Search

The potential social harms that large language models pose, such as generating offensive content and reinforcing biases, are steeply rising. Existing works focus on coping with this concern while interacting with ill-intentioned users, such as those who explicitly make hate speech or elicit harmful responses. However, discussions on sensitive issues can become toxic even if the users are well-intentioned. For safer models in such scenarios, we present the Sensitive Questions and Acceptable Response (SQuARe) dataset, a large-scale Korean dataset of 49k sensitive questions with 42k acceptable and 46k non-acceptable responses. The dataset was constructed leveraging HyperCLOVA in a human-in-the-loop manner based on real news headlines. Experiments show that acceptable response generation significantly improves for HyperCLOVA and GPT-3, demonstrating the efficacy of this dataset., 19 pages, 10 figures, ACL 2023

Loneliness is a major risk factor for morbidity and mortality. However, the effect of loneliness on subsequent prosocial behavior is not well known. Understanding the neurobiological mechanisms underlying loneliness is necessary to address this research gap. We investigate the mechanism using a modified public goods game (PGG) wherein participants can choose to act for a collective or selfish interest after being exposed to loneliness cues. Both behavioral (Study 1) and event-related potential (ERP) (Study 2) measures were used to explore this relationship. In Study 1 (N = 131), we found that participants exhibited decreased prosocial actions under the loneliness priming condition as opposed to the control condition. In Study 2 (N = 17), frontal N400 and posterior P300 components were identified under the loneliness priming condition as opposed to the control condition. Increased (decreased) frontal N400 and posterior P300 lead to selfish (prosocial) choices. These results indicate that humans instinctively perceive loneliness as inconsistency with their desired social-relational life, which in turn stimulates coping strategies for self-preservation. This study contributes to our understanding of the neurobiological basis of loneliness associated with prosocial behavior.

Myostatin is a widely recognized inhibitory factor of skeletal muscle growth and significantly influences muscle development and metabolism. In mice, myostatin inhibition improves insulin sensitivity, increases glucose uptake by skeletal muscle, and reduces body fat. Furthermore, Mss51 is downregulated in response to myostatin inhibition, and its deletion appears to improve the metabolic state of skeletal muscle and reduce adipose tissue, which makes Mss51 a potential target for the treatment of obesity and type 2 diabetes. Here, we report a computationally predicted and validated three-dimensional structure of Mss51. Computational screening was used to identify naturally occurring compounds from the Herbal and Specs chemical database that might inhibit Mss51, based on binding affinities and physiochemical and ADMET properties. ZINC00338371, ZINC95099599 and ZINC08214878 were found to bind to Mss51 with high binding affinity and specificity. In addition, 100 ns molecular dynamics simulations were conducted to assess the stabilities of the interactions between the three compounds and Mss51. MD simulation demonstrated that all three compounds bind to the active pocket site of Mss51 stably and cause conformation changes. ZINC00338371 was found to bind most stably with binding free energy −229.022 ± 13.776 kJ/mol to Mss51, suggesting that it has therapeutic potential as a treatment option for obesity and type 2 diabetes. Communicated by Ramaswamy H. Sarma

Supplementary Material 1: Supplementary figure S1. All-cause mortality risk of PRISm group compared to COPD and normal groups. Supplementary figure S2 All-cause mortality risk of PRISm group compared to COPD GOLD stages and normal groups. Supplementary table S1 Multivariable cox proportional analysis for predicting all-cause mortality. Supplementary figure S3 Cardiovascular mortality risk of PRISm group compared to COPD and normal groups

Conventional straight-shaped laparoscopic surgical instruments have limitations that, unlike robotic surgery, the wrist joint cannot be used. This study aimed to analyze the short-term safety and feasibility of ArtiSential (Livsmed), a new articulating laparoscopic instrument, which obviates the limitations of conventional laparoscopic surgery and allows the wrist joint to be used freely over 360° as in robotic surgery.The study included patients who underwent conventional laparoscopy or laparoscopy with the ArtiSential instrument. Patients who underwent laparoscopic gastrectomy for primary gastric adenocarcinoma in our institution were retrospectively reviewed. The groups were propensity score matched in a 11 ratio. Primary endpoint was incidence of early postoperative complication (postoperative 30-day morbidity and mortality) and secondary endpoints were operative outcomes.A total of 327 patients (147 of the conventional group and 180 of the ArtiSential group) were propensity score matched. After propensity score matching was performed, each group comprised of 122 patients. Both groups were comparable with regard to operation time, estimated blood loss, number of retrieved lymph nodes, and length of hospital stay. The ArtiSential group had a faster time to a fluid diet (2.6 ± 1.3 days vs. 2.3 ± 0.6 days,The current study showed that the use of ArtiSential is a safe and feasible option without increasing operation time, length of hospital stay, and intraoperative bleeding.

