Search

This review summarises developments published in the period from mid-2021 to mid-2022 on the analysis of a variety of matrices for mycotoxins. Important developments in all aspects of mycotoxin analysis, from sampling and quality assurance/quality control of analytical results, to the various detection and quantitation technologies ranging from single mycotoxin biosensors to comprehensive instrumental methods are presented and discussed. This non-exhaustive summary and associated discussion covers such technology as chromatography with targeted or non-targeted high resolution mass spectrometry, detection other than mass spectrometry such as fluorescence or diode array detection, biosensors, as well as assays using alternatives to antibodies. This collaborative critical review intends to guide readers to relevant research by briefly presenting the most important developments in mycotoxin determination published in the past year. This review also relays limitations of the presented methodologies, in order to provide a fulsome assessment of the analytical developments.

El problema que ocupa las reflexiones del siguiente texto es sobre la dificultad de la descripción del sustantivo cuir. Apoyándose en distintos textos, el presente ensayo postula el entendimiento de lo cuir como verbo, es decir encuiramiento. En este segundo sentido, lo cuir viene a ser proceso no terminado, crítica placentera que abre un espacio de futuridad en medio de una cultura condenada a repetir reactivamente el pasado. A partir de una selección de obras de la literatura latinoamericana se muestran diferentes ejemplos de trama cuir que dislocan el ordenamiento heteronormado, desacralizan lo establecido, develan lo inacabado y abren de este modo posibilidades de cambio en el lenguaje.

Parkinson’s disease (PD) is a chronic progressive neurodegenerative disorder characterized by motor and non-motor disturbances as a result of a complex and not fully understood pathogenesis, probably including neuroinflammation, oxidative stress, and formation of alpha-synuclein (α-syn) aggregates. As age is the main risk factor for several neurodegenerative disorders including PD, progressive aging of the immune system leading to inflammaging and immunosenescence may contribute to neuroinflammation leading to PD onset and progression; abnormal α-syn aggregation in the context of immune dysfunction may favor activation of nucleotide-binding oligomerization domain-like receptor (NOD) family pyrin domain containing 3 (NLRP3) inflammasome within microglial cells through interaction with toll-like receptors (TLRs). This process would further lead to activation of Caspase (Cas)-1, and increased production of pro-inflammatory cytokines (PC), with subsequent impairment of mitochondria and damage to dopaminergic neurons. All these phenomena are mediated by the translocation of nuclear factor kappa-B (NF-κB) and enhanced by reactive oxygen species (ROS). To date, drugs to treat PD are mainly aimed at relieving clinical symptoms and there are no disease-modifying options to reverse or stop disease progression. This review outlines the role of the TLR/NLRP3/Cas-1 pathway in PD-related immune dysfunction, also focusing on specific therapeutic options that might be used since the early stages of the disease to counteract neuroinflammation and immune dysfunction.

The aim of the current review is to summarize the available evidence to aid clinicians in the surveillance, treatment and follow-up of the different primary tumors developed by patients diagnosed with von Hippel-Lindau (VHL) syndrome.A non-systematic narrative review of original articles, meta-analyses, and randomized trials was conducted, including articles in the pre-clinical setting to support relevant findings.VHL disease is the most common rare hereditary disorder associated with clear cell renal cell carcinoma. Affected individuals inherit a germline mutation in one VHL allele, and any somatic event that disrupt the other allele can trigger mutations, chromosomal rearrangements, or epigenetic regulations leading to oncogenesis. From a clinical perspective, patients continuously develop multiple primary tumors.Because VHL is considered a rare disease, very limited evidence is available for diagnosis, surveillance, active treatment with local or systemic therapy and follow-up.

