Search

Cryptostigma cecropiaphilum Kondo & Roubik, sp. nov. Material examined (Coccidae). Holotype. Adult ♀. Left label: Cryptostigma / cecropiaphilum Kondo & / Roubik, Ecuador, Orellana / Prov., Yasuní Biosphere / Reserve, ca 14km North of / PUCE Scientific Field / Station, March 2018 / Coll. David W. Roubik. Right label: ex inside hollow stem of / Cecropia ficifolia Warb. / ex Snethl (Urticaceae) / inside nest of Plebeia sp. / Acid Fuchsin Stain / Canada Balsam, 1(1) (CTNI: No. 7109) . Paratypes. Same data as holotype, 54(58 specimens: 17 adult ♀♀ + 10 third-instar nymphs + 24 second-instar nymphs + 7 first-instar nymphs) (CTNI: No. 7109); same data as holotype except date is May 2019, coll. D. Roubik and A. Argoti, 14(15 specimens: 12 adult females + 3 third-instar nymphs) (CTNI: No. 7109); Francisco Orellana Province, Yasuni Biosphere Reserve, PUCE Scientific Field Station, 21.xi.2017, coll. David W. Roubik, inside hollow stem of Cecropia ficifolia Warb. Ex Snethl (Urticaceae), tended by Azteca sp. ants, 2(4 first-instar nymphs) (CTNI: No. 7109); Francisco Orellana Province, Yasuni Biosphere Reserve, PUCE Scientific Field Station, 10.xii.2019, coll. David W. Roubik, inside hollow stem of Cecropia sciadophylla Mart. (Urticaceae), 4(6 specimens: 1 adult female + 5 first-instar nymphs) (QCAZ)., Published as part of Kondo, Takumasa & Roubik, David W., 2022, Description of a new ant- and stingless-bee-loving species of Cryptostigma Ferris (Hemiptera: Coccomorpha: Coccidae) from Ecuador living inside internodes of Cecropia (Urticaceae), with an updated key to the adult females and first-instar nymphs of the genus, pp. 543-554 in Zootaxa 5190 (4) on page 546, DOI: 10.11646/zootaxa.5190.4.4, http://zenodo.org/record/7138503

