90–120 Μ m wide, with 3 pairs of setae. Etymology. The species epithet honours Danish architect Jørn Utzon, who designed the UNESCO World Heritage-Listed Sydney Opera House (Sydney, Australia) and frequently used sculptural curves in his designs. In life, the adult females of C. utzoni (Utzon's scale) and their tests invoke the curves of the arching white shells of the Sydney Opera House., Published as part of Lin, Yen-Po, Kondo, Takumasa, Gullan, Penny J. & Cook, Lyn G., 2018, A newly recognised species of Cryptes Maskell 1892 (Hemiptera: Coccidae) from Western Australia, pp. 101-114 in Zootaxa 4508 (1) on pages 108-112, DOI: 10.11646/zootaxa.4508.1.6, http://zenodo.org/record/2606878

Lin, Yen-Po, Kondo, Takumasa, Gullan, Penny J., Cook, Lyn G. (2018): A newly recognised species of Cryptes Maskell 1892 (Hemiptera: Coccidae) from Western Australia. Zootaxa 4508 (1): 101-114, DOI: https://doi.org/10.11646/zootaxa.4508.1.6

Buergeria japonica is a widely distributed treefrog occurring from Ryukyu Archipelago to Taiwan. Across this wide distributional range, we combined molecular, acoustic, morphological, and behavioral characters to clarify the taxonomic status among these insular populations. Genetic differentiation in mitochondrial sequences indicated an over 16% divergence among two deeply divergent clades: Japanese clade distributes in Ryukyu Archipelago and northwestern drainages of Taiwan, while Taiwanese clade distributes in the remaining drainages on Taiwan. The Taiwanese clade can be distinguished from the nominative species not only by molecular and morphological differences, but also distinguishable by considerable acoustic differentiation, which is extraordinarily noticeable for an additional type of long call that never recorded from Japanese clade. The two clades form a parapatric distribution pattern with narrow contact zones both in western and eastern Taiwan. Playback experiments indicated that male frogs show significantly stronger defensiveness against conspecific calls rather than heterospecific calls, indicating that these signals play a crucial role in species recognition. Here we describe the Taiwanese clade as a new species; the behavioral response and the magnitude of gene flow across their contact zones are especially worth for detailed studies.

Austrolecanium cryptocaryae Lin & Cook sp. n. (Fig 4) urn:lsid:zoobank.org:act:C52B76D7-35E0-4767-92EA-E2978C484BEB Material examined. Holotype. Adult female (ID: LGC00727 f2). Australia: Mt Glorious, D���Aguilar National Park, Queensland, - 27.33�� S, 152.75�� E, on Cryptocarya microneura, 28.iv.2007, L. G. Cook (ANIC: 1/ 1 female). GenBank accession numbers: 18S: KY816391; 28S: KY816400; COI: KY808494; EF-1��: KY824059; wingless: KY798546. Paratype. Adult female (ID: LGC00727f1). Same data as for holotype (ANIC: 1/1 female). GenBank accession numbers: 18S: KY816390; 28S: KY816399; COI: KY808493; EF-1��: KY824058; wingless: KY798545. Paratype. Adult female (ID: LGC00831 f1). Australia: Mt Glorious, D���Aguilar National Park, Queensland, - 27.33�� S, 152.75�� E, on C. microneura, 15.iii.2008, L. G. Cook (ANIC: 1/ 1 female). GenBank accession numbers: 18S: KY816392; 28S: KY816401; COI: KY808495; EF-1��: KY824060; wingless: KY798547. Paratype. Adult female (ID: LGC00831 f2). Same data as for paratype LGC00831 f1 (ANIC: 1/ 1 female). GenBank accession numbers: 18S: KY816393; 28S: KY816402; COI: KY808496; EF-1��: KY824061; wingless: KY798548. Diagnosis. Adult females of A. cryptocaryae can be identified and distinguished from A. sassafras and A. cappari by the following combination of morphological character states (the contrasting states for the other two species are given in Table 3); (i) dorsal setae sharply spinose; (ii) dorsal microducts present along body margin; (iii) marginal setae bluntly spinose; (iv) each anal plate with three apical setae and one seta on inner margin; (v) each supporting bar of anal plate with four setae; and (vi) anal ring with four pairs of setae, each longer than 300 �� m. Austrolecanium cryptocaryae differs from A. sassafras at the following DNA sequence positions (mapped to the GenBank reference sequence listed for each gene): 18S: Reference sequence: KY816394. Site# 22 (A), 309 (-). 