Loa loa is a filarial nematode responsible for loiasis, endemic to West–Central Africa south of the Sahara and transmitted by flies. This study reports a case of L. loa in the vitreous cavity of the eye of a young patient, along with an in-depth literature review. A 22-year-old woman from Cameroon who migrated from Cameroon to Italy was referred to the Emergency Ophthalmology Department at Policlinico di Bari in July 2021 with the presence of a moving parasite in the subconjunctiva of the left eye. A recent onset of a papular lesion on the dorsal surface of the right wrist and a nodular lesion in the scapular region were detected. L. loa filariasis was diagnosed based on anamnestic data, clinical and paraclinical signs, and a parasitological test confirming the presence of microfilariae in two blood samples collected in the morning of two different days. Because of the unavailability of diethylcarbamazine (DEC), albendazole (ALB) 200 mg twice daily was administered for 21 days. A mild exacerbation of pruritus occurred during treatment, but resolved with the use of an antihistamine. A single dose of 12 mg ivermectin was prescribed at the end of the treatment with albendazole. Unlike other endemic parasite infections, L. loa is not included in the Global Program to Eliminate Lymphatic Filariasis, because it is not mentioned in the WHO and CDC list of neglected tropical diseases. This can result in an overall risk of lack of attention and studies on loiasis, with lack of data on global burden of the disease.

The EU General Food Law (GFL) Regulation (EC) 178/2002 establishes the principles of risk analysis in relation to food safety and its three inter-related components: risk assessment, risk management, and risk communication. Reflecting on citizens’ perception of the risk assessment process, the new Transparency Regulation (Regulation (EU) 2019/1381) introduced new provisions on risk communication, the public disclosure of scientific data and information supporting requests for authorisations or for approvals of regulated products as well as other requests for scientific output, and the possibility for the Commission to request EFSA to commission scientific studies with the objective of verifying evidence used in its risk assessment process. The proposal for a legislative framework for sustainable food systems, foreseen to be published in September 2023, aims to mainstream sustainability in all present and future EU policies and legislation impacting the food system. It will establish sustainability objectives and principles that should be consistent with the provisions and objective of the GFL. In a dialogue with high-level experts from science, policy and society with expertise in risk assessment, management and communication, the following question was discussed: How will the relationship between risk assessors (RA) and risk managers (RM) evolve in view of new Food Safety scenarios in Europe?

A longitudinal alteration in health-related quality of life (HRQoL) over a two-year period and its association with early-stage chronic kidney disease (CKD) progression was investigated among 1748 older adults (>75 years). HRQoL was measured by the Euro-Quality of Life Visual Analog Scale (EQ-VAS) at baseline and at one and two years after recruitment. A full comprehensive geriatric assessment was performed, including sociodemographic and clinical characteristics, the Geriatric Depression Scale-Short Form (GDS-SF), Short Physical Performance Battery (SPPB), and estimated glomerular filtration rate (eGFR). The association between EQ-VAS decline and covariates was investigated by multivariable analyses. A total of 41% of the participants showed EQ-VAS decline, and 16.3% showed kidney function decline over the two-year follow-up period. Participants with EQ-VAS decline showed an increase in GDS-SF scores and a greater decline in SPPB scores. The logistic regression analyses showed no contribution of a decrease in kidney function on EQ-VAS decline in the early stages of CKD. However, older adults with a greater GDS-SF score were more likely to present EQ-VAS decline over time, whereas an increase in the SPPB scores was associated with less EQ-VAS decline. This finding should be considered in clinical practice and when HRQoL is used to evaluate health interventions among older adults.

IntroductionWorldwide, COVID-19 pandemic lead to a large fall in the number of newly reported TB cases. In sub-Saharan Africa, microbiological diagnosis of TB is generally based on smear microscopy and Xpert MTB/RIF on sputum samples, but good quality sputum samples are often difficult to obtain, leading clinicians to rely on more invasive procedures for diagnosis. Aim of this study was to investigate pooled sensitivity and specificity of Xpert MTB/RIF on stool samples compared to respiratory microbiological reference standards in African countries.MethodsFour investigators independently searched PubMed, SCOPUS, and Web of Science until 12th October 2022, then screened titles and abstracts of all potentially eligible articles. The authors applied the eligibility criteria, considered the full texts. All the studies reported the data regarding true positive (TP), true negative (TN), false positive (FP) and false negative (FN). Risk of bias and applicability concerns were assessed with the Quadas-2 tool.Resultsoverall, among 130 papers initially screened, we evaluated 47 works, finally including 13 papers for a total of 2,352 participants, mainly children. The mean percentage of females was 49.6%, whilst the mean percentage of patients reporting HIV was 27.7%. Pooled sensitivity for Xpert MTB/RIF assay for detecting pulmonary tuberculosis was 68.2% (95%CI: 61.1–74.7%) even if characterized by a high heterogeneity (I2=53.7%). Specificity was almost 100% (99%, 95%CI: 97–100%; I2 = 45.7%). When divided for reference standard, in the six studies using sputum and nasogastric aspirate the accuracy was optimal (AUC = 0.99, SE = 0.02), whilst in the studies using only sputum for tuberculosis detection the AUC was 0.85 (with a SE = 0.16). The most common source of bias was exclusion of enrolled patients in the analysis.ConclusionsOur study confirms that, in Africa, stool Xpert MTB/RIF may be a useful rule-in test for children above and below 5 years of age under evaluation for pulmonary tuberculosis. Sensitivity increased substantially when using both sputum and nasogastric aspirate as reference samples.