이 연구는 메이커스페이스에 대한 정부 차원의 지원과 관심이 쏟아지고 있는 상황에서, 국내외 대학도서관 메이커스페이스의 구축 및 운영현황을 살펴보고 이에 기반한 운영 전략을 모색하되, 모기관의 발전방향에 부합하고 대학교육을 지원하는 창의‧협력공간으로서 대학도서관 메이커스페이스를 활용할 수 있는 방안을 모색하는데 목적을 두고 있다. 이를 위해 이 연구에서는 (1) 메이커스페이스의 개념을 살펴보고, 특히 대학도서관에서 메이커스페이스의 필요성을 짚어 보고, (2) 국내외 도서관의 메이커스페이스 도입 사례를 대상으로 구축 및 운영 실태와 이를 실현하기 위한 도서관계의 노력 속에서 발견되는 특징 및 시사점을 분석한 후, (3) 향후 우리 대학도서관계에서 메이커스페이스를 구축‧운영하고자 할 때 고려해야 하는 운영 전략을 모색해 보았다. 논의에 필요한 데이터는 문헌연구와 방문조사 및 운영담당자를 대상으로 한 심층조사를 통해 수집하였고, 추가적으로 필요한 데이터는 전화면담 및 이메일조사를 병행하여 수집하였다

In this study, we first analyzed the differences in pragmatic language skills of children aged 6 to 9 years according to their intelligence, language level, and gender, and then looked at differences in pragmatic language skills by linguistic culture family type (multiculturalized children and general household children). Participants of the present study consisted of a total of 41 children aged 6 to 9 years old, with 30 children (male=15, female=15) and 11 children from multicultural families (male=9, female=2). Children were tested for intelligence, vocabulary, and language checklist for children. The correlation and Pearson’s correlation, and independent sample t-test was conducted for differences in pragmatic language abilities of children in general households according to gender. And the difference in scores by child’s pragmatic language checklist (CPLC) sub-domain of children of general households and multicultural families who matched their age and sex was examined through the Mann-Whitney U-test Intelligence and expressive language skills were found to be related to discourse management, communication intent and non-verbal communication excluding ability to control and apply according to the situation. Second, it showed that girls had a higher overall pragmatic language score than boys except the areas of discourse management. Third, the scores of children from single culture (N=11) and children from multicultural families (N=11) who matched gender to chronological age and language age did not differ according to the domestic language and culture environmental group. The results of the above study showed that although pragmatic language skills vary depending on gender, they are not significantly problematic due to linguistic and cultural factors. (Ewha Womans University)

본 연구는 청소년 게임 이용자 패널 데이터를 활용하여 게임 이용이 정신건강과 학업성적에 미치는 영향을 검증했다. 먼저 정신건강 관련, 게임을 많이 이용할수록 우울감과 공격성이 줄어들었고, 그럴수록 다시 게임 이용은 증가하는 상호적 강화작용 패턴을 발견했다. 불안의 경우, 게임 이용이 불안을 낮추는 일방향적 효과만이 존재했고 게임 이용과 고독감은 유의한 관계를 보이지 않았다. 이러한 결과는 선호 게임 유형(혼자 vs. 게임에서 만난 사람들과 함께 vs. 오프라인 친구들과 함께 하는 게임)이나 대인관계 특성(부모와의 의사소통, 교사 지지, 친구 지지)에 따라 달라지지 않았다. 다음으로 게임 이용은 학업성적에 긍정적 영향을 미쳤지만, 성적은 게임 이용에 영향을 주지 않았다. 게임 이용이 성적에 미치는 효과는 공부시간이나 정신건강 변인들에 의해 매개되지 않았다. 추가분석 결과, 데이터 분석방법에 따라(종단분석 vs. 횡단분석) 게임 효과에 대한 상반된 결론이 도출됨을 확인했다. 구체적으로 횡단분석 결과가 게임에 대한 대중적 우려와 대체로 일치했는데, 이는 방법론적으로 더욱 엄정한 게임 효과 연구가 필요함을 시사한다.