28S: Reference sequence: KY816403. Site# 9 (C), 29 (G), 49 (G), 87 (A), 89 (A), 90 (C), 143 (T), 154 (T), 166 (C), 167 (T), 175 (T), 255 (T), 381 (C), 454 (-), 476 (T), 514 (G), 544 (T). COI: Reference sequence: KY808497. Site# 3 (A), 12 (A), 18 (T), 24 (T), 27 (C), 33 (C), 36 (C), 41 (A), 43��� 45 (TTA), 47���48 (CT), 51 (T), 61 (G), 63 (T), 69 (T), 72 (T), 75 (C), 79 (C), 87 (C), 93 (C), 105 (T), 108 (T), 120 (G), 123 (T), 126 (A), 128 (T), 141 (T), 144 (A), 151���154 (AGAT), 156���157 (TT), 159 (A), 165 (A), 168 (G), 174 (C), 177 (A), 183 (T), 187 (T), 189 (A), 192 (A), 195 (T), 198 (A), 206 (A), 213���214 (TT), 222���223 (CT), 225 (A), 227 (T), 240 (T), 243 (T), 255���258 (TTTC), 261 (T), 271 (C), 273 (T), 283 (T), 290���291 (CA), 294 (G), 297���298 (TT), 300 (A), 301���303 (ACA), 309 (C), 312���313 (TT), 328 (A), 330 (C), 336 (G), 339 (C), 343 (A), 345 (A), 348 (T), 354 (T), 360 (C), 363 (A), 366 (C), 369 (T), 373 (T), 375���376 (AA), 378 (T), 381���382 (AT), 385 (G), 387 (T), 389���391 (GAC), 396 (C), 398 (A), 405���406 (AA), 410���412 (TTT), 417 (T), 419 (A), 421 (A), 423���424 (TT), 426 (T), 429 (T), 435 (C), 450 (A), 456 (T), 459 (T), 462 (T), 465 (T), 468���469 (TC), 471 (T), 474 (A), 477 (C), 480 (C), 483���484 (TT), 489 (A), 492 (A), 495 (A), 501 (T), 505 (A), 507���508 (AT), 510 (T), 513 (C), 528 (C), 537 (T), 547 (A), 554���555 (AT), 558 (A), 565 (G), 567 (T), 570 (C), 572 (A), 579 (T). EF- 1��: Reference sequence: KY824062. Site# 9 (T), 18 (C), 24 (G), 165 (C), 171 (G), 183 (A), 189 (T), 216 (C), 249 (G), 292 (T), 321 (C), 324 (A), 412 (T), 459 (C). wingless: Reference sequence: KY798543. Site# 33 (A), 123 (G), 126 (C), 129 (G), 156 (T), 159 (G), 171 (C), 183 (A), 201 (C), 205 (T), 207 (G), 215���216 (GT), 247 (C), 255 (A), 276 (T). Description. Adult female (Fig. 4) (drawing and measurements based on four specimens: LGC00727 f1, LGC00727 f2, LGC00831 f1 and LGC00831 f2, all in good condition). Unmounted specimens. Live insects (Fig. 1A) bright green with a shiny dorsum, partially transparent near body margin. All specimens were found on the underside of leaves of the host plant. Mounted specimens. Body oval and symmetrical, 5.3���6.5 mm long, 4.6���5.2 mm wide. Dorsum. Dorsum mostly membranous but sclerotized around inner margin of each stigmatic cleft and on dorsal derm around anal plates. Dorsal setae sharply spinose, each 5���12 �� m long, scattered throughout dorsum. Dorsal pores of 2 kinds: (i) microductules, each about 1 �� m in diameter, with inner ductule tubular, 8���15 �� m long, filamentous distally, frequent along margin; and (ii) preopercular pores, each 3���8 �� m in diameter, scattered over dorsum, but most situated in a broad area anterior to anal plates, forming a cluster of 528���692 pores. Anal plates each triangular with anterior and posterior margins subequal in length, 294���354 �� m long, 96���126 �� m wide; with 3 setae apically on each plate plus 1 seta on inner margin anterior to apical setae. Anogenital fold with 2 pairs of setae along anterior margin, each 23���30 �� m long; also with a distinct supporting bar on each margin, each bar with 4 setae (50���68 �� m long), 2 marginally and 2 posteriorly. Anal tube shorter than length of anal plates, 213���300 �� m long; anal ring 96���116 �� m in diameter, bearing 4 pairs of setae, each seta 342���432 �� m long. Margin. Each marginal seta with a rounded apex, longer than a dorsal seta, 11���29 �� m long, arranged in a single marginal row, with 16���22 setae on head between stigmatic clefts, 4���10 on each side between anterior and posterior stigmatic clefts, and 11���18 on each side of abdomen; marginal setae on anal lobes not differentiated from others. Each stigmatic cleft mushroom-shaped, with narrow cleft broadening into a wide space; each with a well-defined area of sclerotization along inner margin of cleft and with 6���12 stigmatic spines; each spine 12���48 �� m long, parallel-sided, with a rounded to clavate apex. Venter. Venter membranous; segmentation only visible on abdomen. Ventral setae hair-like, each 5���7 �� m long, sparsely scattered across venter. Pregenital segment (VII) with a single pair of long pregenital setae, each seta 114��� 144 �� m long. A group of 11���15 setae, each 12���39 �� m long, present near each pregenital seta and just anterior to each group of pregenital disc-pores. Pregenital disc-pores each 5���8 �� m in diameter, mostly each with 6 loculi, present in 2 groups each of 6���16 pores on either side of anogenital fold. Each stigmatic furrow with a band of spiracular disc-pores, each pore mostly with 5 loculi and about 6 �� m in diameter, with 87���124 pores present between each spiracle and stigmatic cleft. Ventral microducts minute, each with outer ductule 3���6 �� m long and inner ductule inconspicuous; sparsely scattered throughout venter but concentrated around mouthparts. Ventral tubular ducts absent. Spiracles well developed: anterior spiracle plus peritreme 108���162 �� m long, 60���132 �� m wide; posterior spiracle plus peritreme 126���162 �� m long, 108���144 �� m wide. Legs much reduced, each 91���130 �� m long, trochanter fused with femur; tarsal digitules narrower than claw digitules, each 9���17 �� m long, with minute apical knob; claw digitules each 15���23 �� m long, with minute apical knob; claw without a denticle. Antennae each with 6 segments but segmentation often obscure, each antenna 132���192 �� m long in total; all setae on terminal 3 segments fleshy, each 8���27 �� m long. A pair of interantennal setae present, each 27���33 �� m long. Mouthparts positioned at centre of body. Clypeolabral shield 174���180 �� m long, 120���150 �� m wide. Labium 84 �� m long, 90��� 120 �� m wide. Etymology. The other two species of Austrolecanium are named after their host plants, so we continue this tradition here. The species epithet cryptocaryae is derived from the genus name of the host plant, Cryptocarya microneura, and means "of Cryptocarya ". Biological notes. No natural enemies, including parasitoids or predators, of A. cryptocaryae were found in this study., Published as part of Lin, Yen-Po, Ding, Zheng Yee, Gullan, Penny J. & Cook, Lyn G., 2017, A newly recognised Australian endemic species of Austrolecanium Gullan & Hodgson 1998 (Hemiptera: Coccidae) from Queensland, pp. 119-130 in Zootaxa 4272 (1) on pages 126-129, DOI: 10.11646/zootaxa.4272.1.6, http://zenodo.org/record/583400

Lin, Yen-Po, Ding, Zheng Yee, Gullan, Penny J., Cook, Lyn G. (2017): A newly recognised Australian endemic species of Austrolecanium Gullan & Hodgson 1998 (Hemiptera: Coccidae) from Queensland. Zootaxa 4272 (1): 119-130, DOI: https://doi.org/10.11646/zootaxa.4272.1.6