Diabetic retinopathy (DR) is the main ocular complication of diabetes. Among all the causes of blindness, it is the only one whose global pre-valence has increased over the past 30 years. DR prevalence is expected to increase in the upcoming years. Therefore, it is essential to establish cost-effective screening programs for early diagnosis of DR, which using new imaging systems, telemedicine and artificial intelligence prevent its evolution to advanced sight-threatening stages.

Supplementary Movie S1

Next-generation Trop-2–targeted therapy against advanced cancers is hampered by expression of Trop-2 in normal tissues. We discovered that Trop-2 undergoes proteolytic activation by ADAM10 in cancer cells, leading to the exposure of a previously inaccessible protein groove flanked by two N-glycosylation sites. We designed a recognition strategy for this region, to drive selective cancer vulnerability in patients. Most undiscriminating anti–Trop-2 mAbs recognize a single immunodominant epitope. Hence, we removed it by deletion mutagenesis. Cancer-specific, glycosylation-prone mAbs were selected by ELISA, bio-layer interferometry, flow cytometry, confocal microscopy for differential binding to cleaved/activated, wild-type and glycosylation site–mutagenized Trop-2. The resulting 2G10 mAb family binds Trop-2–expressing cancer cells, but not Trop-2 on normal cells. We humanized 2G10 by state-of-the-art complementarity determining region grafting/re-modeling, yielding Hu2G10. This antibody binds cancer-specific, cleaved/activated Trop-2 with Kd < 10−12 mol/L, and uncleaved/wtTrop-2 in normal cells with Kd 3.16×10−8 mol/L, thus promising an unprecedented therapeutic index in patients. In vivo, Hu2G10 ablates growth of Trop-2–expressing breast, colon, prostate cancers, but shows no evidence of systemic toxicity, paving the way for a paradigm shift in Trop-2–targeted therapy.

Supplementary Online Material

To evaluate the anatomical and functional outcomes of pars plana vitrectomy (PPV) and epiretinal membrane (ERM) peeling in patients with retinal vein occlusion (RVO) and secondary ERM.Retrospective, multicenter study including patients with RVO and ERM who underwent PPV and ERM peeling with or without phacoemulsification. Demographic, clinical, surgical, and optical coherence tomography (OCT) features were recorded at the time of ERM peeling (baseline). Best-corrected visual acuity (BCVA) and central macular thickness (CMT) were longitudinally collected up to 36 months after surgery. Clinical factors associated with BCVA and CMT and disappearance of macular edema during follow-up were investigated.Twenty-one eyes of 21 patients with a median follow-up of 18 months were included. The BCVA improved significantly after ERM peeling (baseline vs. 24 months, p = 0.01). Absence of the external liming membrane/ellipsoid zone on OCT was associated with worse visual outcomes (regression estimate [95% confidence interval, CI] = 0.93 [0.39-1.48] logMAR, p = 0.004). Eyes with disorganization of the inner retinal layers at baseline had higher CMT values at each visit (regression estimate [95% CI] = 114.1 [78.9-219.4] μm, p = 0.004). Older age at the time of RVO (p = 0.03) and branch RVO (p = 0.04) were risk factors for persistent macular edema after ERM removal.PPV and ERM removal provided encouraging functional and morphological results in eyes with RVO, with disappearance of macular edema in most eyes. The integrity of the outer retina and preservation of inner retinal segmentation were associated with better visual and anatomical outcomes after ERM removal, respectively.