Key to adult females of species of Cryptostigma Ferris (modified from Kondo 2010) 1 Ventral tubular ducts present............................................................................ 2 - Ventral tubular ducts absent............................................................................. 3 2(1) With multilocular disc-pores just posterior to antennae. Dorsum with 60 or more orbicular pores. Associated with ants......................................................................................... C. saundersi Laing - Without multilocular disc-pores around antennae. Dorsum with fewer than 35 orbicular pores. Associated with stingless bees................................................................................... C. chacoense Kondo 3(1) Margin of dorsal stigmatic sclerotization dentate (similar to the chain of a chainsaw)................ C. serratum Kondo - Margin of dorsal stigmatic sclerotization smooth, not dentate.................................................. 4 4(3) Dorsum with orbicular pores............................................................................ 5 - Dorsum without orbicular pores........................................................................ 11 5(4) Dorsum with 2 orbicular pores. Multilocular disc-pores present on each side of mouthparts....... C. biorbiculus Morrison - Dorsum with 3 or more orbicular pores. Multilocular disc-pores absent from around mouthparts...................... 6 6(5) Dorsum with a small group of many setae present next to each stigmatic sclerotization. Dorsal derm becoming tessellate in mature specimens. Orbicular pores totaling 3‒8.............................................. C. philwardi Kondo - Dorsal setae absent. Dorsal derm not tessellated in mature specimens. Orbicular pores totaling 3 or 5.................. 7 7(6) Dorsum with 5 orbicular pores.......................................................................... 8 - Dorsum with 3 orbicular pores.......................................................................... 9 8(7) Multilocular pores abundant around vulva and median areas of abdominal segments, and often a few on last thoracic segments too; also present in a submarginal band extending from vulvar area alongside anal cleft to posterior spiracular pore band on each side of body. Cribriform platelets present, each square, round or irregularly shaped and each with 2‒10 pores. Dorsum without clusters of small simple pores (apart from those in the platelets). Some antennal fleshy setae with apices not knobbed. Derm around body margin rugose............................................................. C. urichi (Cockerell) - Multilocular pores abundant around vulva and posterior abdominal segments, but not distributed as above. Cribriform platelets absent. Dorsum with clusters of 4‒10 small simple pores. Antennal fleshy setae with apices always knobbed. Derm around body margin smooth................................................................... C. inquilinum (Newstead) 9(7) Body margin heavily papillate. With very few or no multilocular pores near margin of abdominal apex.. C. gullanae Kondo - Body margin not papillate, although may be somewhat rugose. Numerous multilocular pores present around submargin of abdomen.......................................................................................... 10 10(9) Body about 2x longer than wide. Each stigmatic cleft with 1 stigmatic seta. Associated with ants...... C. jonmartini Kondo - Body about as long as wide. Each stigmatic cleft with 3 stigmatic setae. Associated with stingless bees.................................................................................................. C. melissophilum Kondo 11(4) Dorsum without sclerotic pores. Legs greatly reduced, but each with about 4 segments, each segment mostly quadrate........................................................................................ C. mexicanum Kondo - Dorsum with sclerotic pores. Legs greatly reduced, usually each represented by a rudimentary claw or small sclerotized disc with associated pores and setae......................................................................... 12 12(11) Sclerotic pores arranged in square- to rectangular-shaped groups. Dorsal microducts each with outer ductule long and heavily sclerotized, swollen near duct opening.............................................. C. reticulolaminae Morrison - Sclerotic pores not arranged as above. Dorsal microducts each with outer ductule long or short; if long, neither swollen near duct opening nor heavily sclerotized..................................................................... 13 13(12) Stigmatic sclerotization cone-shaped. Each anal plate with 10–16 dorsal setae............... C. guadua Kondo & Gullan - Stigmatic sclerotization not cone-shaped. Each anal plate usually with 5 or fewer dorsal setae....................... 14 14(13) Preopercular pores present............................................................................. 15 - Preopercular pores absent............................................................................. 16 15(14) Preopercular pores tubercle like. Multilocular pores restricted to perivulvar region and abdominal segments. Associated Hymenoptera unknown.............................................................. C. tuberculosum Kondo - Preopercular pores not tubercle like. Multilocular pores present on perivulvar region and mid areas of thoracic and abdominal segments, also with several pores around prothoracic legs. Associated with stingless bees or Azteca sp. ants.............................................................................. C. cecropiaphilum Kondo & Roubik sp. nov. 16(14) Dorsum next to each stigmatic cleft with small subcircular group of large simple pores.... Cryptostigma rhizophilum Kondo - Dorsum next to each stigmatic cleft without small group of large simple pores................................... 17 17(16) Venter with simple pores present on thorax. Habit arboreal...................................... C. longinoi Kondo - Venter without simple pores. Habit hypogeic............................................... C. silveirai (Hempel), Published as part of Kondo, Takumasa & Roubik, David W., 2022, Description of a new ant- and stingless-bee-loving species of Cryptostigma Ferris (Hemiptera: Coccomorpha: Coccidae) from Ecuador living inside internodes of Cecropia (Urticaceae), with an updated key to the adult females and first-instar nymphs of the genus, pp. 543-554 in Zootaxa 5190 (4) on pages 551-552, DOI: 10.11646/zootaxa.5190.4.4, http://zenodo.org/record/7138503, {"references":["Kondo, T. (2010) Taxonomic revision of the myrmecophilous, meliponiphilous and rhizophilous soft scale genus Cryptostigma Ferris (Hemiptera: Coccoidea: Coccidae). Zootaxa, 2709 (1), 1 - 72. https: // doi. org / 10.11646 / zootaxa. 2709.1.1"]}