Austrolecanium cryptocaryae Lin & Cook sp. n. (Fig 4) urn:lsid:zoobank.org:act:C52B76D7-35E0-4767-92EA-E2978C484BEB Material examined. Holotype. Adult female (ID: LGC00727 f2). Australia: Mt Glorious, D’Aguilar National Park, Queensland, - 27.33° S, 152.75° E, on Cryptocarya microneura, 28.iv.2007, L. G. Cook (ANIC: 1/ 1 female). GenBank accession numbers: 18S: KY816391; 28S: KY816400; COI: KY808494; EF-1α: KY824059; wingless: KY798546. Paratype. Adult female (ID: LGC00727f1). Same data as for holotype (ANIC: 1/1 female). GenBank accession numbers: 18S: KY816390; 28S: KY816399; COI: KY808493; EF-1α: KY824058; wingless: KY798545. Paratype. Adult female (ID: LGC00831 f1). Australia: Mt Glorious, D’Aguilar National Park, Queensland, - 27.33° S, 152.75° E, on C. microneura, 15.iii.2008, L. G. Cook (ANIC: 1/ 1 female). GenBank accession numbers: 18S: KY816392; 28S: KY816401; COI: KY808495; EF-1α: KY824060; wingless: KY798547. Paratype. Adult female (ID: LGC00831 f2). Same data as for paratype LGC00831 f1 (ANIC: 1/ 1 female). GenBank accession numbers: 18S: KY816393; 28S: KY816402; COI: KY808496; EF-1α: KY824061; wingless: KY798548. Diagnosis. Adult females of A. cryptocaryae can be identified and distinguished from A. sassafras and A. cappari by the following combination of morphological character states (the contrasting states for the other two species are given in Table 3); (i) dorsal setae sharply spinose; (ii) dorsal microducts present along body margin; (iii) marginal setae bluntly spinose; (iv) each anal plate with three apical setae and one seta on inner margin; (v) each supporting bar of anal plate with four setae; and (vi) anal ring with four pairs of setae, each longer than 300 Μ m. Austrolecanium cryptocaryae differs from A. sassafras at the following DNA sequence positions (mapped to the GenBank reference sequence listed for each gene): 18S: Reference sequence: KY816394. Site# 22 (A), 309 (-). 28S: Reference sequence: KY816403. Site# 9 (C), 29 (G), 49 (G), 87 (A), 89 (A), 90 (C), 143 (T), 154 (T), 166 (C), 167 (T), 175 (T), 255 (T), 381 (C), 454 (-), 476 (T), 514 (G), 544 (T). COI: Reference sequence: KY808497. Site# 3 (A), 12 (A), 18 (T), 24 (T), 27 (C), 33 (C), 36 (C), 41 (A), 43– 45 (TTA), 47–48 (CT), 51 (T), 61 (G), 63 (T), 69 (T), 72 (T), 75 (C), 79 (C), 87 (C), 93 (C), 105 (T), 108 (T), 120 (G), 123 (T), 126 (A), 128 (T), 141 (T), 144 (A), 151–154 (AGAT), 156–157 (TT), 159 (A), 165 (A), 168 (G), 174 (C), 177 (A), 183 (T), 187 (T), 189 (A), 192 (A), 195 (T), 198 (A), 206 (A), 213–214 (TT), 222–223 (CT), 225 (A), 227 (T), 240 (T), 243 (T), 255–258 (TTTC), 261 (T), 271 (C), 273 (T), 283 (T), 290–291 (CA), 294 (G), 297–298 (TT), 300 (A), 301–303 (ACA), 309 (C), 312–313 (TT), 328 (A), 330 (C), 336 (G), 339 (C), 343 (A), 345 (A), 348 (T), 354 (T), 360 (C), 363 (A), 366 (C), 369 (T), 373 (T), 375–376 (AA), 378 (T), 381–382 (AT), 385 (G), 387 (T), 389–391 (GAC), 396 (C), 398 (A), 405–406 (AA), 410–412 (TTT), 417 (T), 419 (A), 421 (A), 423–424 (TT), 426 (T), 429 (T), 435 (C), 450 (A), 456 (T), 459 (T), 462 (T), 465 (T), 468–469 (TC), 471 (T), 474 (A), 477 (C), 480 (C), 483–484 (TT), 489 (A), 492 (A), 495 (A), 501 (T), 505 (A), 507–508 (AT), 510 (T), 513 (C), 528 (C), 537 (T), 547 (A), 554–555 (AT), 558 (A), 565 (G), 567 (T), 570 (C), 572 (A), 579 (T). EF- 1α: Reference sequence: KY824062. Site# 9 (T), 18 (C), 24 (G), 165 (C), 171 (G), 183 (A), 189 (T), 216 (C), 249 (G), 292 (T), 321 (C), 324 (A), 412 (T), 459 (C). wingless: Reference sequence: KY798543. Site# 33 (A), 123 (G), 126 (C), 129 (G), 156 (T), 159 (G), 171 (C), 183 (A), 201 (C), 205 (T), 207 (G), 215–216 (GT), 247 (C), 255 (A), 276 (T). Description. Adult female (Fig. 4) (drawing and measurements based on four specimens: LGC00727 f1, LGC00727 f2, LGC00831 f1 and LGC00831 f2, all in good condition). Unmounted specimens. Live insects (Fig. 1A) bright green with a shiny dorsum, partially transparent near body margin. All specimens were found on the underside of leaves of the host plant. Mounted specimens. Body oval and symmetrical, 5.3–6.5 mm long, 4.6–5.2 mm wide. Dorsum. Dorsum