Next-generation Trop-2–targeted therapy against advanced cancers is hampered by expression of Trop-2 in normal tissues. We discovered that Trop-2 undergoes proteolytic activation by ADAM10 in cancer cells, leading to the exposure of a previously inaccessible protein groove flanked by two N-glycosylation sites. We designed a recognition strategy for this region, to drive selective cancer vulnerability in patients. Most undiscriminating anti–Trop-2 mAbs recognize a single immunodominant epitope. Hence, we removed it by deletion mutagenesis. Cancer-specific, glycosylation-prone mAbs were selected by ELISA, bio-layer interferometry, flow cytometry, confocal microscopy for differential binding to cleaved/activated, wild-type and glycosylation site–mutagenized Trop-2. The resulting 2G10 mAb family binds Trop-2–expressing cancer cells, but not Trop-2 on normal cells. We humanized 2G10 by state-of-the-art complementarity determining region grafting/re-modeling, yielding Hu2G10. This antibody binds cancer-specific, cleaved/activated Trop-2 with Kd < 10−12 mol/L, and uncleaved/wtTrop-2 in normal cells with Kd 3.16×10−8 mol/L, thus promising an unprecedented therapeutic index in patients. In vivo, Hu2G10 ablates growth of Trop-2–expressing breast, colon, prostate cancers, but shows no evidence of systemic toxicity, paving the way for a paradigm shift in Trop-2–targeted therapy.

Pulmonary arterial hypertension (PAH) in the elderly is often associated with left heart disease (LHD), prompting concerns about the use of pulmonary vasodilators. The PATRIARCA registry enrolled ≥70 year-old PAH or chronic thromboembolic pulmonary hypertension (CTEPH) patients at 11 Italian centers from 1 December 2019 through 15 September 2022. After excluding those with CTEPH, post-capillary PH at the diagnostic right heart catheterization (RHC), and/or incomplete data, 23 (33%) of a total of 69 subjects met the criteria proposed in the AMBITION trial to suspect LHD. Diabetes [9 (39%) vs. 6 (13%), p = 0.01] and chronic kidney disease [14 (61%) vs. 12 (26%), p = 0.003] were more common, and the last RHC pulmonary artery wedge pressure [14 ± 5 vs. 10 ± 3 mmHg, p < 0.001] was higher and pulmonary vascular resistance [5.56 ± 3.31 vs. 8.30 ± 4.80, p = 0.02] was lower in LHD than non-LHD patients. However, PAH therapy was similar, with 13 (57%) and 23 (50%) subjects, respectively, taking two oral drugs. PAH medication patterns remained comparable between LHD and non-LHD patients also when the former [37, 54%] were identified by atrial fibrillation and echocardiographic features of LHD, in addition to the AMBITION criteria. In this real-world snapshot, elderly PAH patients were treated with pulmonary vasodilators, including combinations, despite a remarkable prevalence of a LHD phenotype.

Pregnant and breastfeeding women are at an increased risk of severe illness from COVID-19. Despite this, low vaccination coverages are reported in this population sub-group. The purpose of this study is to estimate the proportion of pregnant and breastfeeding women expressing hesitation to the COVID-19 vaccine worldwide. Forty-six studies were included, selected from scientific articles available in three scientific databases between 1 January 2020 and 6 February 2022. The vaccine hesitation rate among pregnant and breastfeeding women was 48.4% (95%CI=43.4–53.4%). In a sub analysis by study period, it was 40.0% (95%CI=31.6–46.6%) considering surveys administered in 2020, 58.0% (95%CI=48.9–66.9%) considering surveys administered in the first semester of 2021, and 38.1% (95%CI=25.9–51.2%) considering surveys administered in the second semester of 2021. The main reasons for vaccine hesitation were lack of information about vaccination, opinion that the vaccine is unsafe, and fear of adverse events. Available evidence in the literature has shown that fighting vaccine resistance is harsh and too slow as a process, considering the rapidity and unpredictability of a pandemic. Health education should be provided in order to improve the willingness of the community, especially for those with lower levels of education.