Cryptostigma cecropiaphilum Kondo & Roubik, sp. nov. Material examined (Coccidae). Holotype. Adult ♀. Left label: Cryptostigma / cecropiaphilum Kondo & / Roubik, Ecuador, Orellana / Prov., Yasuní Biosphere / Reserve, ca 14km North of / PUCE Scientific Field / Station, March 2018 / Coll. David W. Roubik. Right label: ex inside hollow stem of / Cecropia ficifolia Warb. / ex Snethl (Urticaceae) / inside nest of Plebeia sp. / Acid Fuchsin Stain / Canada Balsam, 1(1) (CTNI: No. 7109) . Paratypes. Same data as holotype, 54(58 specimens: 17 adult ♀♀ + 10 third-instar nymphs + 24 second-instar nymphs + 7 first-instar nymphs) (CTNI: No. 7109); same data as holotype except date is May 2019, coll. D. Roubik and A. Argoti, 14(15 specimens: 12 adult females + 3 third-instar nymphs) (CTNI: No. 7109); Francisco Orellana Province, Yasuni Biosphere Reserve, PUCE Scientific Field Station, 21.xi.2017, coll. David W. Roubik, inside hollow stem of Cecropia ficifolia Warb. Ex Snethl (Urticaceae), tended by Azteca sp. ants, 2(4 first-instar nymphs) (CTNI: No. 7109); Francisco Orellana Province, Yasuni Biosphere Reserve, PUCE Scientific Field Station, 10.xii.2019, coll. David W. Roubik, inside hollow stem of Cecropia sciadophylla Mart. (Urticaceae), 4(6 specimens: 1 adult female + 5 first-instar nymphs) (QCAZ).

In Ecuador, agriculture is an important economic activity. Crops are grown mainly in the regions of the continental area: Amazon, Andes and Coast. We conducted this study to elaborate a compendium about the diversity of parasitoids of agri­cultural insect pests and to estimate the trend of biocontrol by the use of these natural enemies. Approximately 200 taxa of parasitoids were found to be reported controlling various pests that affect cultivated crops in continental Ecuador. The ma­jor parasitoids referred in biological control in Ecuador are Telenomus spp. (Hymenoptera: Platygastridae), Trichogramma spp. (Hymenoptera: Trichogrammatidae) and Encarsia spp. (Hymenoptera: Aphelinidae). The results suggest a decreasing trend in the use of parasitoids as biocontrol agents from 1980 to the present (R2: 0.80, P

Ripersiella menkei (McKenzie, 1962) Material examined. COSTA RICA: 2 ♀♀, Puntarenas Province, Manuel Antonio National Park, secondary rain forest, in leaf litter and root-matrix, 24.i.1993; 7 ♀♀, San José Province, Irazú volcano, near Jaboncillal, in leaf litter and root-matrix, 2800 m a.s.l., 16.i.1993; 5 ♀♀, Talamanca Mt. Range, Sierra de La Muerte, El Empalme, lower mountain wet forest, in leaf litter and root-matrix, 2150 m a.s.l., 24.i.1992. Distribution. * Costa Rica, Mexico., Published as part of Szita, Éva, Benedicty, Zsuzsanna Konczné, Kondo, Takumasa, Ramos-Portilla, Andrea Amalia & Kaydan, Mehmet Bora, 2020, Studies on the genus Ripersiella Tinsley (Hemiptera: Coccomorpha: Rhizoecidae) in the Neotropical region, with description of a new species, pp. 573-582 in Zootaxa 4851 (3) on page 578, DOI: 10.11646/zootaxa.4851.3.7, http://zenodo.org/record/4486957, {"references":["McKenzie, H. L. (1962) Third taxonomic study of California mealybugs, including additional species from North and South America (Homoptera: Coccoidea: Pseudococcidae). Hilgardia, 32, 637 - 688. https: // doi. org / 10.3733 / hilg. v 32 n 14 p 637"]}

Ripersiella sasae (Takagi & Kawai, 1971) Material examined. COSTA RICA: 1 ♀, Cartago Province, Turrialba, Tropical Agronomy Research and Learning Center (CATIE), in moss from trunks, 150 m a.s.l., 12.i.1993. Distribution. * Costa Rica, Japan, Madeira Island. Host. Sasa (Poaceae)., Published as part of Szita, Éva, Benedicty, Zsuzsanna Konczné, Kondo, Takumasa, Ramos-Portilla, Andrea Amalia & Kaydan, Mehmet Bora, 2020, Studies on the genus Ripersiella Tinsley (Hemiptera: Coccomorpha: Rhizoecidae) in the Neotropical region, with description of a new species, pp. 573-582 in Zootaxa 4851 (3) on pages 578-579, DOI: 10.11646/zootaxa.4851.3.7, http://zenodo.org/record/4486957, {"references":["Takagi, S. & Kawai, S. (1971) Two new hypogeic mealybugs of Rhizoecus from Japan (Homoptera: Coccoidea). Kontyu, 39, 373 - 378."]}