mostly membranous but sclerotized around inner margin of each stigmatic cleft and on dorsal derm around anal plates. Dorsal setae sharply spinose, each 5–12 Μ m long, scattered throughout dorsum. Dorsal pores of 2 kinds: (i) microductules, each about 1 Μ m in diameter, with inner ductule tubular, 8–15 Μ m long, filamentous distally, frequent along margin; and (ii) preopercular pores, each 3–8 Μ m in diameter, scattered over dorsum, but most situated in a broad area anterior to anal plates, forming a cluster of 528–692 pores. Anal plates each triangular with anterior and posterior margins subequal in length, 294–354 Μ m long, 96–126 Μ m wide; with 3 setae apically on each plate plus 1 seta on inner margin anterior to apical setae. Anogenital fold with 2 pairs of setae along anterior margin, each 23–30 Μ m long; also with a distinct supporting bar on each margin, each bar with 4 setae (50–68 Μ m long), 2 marginally and 2 posteriorly. Anal tube shorter than length of anal plates, 213–300 Μ m long; anal ring 96–116 Μ m in diameter, bearing 4 pairs of setae, each seta 342–432 Μ m long. Margin. Each marginal seta with a rounded apex, longer than a dorsal seta, 11–29 Μ m long, arranged in a single marginal row, with 16–22 setae on head between stigmatic clefts, 4–10 on each side between anterior and posterior stigmatic clefts, and 11–18 on each side of abdomen; marginal setae on anal lobes not differentiated from others. Each stigmatic cleft mushroom-shaped, with narrow cleft broadening into a wide space; each with a well-defined area of sclerotization along inner margin of cleft and with 6–12 stigmatic spines; each spine 12–48 Μ m long, parallel-sided, with a rounded to clavate apex. Venter. Venter membranous; segmentation only visible on abdomen. Ventral setae hair-like, each 5–7 µ m long, sparsely scattered across venter. Pregenital segment (VII) with a single pair of long pregenital setae, each seta 114– 144 Μ m long. A group of 11–15 setae, each 12–39 Μ m long, present near each pregenital seta and just anterior to each group of pregenital disc-pores. Pregenital disc-pores each 5–8 Μ m in diameter, mostly each with 6 loculi, present in 2 groups each of 6–16 pores on either side of anogenital fold. Each stigmatic furrow with a band of spiracular disc-pores, each pore mostly with 5 loculi and about 6 Μ m in diameter, with 87–124 pores present between each spiracle and stigmatic cleft. Ventral microducts minute, each with outer ductule 3–6 Μ m long and inner ductule inconspicuous; sparsely scattered throughout venter but concentrated around mouthparts. Ventral tubular ducts absent. Spiracles well developed: anterior spiracle plus peritreme 108–162 Μ m long, 60–132 Μ m wide; posterior spiracle plus peritreme 126–162 Μ m long, 108–144 Μ m wide. Legs much reduced, each 91–130 Μ m long, trochanter fused with femur; tarsal digitules narrower than claw digitules, each 9–17 Μ m long, with minute apical knob; claw digitules each 15–23 Μ m long, with minute apical knob; claw without a denticle. Antennae each with 6 segments but segmentation often obscure, each antenna 132–192 Μ m long in total; all setae on terminal 3 segments fleshy, each 8–27 Μ m long. A pair of interantennal setae present, each 27–33 Μ m long. Mouthparts positioned at centre of body. Clypeolabral shield 174–180 Μ m long, 120–150 Μ m wide. Labium 84 Μ m long, 90– 120 Μ m wide. Etymology. The other two species of Austrolecanium are named after their host plants, so we continue this tradition here. The species epithet cryptocaryae is derived from the genus name of the host plant, Cryptocarya microneura, and means "of Cryptocarya ". Biological notes. No natural enemies, including parasitoids or predators, of A. cryptocaryae were found in this study.