As for other vaccines, vaccination hesitancy may be a determining factor in the success (or otherwise) of the COVID-19 immunization campaign in healthcare workers (HCWs).To estimate the proportion of HCWs in Italy who expressed COVID-19 vaccine hesitancy, we conducted a systematic review of the relevant literature and a meta-analysis. Determinants of vaccine compliance and options suggested by these studies to address vaccine hesitancy among HCWs were also analyzed. Seventeen studies were included in the meta-analysis and systematic review, selected from scientific articles available in the MEDLINE/PubMed, Google Scholar and Scopus databases between 1 January 2020 and 25 January 2022. The vaccine hesitancy rate among HCWs was 13.1% (95%CI: 6.9-20.9%). The vaccine hesitancy rate among HCWs investigated before and during the vaccination campaign was 18.2% (95%CI = 12.8-24.2%) and 8.9% (95%CI = 3.4-16.6%), respectively. That main reasons for vaccine hesitation were lack of information about vaccination, opinion that the vaccine is unsafe, and fear of adverse events.Despite strategies to achieve a greater willingness to immunize in this category, mandatory vaccination appears to be one of the most important measures that can guarantee the protection of HCWs and the patients they care for.

Aim of this study was to assess the predictors of virological failure (VF) among patients living with HIV (PLWHIV) switching from an effective first-line antiretroviral therapy (ART) regimen, and to evaluate the emergence of resistance-associated mutations. All adult patients enrolled in the Antiviral Response Cohort Analysis cohort who started ART after 2010, with at least 6 months of virological suppression (VS) before ART switch and with an available genotypic resistance test (GRT) at baseline were included. Thirty-two patients out of the 607 PLWHIV included (5.3%) experienced VF after a median of 11 months from ART switch. Younger age (adjusted Hazard Ratio [aHR] 0.96, 95% confidence interval [CI] 0.92-0.99

Striving for an adaptive, iterative, and proactive food safety system FoodSafety4EU contributes to enhancing common efforts and building synergies within the EU Food Safety System through the co-design of an integrated and multi-stakeholder platform. This enables a network of FSS actors at the national, European and international levels to access resources efficiently, synchronise food safety research strategies, and share and exchange scientific knowledge.

Accumulating evidence indicates that serum and tissue levels of lectin, galactoside-binding soluble 3 binding protein (LGALS3BP), a secreted glycoprotein, are elevated in human cancers. Recently, we have identified LGALS3BP as a factor capable of stimulating angiogenesis of microvascular endothelial cells in vitro as well as in vivo. However, the potential therapeutic implications of LGALS3BP function blockade have not been explored yet. Here, we tested the ability of an anti-LGALS3BP mouse monoclonal antibody, SP-2, to antagonize LGALS3BP-induced angiogenesis and tumor growth. The antibody was found to inhibit endothelial cell tubulogenesis induced by either conditioned medium of breast cancer and melanoma cells or human recombinant LGALS3BP. In addition, SP-2 inhibited phosphorylation of FAK and its recruitment to membrane sites as well as AKT and ERK phosphorylation promoted by LGALS3BP. When used in vivo, the antibody restrained LGALS3BP-stimulated angiogenesis and growth of tumor xenografts. Furthermore, the combination of SP-2 and low-dose bevacizumab was more effective than either agent alone. Taken together, these results lead to consideration of SP-2 as a promising candidate for LGALS3BP-targeted therapy. Mol Cancer Ther; 13(4); 916–25. ©2014 AACR.

PDF file - 3024K, Time- and dose-dependent effects of KG-501 on the CREB expression and activity of HER-2/neu+ cells. (A) mRNA expression of CREB, CBP, bcl2 and bcl-xL was determined over time upon treatment with 10 �M KG-501 using RT-PCR followed by agarose electrophoresis as described in Materials and Methods. Expression of β-actin served as control. (B) HER-2/neu+ cells were incubated with KG-501 for 48 h at 37{degree sign}C and analysed as described in Materials and Methods. Western blotting using a phospho(Ser-133) mAb was performed and Beta-actin mAb served as the control. The right panel demonstrate the quantified densitometry data (right) are means �SD (n = 3). (C) CFSE-labeled HER-2/neu+ cells were incubated with KG-501 and fluorescence was determined 48 h later on a FACsCalibur. Red line, untreated cells.