Ripersiella kondonis (Kuwana, 1923) Material examined. COSTA RICA: 1 ♀, Talamanca Mt. Range, Sierra de La Muerte, Alto de la Gloria, in leaf litter and moss, 1800 m a.s.l., 24.i.1992. Distribution. China, * Costa Rica, Guatemala, Japan, U.S.A. Hosts. Nerium (Apocynaceae), Chrysanthemum (Asteraceae), Celtis occidentalis (Cannabaceae), Stellaria media (Caryophyllaceae), Scabiosa (Dipsacaceae), Medicago sativa (Fabaceae), Pelargonium inquinans (Geraniaceae), Watsonia (Iridaceae), Salvia (Lamiaceae), Ligustrum (Oleaceae), Rumex (Polygonaceae), Portulaca grandiflora (Portulacaceae), Crataegus, Eriobotrya japonica, Fragaria, Prunus, Rosa (Rosaceae), Coffea arabica (Rubiaceae), Citrus (Rutaceae)., Published as part of Szita, Éva, Benedicty, Zsuzsanna Konczné, Kondo, Takumasa, Ramos-Portilla, Andrea Amalia & Kaydan, Mehmet Bora, 2020, Studies on the genus Ripersiella Tinsley (Hemiptera: Coccomorpha: Rhizoecidae) in the Neotropical region, with description of a new species, pp. 573-582 in Zootaxa 4851 (3) on pages 576-578, DOI: 10.11646/zootaxa.4851.3.7, http://zenodo.org/record/4486957, {"references":["Kuwana, S. I. (1923) Descriptions and biology of new or little-known coccids from Japan. Bulletin of Agriculture and Commerce, Imperial Plant Quarantine Station, Yokohama, 3, 1 - 67."]}

Ripersiella mexicana Hambleton, 1946 Material examined. COSTA RICA: 1 ♀, Alajuela Province, Poas Volcano National Park, 2704 m a.s.l., 21.i.1992; 2 ♀♀, San José Province, Irazú volcano, near Jaboncillal, in moss, 2800 m a.s.l., 16.i.1993; 7 ♀♀, Talamanca Mt. Range, Sierra de La Muerte, Alto de la Gloria, in leaf litter and root-matrix, 1800–3400 m a.s.l., 24.i.1992. Distribution. * Costa Rica, Mexico, Netherlands, Russia, U.S.A. Hosts. Mammillaria geminispina (Cactaceae), Euphorbia neoarborescens (Euphorbiaceae), Poaceae., Published as part of Szita, Éva, Benedicty, Zsuzsanna Konczné, Kondo, Takumasa, Ramos-Portilla, Andrea Amalia & Kaydan, Mehmet Bora, 2020, Studies on the genus Ripersiella Tinsley (Hemiptera: Coccomorpha: Rhizoecidae) in the Neotropical region, with description of a new species, pp. 573-582 in Zootaxa 4851 (3) on page 578, DOI: 10.11646/zootaxa.4851.3.7, http://zenodo.org/record/4486957, {"references":["Hambleton, E. J. (1946) Studies of hypogeic mealybugs. Revista de Entomologia. Rio de Janeiro, 17, 1 - 77."]}