The goals of this study are to develop an abductive procedure that students can use to build alternative models, as well as to help teachers in building scientific models for their students based on the initial model they were given about seasonal change. Understanding these explanatory mental models can provide important information about the students’ knowledge structure, based on questions’ responses. The data collected from the paper-pencil test and individual interview with students. For this study, 30 pre-service elementary school teachers(1st grade) were participated. The findings of this study indicate that the students had obvious alternative conceptions, and that the 'distance theory' had the most significant effects on their alternative conceptions. We reconstructed the forming process of their alternative concepts based on abduction inference patterns in order to determine the origin of structure of their alternative conceptions about seasonal change. The expansion, contraction, and revision of main theory is achieved by their early age perceptions of traditional celestial bodies rather than developed specific information, and they have the expansion, contraction, and revision of main theory as their alternative models. The implications for science education for pre-service teachers and related studies were discussed. Teachers must have both the requisite science knowledge and the required abductive inference skills to effectively instruct elementary school students in scientific activities. Finally, future studies should equate real scientists' research processes to teachers' research processes. This suggestion is based on the assumption that scientists and students use similar processes to develop scientific knowledge.

Autophagy is an essential cellular process that involves the transport of cytoplasmic content in double-membraned vesicles to lysosomes for degradation. Neurons do not undergo cytokinesis, and thus, the cell division process cannot reduce levels of unnecessary proteins. The primary cause of neurodegenerative disorders (NDs) is the abnormal deposition of proteins inside neuronal cells, and this could be averted by autophagic degradation. Thus, autophagy is an important consideration when considering means of developing treatments for NDs. Various pharmacological studies have reported that the active components in herbal medicines exhibit therapeutic benefits in NDs, for example, by inhibiting cholinesterase activity and modulating amyloid beta levels, and α-synuclein metabolism. A variety of bioactive constituents from medicinal plants are viewed as promising autophagy controllers and are revealed to recover the NDs by targeting the autophagic pathway. In the present review, we discuss the role of autophagy in the therapeutic management of several NDs. The molecular process responsible for autophagy and its importance in various NDs and the beneficial effects of medicinal plants in NDs by targeting autophagy are also discussed.

Additional file 1: Figure S1. A. Immunofluorescent detection of HMGB1 (green) and nucleus (DAPI, blue) in the liver tissue of normal and Lrat:Cas9-ERT2: sgTif1γ mice treated with TMX. The DIC image shows the phenotype of the cells. Scale bar: 50 μm. B. Western blotting of supernatant of HepG2 cells treated retinol for 3 days or 7 days. Western blotting was performed using an anti-HMGB1 antibody and a Ponceau staining was used for loading control. Figure S2. Immunofluorescent detection of albumin (magenta) and BODIPY staining of triglyceride (red) in HepaRG cells treated with or without retinol. The nuclei were stained with SYTOX green. The DIC image shows the phenotype of the cells. Scale bar: 5 μm. Figure S3. A. Retinol autofluorescence (blue) in LX2 cells treated with or without retinol. The nuclei are shown in green. Scale bar: 25 μm. B. Flow cytometry analyses of the cells described in A. C. The expression levels of the mRNAs encoding human ATGL, PNPLA3, and STRA6 in LX2 cells treated with or without recombinant human TGFβ1 and/or recombinant human HGF. D. The expression level of the mRNA encoding human STRA6 in LX2 cells overexpressing TIF1γ or transfected with a TIF1γ-specific siRNA (100 nM) for 2 days. For overexpression, the cells were transfected with pLenti-TIF1γ and incubated for 1 day prior to analysis. Figure S4. Myc-tagged human STRA6 was transfected into 293 T cells, and the cells were treated with or without 1 μM retinol for 1 day. Western blotting was performed using an anti-STRA6 antibody and an anti-myc antibody. GAPDH was detected as a loading control.

Additional file 1: Fig. S1. (A) Evaluation of the vector in 293 T cells. Western blotting of cell lysate and supernatant of pCMV-mChemerin-transfected 293 T cells. (B) Evaluation of the vector by 2D migration assay. Under the supernatant of pCMV-aChemerin-transfected 293 T cells, 2D random migration of hBM-MSCs were analyzed at 6 and 12 h. Fig. S2. Evaluation of human cells engrafting in mouse liver tissue. Genomic DNA from mouse liver tissue was extracted and analyzed by PCR for presence of human genome using equal amount. Genomic DNA of 293 T cells was used as a positive control. Human genomic DNA-specific primers; forward: ATGCTGATGTCTGGGTAGGGTG, reverse: TGAGTCAGGAGCCAGCGTATG, were used.

배경 및 목적: 본 연구는 말더듬 성인의 말더듬 극복을 향한 경험과 그 의미를 알아보고자 하였다. 방법: 스스로 말을 더듬는다고 생각 하는 말더듬 성인 5명이 참여하였으며, 이들의 경험을 알아보는 데 적합한 내러티브 연구방법을 사용하였다. 두 차례의 개별면담을 통해 면담자료를 수집하고, 동의한 참여자에 한하여 자신의 경험과 관련된 다양한 질적 자료원을...