PDF file - 67KB

The cyclic (c)AMP responsive element binding protein (CREB) plays a key role in many cellular processes, including differentiation, proliferation, and signal transduction. Furthermore, CREB overexpression was found in tumors of distinct origin and evidence suggests an association with tumorigenicity. To establish a mechanistic link between HER-2/neu–mediated transformation and CREB protein expression and function, in vitro models of HER-2/neu–overexpressing and HER-2/neu–negative/silenced counterparts as well as human mammary carcinoma lesions with defined HER-2/neu status were used. HER-2/neu overexpression resulted in the induction and activation of CREB protein in vitro and in vivo, whereas short hairpin RNA (shRNA)–mediated inhibition of HER-2/neu correlated with downregulated CREB activity. CREB activation in HER-2/neu–transformed cells enhanced distinct signal transduction pathways, whereas their inhibition negatively interfered with CREB expression and/or activation. CREB downregulation in HER-2/neu–transformed cells by shRNA and by the inhibitors KG-501 and lapatinib caused morphologic changes, reduced cell proliferation with G0–G1 cell-cycle arrest, which was rescued by CREB expression. This was accompanied by reduced cell migration, wound healing, an increased fibronectin adherence, invasion, and matrix metalloproteinase expression. In vivo shCREB-HER-2/neu+ cells, but not control cells, exerted a significantly decreased tumorgenicity that was associated with decreased proliferative capacity, enhanced apoptosis, and increased frequency of T lymphocytes in peripheral blood mononuclear cells. Thus, CREB plays an important role in the HER-2/neu–mediated transformation by altering in vitro and in vivo growth characteristics.Implications: These data suggest that CREB affects tumor immunogenicity and is a potential target for cancer therapy. Mol Cancer Res; 11(11); 1462–77. ©2013 AACR.

PDF file - 6761K, Correlation of HER-2/neu with pCREB expression. (A) shHER-2 transfection strongly down-regulates HER-2/neu expression in MCF-7 cells. (B) shHER-2/neu-mediated down-regulation of HER-2/neu in HER-2/neu+ MCF-7 cells results in a reduced in CREB phophorylation. (C) Representative immunohistochemical staining and grading from breast cancer tumor lesions are shown.

PDF file - 48KB, SP-2 inhibits growth of ovarian cancer and melanoma xenografts.

PDF file - 8658K, Immunohistochemical analysis of HER-2/neu+ cells and shCREB-HER-2/neu+ cells following in-vivo tumorigenicity. (A) Representative images from organs of tumor-bearing mice injected with HER-2/neu+ cells and shCREB-HER-2/neu+ cells are shown. The tumors were fixed, embedded in paraffin, and 5 �m slices were stained as indicated. Magnification, 20�. (B) Tumor slices were stained with hematoxylin-eosin and analyzed for apoptosis (TUNEL), proliferation (Ki-67) and CREB expression. Following incubation with a horse-radish-peroxidase-linked antibody, the slices were stained with diaminobenzidine and counterstained with methylene blue. Arrows (apoptosis staining), blood vessels; arrowheads, apoptotic cells. Magnification, 20�.

PDF file - 1836K, Effects of shCREB constructs on CREB protein expression. (A) Efficacy of shCREB knock-down (shCREB-HER-2/neu+ cells) was analyzed using an NC control plasmid and four different shRNA plasmid contructs targeting murine CREB1. The following shRNA sequences were amplified and cloned into a pClip plasmid construct containing a puromycin resistance gene: plasmid #1: TCAGCCGGGTACTACCATTCT; plasmid #2: ACAGGGAGGCAGCAAGAGAAT, plasmid #3: AAGTCCAAACAGTTCAGATTT and plasmid #4: TGCTCCCACTGTAACCTTAGT. Plasmid NC (GGAATCTCATTCGATGCATAC) served as a nonsense control. These plasmids were transfected into HER-2/neu+ cells and CREB protein expression was determined by Western blotting as described in Materials and Methods using an anti-CREB-specific antibody. Arrows point to plasmid constructs that were further used in this study. (B) mRNA expression of ATF-1 and CREM was analyzed in HER-2/neu+ cells and shCREB-HER-2/neu+ cells using q-PCR. Data are means plus-minus SD (n = 3).