Ripersiella incarum Kaydan & Szita, sp. n. ( Fig. 1). Material examined. Holotype ♀. Peru: Cusco Region / Machu Picchu / 7.xii.1972 / Leg. Balogh J. (PPI code: 12844; HNHM code: D-Am 3189); additional information: 2000 m a.s.l., moss forest, in leaf litter and roots. Description of the slide-mounted adult female. Body elongate-oval, 1.18 mm long, 0.68 mm wide. Eyes marginal, each about 12.5 μm wide. Antenna 5 segmented, 210 μm long; apical segment 85 μm long, 32.5 μm wide, with 4 fleshy setae, each seta 30–50 μm long, and apical setae each about 35 μm long. Clypeolabral shield 95 μm long, 105 μm wide. Labium 3 segmented, 115 μm long, 85 μm wide. Anterior spiracles each 32–35 μm long, 12–15 μm wide across atrium; posterior spiracles each 32–35 μm long, 12–15 μm wide across atrium. Legs well developed, length data for posterior legs: coxa about 110 μm, trochanter + femur 160–165 μm, tibia + tarsus about 175 μm, claw 30–35 μm. Ratio of lengths of tibia + tarsus to trochanter + femur 1.06–1.09:1; ratio of lengths of tibia to tarsus 0.89–1.0:1; ratio of length of hind trochanter + femur to greatest width of femur 2.75–3.2:1. Claw digitules spine-like, each about 7.5 μm long, shorter than claw. Claw without a denticle. Both pairs of ostioles present; anterior ostioles each with a total of 16 trilocular pores and 8 setae for both lips; posterior ostioles each with a total of 24–26 trilocular pores and 12–19 setae for both lips. Anal ring without spicules, 45 μm wide, bearing 6 setae, each seta 65–75 μm long. Dorsum. Derm membranous, without any cerarii around body margin. Setae on each anal lobe hair-like, each 50–55 μm long; body setae short flagellate, each 15–30 μm long, scattered on head, thorax and abdominal segments. Trilocular pores each 4–5 μm in diameter, scattered over entire body. Multilocular disc pores absent. Bitubular ducts, each duct 10 μm wide at mid-point, present in longitudinal single rows on medial, submedial and marginal areas; in a single row across abdominal segments, numbers as follows: segment I, 6; II, 5; III, 5; IV, 4; V, 5; VI, 4; VII, 6; VIII + IX, 0, and on head and thorax, 18. Tubular ducts absent. Venter. Setae flagellate, each 10–55 μm long, longest setae situated medially on head. Apical setae of anal lobe broken. Multilocular disc pores absent. Trilocular pores each 3–4 μm in diameter, scattered. Bitubular ducts, each duct 7–8 μm wide at mid-point, present in a longitudinal row on margins of abdomen and thorax, 1 on mid-area of each of abdominal segments VII and VI, and on mid-area of mesothorax. Distribution. Peru. Etymology. The name of the species is dedicated to the Inca people, as the specimen was found at Machu Picchu, near the most prominent icon of the Inca civilization. Diagnosis. Ripersiella incarum Kaydan & Szita sp. n. can be recognized by the combination of the following features: (i) antenna 5 segmented; (ii) circulus absent; (iii) bitubular ducts of one size on dorsum, distributed in longitudinal single rows on medial, submedial and marginal area; (iv) multilocular pores absent; and (v) tubular ducts absent. Ripersiella incarum sp. n. is similar to R. caledonensis and R. boharti in lacking circuli, but differs from them both in lacking multilocular pores and tubular ducts and in having 5-segmented antennae (multilocular pores and tubular ducts present, antennae 6 segmented in R. caledoniensis and R. boharti). Ripersiella incarum sp. n. is also similar to R. gombakensis (Williams) in lacking multilocular pores and tubular ducts, but differs in lacking a circulus and having 5-segmented antennae (circulus present and antennae 6 segmented in R. gombakensis)., Published as part of Szita, Éva, Benedicty, Zsuzsanna Konczné, Kondo, Takumasa, Ramos-Portilla, Andrea Amalia & Kaydan, Mehmet Bora, 2020, Studies on the genus Ripersiella Tinsley (Hemiptera: Coccomorpha: Rhizoecidae) in the Neotropical region, with description of a new species, pp. 573-582 in Zootaxa 4851 (3) on page 576, DOI: 10.11646/zootaxa.4851.3.7, http://zenodo.org/record/4486957