본 연구는 학습무동기 척도를 개발하고 타당화하는데 그 목적이 있었다. 척도 개발을 위해 유기적 통합이론, 학습된 무기력, 기대-가치 이론을 토대로 하여 학습무동기의 잠재적 구성요인을 도출하였다. 중학생 210명을 대상으로 개방형 설문을 실시하여 측정문항을 개발하였다. 다음으로 중학생 200명을 대상으로 실시한 예비 검사를 통해 문항을 정교하게 수정하였다. 이를 통해 내재적 가치결여, 외재적 가치결여, 상대적 비용, 능력신념결여, 노력신념결여, 사회적 압력의 6요인 18문항을 최종 학습무동기 척도로 확정하였다. 697명의 중․고등학생을 대상으로 학습무동기 척도의 타당도를 검증하였다. 먼저 구인타당도 검증을 위해 탐색적 및 확인적 요인분석을 실시한 결과, 요인구조가 자료에 잘 부합함을 확인하였다. 또한 자기결정성동기와 성취목표, 학업적 자기효능감과의 상관분석을 통해 척도의 준거타당도가 양호함을 확인하였다. 고등학생들을 대상으로 교차타당도를 검증한 결과, 이 척도가 중학생 뿐만 아니라 고등학생에게도 동일하게 적용 가능함을 확인하였다. 학습무동기 척도의 향후 활용도를 중심으로 이 연구의 시사점이 논의되었다.

본 연구는 Skinner, Johnson과 Snyder(2005)가 동기촉진적 관점에서 제작한 청소년용 부모양육태도척도(PSCQ_A)를 우리나라 청소년을 대상으로 한국판 청소년용 동기모형 양육태도척도(PSCQ_KA)를 타당화하는데 목적이 있다. 인천, 대구, 경기도의 3개 학교에서 수집한 남․여 중학생 507명의 설문자료를 바탕으로 타당도를 검증하였다. 확인적 요인분석을 통해 따스함과 거부, 자율지지와 강요, 구조제공과 비일관성의 6요인 구조가 적합함을 확인하였다. 또한 유사한 양육행동척도들과 적절한 상관관계를 보임으로써 PSCQ_KA의 공인타당도를 확인하였다. 부모의 양육태도 6요인은 부모에 대한 신뢰, 자녀의 자아존중감 및 우울·불안에 대하여 유의미한 예측효과가 있음을 검증함으로써 PSCQ_KA의 예측타당도를 확인하였다. 따라서 본 연구를 통하여 PSCQ_KA의 6요인 24문항이 우리나라 청소년들이 지각하는 부모의 양육태도를 측정하기에도 타당하고 신뢰할만한 도구임이 확인되었다. 끝으로 본 연구의 제한점과 의의를 제시하였다.

Additional file 1. Biofeedback-based sleep improvement program

Clarithromycin-based triple therapy is prescribed worldwide for Helicobacter pylori eradication. However, increases in the clarithromycin resistance of H pylori are thought to be responsible for eradication failure. Here, we studied whether point mutations in domain V of the 23S rRNA gene can affect H pylori eradication failure in a prospective, open-label, observational study. Of the 755 enrolled patients, 299 patients (39.6%) had positive Campylobacter-like organism (CLO) tests. DNA sequencing analysis of H pylori 23S rRNA in 295 patients revealed that 2143G was the most frequent point mutation (24.7% of patients), followed by the 2182T mutation (11.5%). The overall eradication failure rate was 20.9% (42/201) in clarithromycin-based triple therapy. Patients with the 2143G had an approximately 60% eradication failure rate, which suggested that 2143G was a high-risk genotype for eradication failure. Patients with the 2182C genotype without 2143G had an 8.7% failure rate, and patients without 2143G or 2182C had only a 4.3% failure rate. The presence of 2143G, which was associated with previous eradication history and female sex, was an independent risk factor for eradication failure. In conclusion, the 2143G point mutation in the 23S rRNA of H pylori was an independent risk factor for eradication failure in clarithromycin-based triple therapy. Personalized tailored therapy based on the genotypes of 23S rRNA can increase eradication success rates in H pylori infections.

Supplemental material, DS_10.1177_0363546518780991 for Therapeutic Efficacy of Spherical Aggregated Human Bone Marrow–Derived Mesenchymal Stem Cells Cultured for Osteochondral Defects of Rabbit Knee Joints by Byung Hoon Lee, Jong Nam Park, Eun Ju Lee, Young Wan Moon and Joon Ho Wang in The American Journal of Sports Medicine

Table S1. Changes in vegetation and importance value for the four sub-wetlands from 1999 to 2013. (DOCX 38 kb)