PDF file - 88K

PDF file - 101K, Supplementary Table 1. Summary of primers used Supplementary Table 2. Patients and tumor characteristics (n = 112) Supplementary Table 3. pCREB(ser133) status according to clinico-pathological parameters in T1-T2, N0 breast cancer patients (n = 112).

Trop-2 drives the recruitment of Akt to the cell membrane via its PH domain.

Supplementary Methods: Protein microarrays,Multiplex Western blotting,Confocal time-lapse microscopy, Western blotting, Immunohistochemistry, 3D structure analysis; Supplementary Table 3:Breast cancer case series clinical and pathological parameters; the file also contains legends for Supplementary Figures 1-6.

The BRCA1 tumor suppressor gene encodes a multidomain protein for which several functions have been described. These include a key role in homologous recombination repair (HRR) of DNA double-strand breaks, which is shared with two other high-risk hereditary breast cancer suppressors, BRCA2 and PALB2. Although both BRCA1 and BRCA2 interact with PALB2, BRCA1 missense variants affecting its PALB2-interacting coiled-coil domain are considered variants of uncertain clinical significance (VUS). Using genetically engineered mice, we show here that a BRCA1 coiled-coil domain VUS, Brca1 p.L1363P, disrupts the interaction with PALB2 and leads to embryonic lethality. Brca1 p.L1363P led to a similar acceleration in the development of Trp53-deficient mammary tumors as Brca1 loss, but the tumors showed distinct histopathologic features, with more stable DNA copy number profiles in Brca1 p.L1363P tumors. Nevertheless, Brca1 p.L1363P mammary tumors were HRR incompetent and responsive to cisplatin and PARP inhibition. Overall, these results provide the first direct evidence that a BRCA1 missense variant outside of the RING and BRCT domains increases the risk of breast cancer.Significance:These findings reveal the importance of a patient-derived BRCA1 coiled-coil domain sequence variant in embryonic development, mammary tumor suppression, and therapy response.See related commentary by Mishra et al., p. 6080

Trop-2 proteome profiling.

Supplementary Information, Figures and Tables

Purpose: Inhibition of AKT is a key target area for personalized cancer medicine. However, predictive markers of response to AKT inhibitors are lacking. Correspondingly, the AKT-dependent chain of command for tumor growth, which will mediate AKT-dependent therapeutic responses, remains unclear.Experimental Design: Proteomic profiling was utilized to identify nodal hubs of the Trop-2 cancer growth–driving network. Kinase-specific inhibitors were used to dissect Trop-2–dependent from Trop-2–independent pathways. In vitro assays, in vivo preclinical models, and case series of primary human breast cancers were utilized to define the mechanisms of Trop-2–driven growth and the mode of action of Trop-2–predicted AKT inhibitors.Results: Trop-2 and AKT expression was shown to be tightly coordinated in human breast cancers, with virtual overlap with AKT activation profiles at T308 and S473, consistent with functional interaction in vivo. AKT allosteric inhibitors were shown to only block the growth of Trop-2–expressing tumor cells, both in vitro and in preclinical models, being ineffective on Trop-2–null cells. Consistently, AKT-targeted siRNA only impacted on Trop-2–expressing cells. Lentiviral downregulation of endogenous Trop-2 abolished tumor response to AKT blockade, indicating Trop-2 as a mandatory activator of AKT.Conclusions: Our findings indicate that the expression of Trop-2 is a stringent predictor of tumor response to AKT inhibitors. They also support the identification of target-activatory pathways, as efficient predictors of response in precision cancer therapy. Clin Cancer Res; 22(16); 4197–205. ©2016 AACR.