Ripersiella aloes Williams & Pellizzari, 1997 Material examined. COSTA RICA: 1 ♀, San José Province, Irazú volcano, near Jaboncillal, in leaf litter and rootmatrix, 2800 m a.s.l., 16.i.1993. Distribution. China, * Costa Rica, Russia (Gavrilov-Zimin & Gapon 2016), U.K. Hosts. Aloe glauca, Gasteria (Aloaceae)

Ripersiella Tinsley, 1899 Type species: Ripersia rumicus Maskell, 1892, Published as part of Szita, Éva, Benedicty, Zsuzsanna Konczné, Kondo, Takumasa, Ramos-Portilla, Andrea Amalia & Kaydan, Mehmet Bora, 2020, Studies on the genus Ripersiella Tinsley (Hemiptera: Coccomorpha: Rhizoecidae) in the Neotropical region, with description of a new species, pp. 573-582 in Zootaxa 4851 (3) on page 574, DOI: 10.11646/zootaxa.4851.3.7, http://zenodo.org/record/4486957, {"references":["Maskell, W. M. (1892) Further coccid notes: with descriptions of new species, and remarks on coccids from New Zealand, Australia and elsewhere. Transactions and Proceedings of the New Zealand Institute, 24 (1891), 1 - 64."]}

Ripersiella campestris (Hambleton, 1946) Material examined. COSTA RICA: 2 ♀♀, Heredia Province, La Selva Biological Station, River Sura, in leaf litter, 800 m a.s.l., 14.i.1992; 1 ♀, Talamanca Mt. Range, Sierra de La Muerte, Alto de la Gloria, in leaf litter and rootmatrix, 1800 m a.s.l., 24.i.1992. Distribution. Costa Rica, El Salvador, Guatemala. Hosts. Asteraceae, Coffea arabica (Rubiaceae)., Published as part of Szita, Éva, Benedicty, Zsuzsanna Konczné, Kondo, Takumasa, Ramos-Portilla, Andrea Amalia & Kaydan, Mehmet Bora, 2020, Studies on the genus Ripersiella Tinsley (Hemiptera: Coccomorpha: Rhizoecidae) in the Neotropical region, with description of a new species, pp. 573-582 in Zootaxa 4851 (3) on page 575, DOI: 10.11646/zootaxa.4851.3.7, http://zenodo.org/record/4486957, {"references":["Hambleton, E. J. (1946) Studies of hypogeic mealybugs. Revista de Entomologia. Rio de Janeiro, 17, 1 - 77."]}

Ripersiella loksae Konczné Benedicty & Kozár, 2004 Material examined. BRAZIL: 1 ♀, Amazonas State, Manaus, INPA protected forest, in leaf litter, 21.ix.1967; 2 ♀♀, Ceará State, Ubajara Park National, Serra Grande, tropical rainforest, in moss from trunks, 650 m a.s.l., 25.iv.1990; 3 ♀♀, Minas Gerais State, Santa Rita de Jacutinga, 1 km from waterfall, submontane rain forest, in leaf litter and root matrix, 13.ii.1995; 2 ♀♀, Rio de Janeiro State, Itatiaia National Park, near TV-tower, subtropical bushy vegetation with Lycopodium spp. and lichens, in leaf litter and root matrix, 1400 m a.s.l., 21.iv.1992; 2 ♀♀ on 1 slide, São Paulo State, Campinas, Americana, secondary forest in the valley of a small creek, in leaf litter, 21.ix.1967; 3 ♀♀, São Paolo State, Caraguatatuba, Serra do Mar State Park, Atlantic rain forest, in leaf litter, 900-1000 m a.s.l., 3.vi.1992; 1 ♀, São Paolo State, Ilha do São Sebastião, near pass, tropical rainforest, in thick leaf litter and root matrix, 400–450 m a.s.l., 28.xi.1990; 1 ♀, São Paolo State, Ilha do São Sebastião, protected urban forest, in leaf litter, 29.v.1992; 7 ♀♀, São Paolo State, São Roque, Project Itatuba, Sapucaia Lake, submontane Atlantic rain forest, in leaf litter, 800-850 m a.s.l., 3.i.1995; 15 ♀♀, São Paolo State, São Roque, Project Itatuba, Sapucaia Lake, submontane rain forest, in leaf litter, 800 m a.s.l., 9.i.1995; 2 ♀♀, São Paolo State, Pindamonhangaba, Paraíba valley, remnant rainforest, untouched, in moist leaf litter, 10.v.1990; 3 ♀♀, São Paolo State, Pindamonhangaba, secondary rain forest, in leaf litter, 28.v.1992; 2 ♀♀ on 1 slide, Serra da Mantiqueira Mt. Range, montain rainforest, in thick leaf litter and root matrix, 1500 m a.s.l., 18.v.1990; 4 ♀♀ on 2 slides, Serra do Mar Mt. Range, submontane rain forest, in leaf litter and root matrix, 1000 m a.s.l., 15.ii.1995; 1 ♀, Tocantins State, 5 km from Porto Nacional, bank of Tocantins river, gallery forest, in Selaginella sp. layer, 24.i.1995. PERU: 1 ♀, Lima-Pucallpa transect, 87 km from Pucallpa, virgin forest, in leaf litter and root matrix, 2-4.xi.1971. Distribution. Brazil, Chile, Paraguay, * Peru., Published as part of Szita, Éva, Benedicty, Zsuzsanna Konczné, Kondo, Takumasa, Ramos-Portilla, Andrea Amalia & Kaydan, Mehmet Bora, 2020, Studies on the genus Ripersiella Tinsley (Hemiptera: Coccomorpha: Rhizoecidae) in the Neotropical region, with description of a new species, pp. 573-582 in Zootaxa 4851 (3) on page 578, DOI: 10.11646/zootaxa.4851.3.7, http://zenodo.org/record/4486957

Ripersiella disjuncta (McKenzie, 1967) Material examined. COSTA RICA: 1 ♀, Alajuela Province, Arenal volcano, hot spings, in secondary rain forest leaf litter, 2800 m a.s.l., 16.i.1993; 1 ♀, Heredia Province, La Selva Biological Station, River Sura, in leaf litter, 1800 m a.s.l., 24.i.1992; 2 ♀♀, Puntarenas Province, Manuel Antonio National Park, secondary rain forest, in leaf litter and root-matrix, 24.i.1993; 1 ♀, San José Province, Irazú volcano, near Jaboncillal, in leaf litter and rootmatrix, 2800 m a.s.l., 16.i.1993; 2 ♀♀, San José Province, Tarbaca, lower mountain wet forest, Quercus seemanni trees, in leaf litter and root-matrix, 1550 m a.s.l., 14.i.1993. Distribution. * Costa Rica, Mexico, USA. Hosts. Encelia (Asteraceae), Eriogonum fasciculatum (Polygonaceae)., Published as part of Szita, Éva, Benedicty, Zsuzsanna Konczné, Kondo, Takumasa, Ramos-Portilla, Andrea Amalia & Kaydan, Mehmet Bora, 2020, Studies on the genus Ripersiella Tinsley (Hemiptera: Coccomorpha: Rhizoecidae) in the Neotropical region, with description of a new species, pp. 573-582 in Zootaxa 4851 (3) on pages 575-576, DOI: 10.11646/zootaxa.4851.3.7, http://zenodo.org/record/4486957, {"references":["McKenzie, H. L. (1967) Mealybugs of California with taxonomy, biology, and control of North American species (Homoptera: Coccoidea: Pseudococcidae). University of California Press, Berkeley, California, 526 pp."]}

Ripersiella caledoniensis Kozár & Konczné Benedicty, 2003 Material examined. COSTA RICA: 5 ♀♀ on 3 slides, Alajuela Province, Poas Volcano National Park, in leaf litter and soil, 21.i.1992. Distribution. * Costa Rica, New Caledonia., Published as part of Szita, Éva, Benedicty, Zsuzsanna Konczné, Kondo, Takumasa, Ramos-Portilla, Andrea Amalia & Kaydan, Mehmet Bora, 2020, Studies on the genus Ripersiella Tinsley (Hemiptera: Coccomorpha: Rhizoecidae) in the Neotropical region, with description of a new species, pp. 573-582 in Zootaxa 4851 (3) on page 575, DOI: 10.11646/zootaxa.4851.3.7, http://zenodo.org/record/4486957, {"references":["Kozar, F. & Konczne Benedicty, Z. (2003) Description of four new species from Australian, Austro-oriental, New Zealand and South Pacific regions (Homoptera, Coccoidea, Pseudococcidae, Rhizoecinae), with a review, and a key to the species Ripersiella. Bollettino di Zoologia Agraria e di Bachicoltura, Milano, Series 2, 35, 225 - 239."]}

Ripersiella aloes Williams & Pellizzari, 1997 Material examined. COSTA RICA: 1 ♀, San José Province, Irazú volcano, near Jaboncillal, in leaf litter and rootmatrix, 2800 m a.s.l., 16.i.1993. Distribution. China, * Costa Rica, Russia (Gavrilov-Zimin & Gapon 2016), U.K. Hosts. Aloe glauca, Gasteria (Aloaceae), Published as part of Szita, Éva, Benedicty, Zsuzsanna Konczné, Kondo, Takumasa, Ramos-Portilla, Andrea Amalia & Kaydan, Mehmet Bora, 2020, Studies on the genus Ripersiella Tinsley (Hemiptera: Coccomorpha: Rhizoecidae) in the Neotropical region, with description of a new species, pp. 573-582 in Zootaxa 4851 (3) on page 575, DOI: 10.11646/zootaxa.4851.3.7, http://zenodo.org/record/4486957, {"references":["Williams, D. J. & Pellizzari, G. (1997) Two species of mealybugs (Homoptera Pseudococcidae) on the roots of Aloaceae in greenhouses in England and Italy. Bollettino di Zoologia Agraria e di Bachicoltura, Milano, Series II, 29, 157 - 166.","Gavrilov-Zimin, I. A. & Gapon, D. A. (2016) New Afrotropical scale insect pests (Homoptera: Coccinea) under glass in St Petersburg, Russia. Zoosystematica Rossica, 25, 233 - 238. https: // doi. org / 10.31610 / zsr / 2016.25.2.233"]}

Coccus pseudotumuliferus Gullan & Kondo sp. n. urn:lsid:zoobank.org:act: 73044BE2-763D-494F-AA8B-0CCEF0859A1D (Figs 2E, 11 A���C, 12) Coccus ��� tumuliferus var. C. 84���, Heckroth et al. 1998: 431, 432, 434, 436, 438 & 440. Morphospecies C. 214, Heckroth et al. 1998: 431, 433, 436, 437 & 440. Coccus "near tumuliferus ", Quek et al. 2017: 823. Type material examined. Holotype: adult female, BORNEO: Sabah, Crocker Range, Tikolod, 650 m, ex hollow stem of Macaranga indistincta, 18 Oct. 1999, coll. S.-P. Quek, SPQ.125b, DNA voucher 1(1) (FRIM). Paratypes: BORNEO: same data as holotype except ex M. pearsonii & M. glandibracteolata, SPQ.126a & SPQ.129b, DNA vouchers 2(2) (ANIC); Sabah, Crocker Range, Keningau to Ulu Kimanis trail, ~ 5.28�� N, ~ 116.05�� E, 900���1200 m, ex M. angulata, M. puberula & M. glandibracteolata, 19 Oct. 1999, coll. S.-P. Quek, SPQ.131b, SPQ.136b, SPQ.139 & SPQ.147, DNA vouchers 4(4) (3 ANIC, 1 FRIM: SPQ.147); Sabah, Crocker Range, past Keningau, Senagang, 450 m, ex M. glandibracteolata & M. indistincta, 20 Oct. 1999, coll. S.-P. Quek, SPQ.148 & SPQ.150, DNA vouchers 2(2) (1 ANIC, 1 FRIM: SPQ.148); Sabah, Crocker Range, Mahua camp, 1000 m, ex M. puberula, 16 Oct. 1999, coll. S.-P. Quek, SPQ.101a, DNA vouchers 2(2); Sabah, Crocker Range, near Majora, Apin Apin, 500 m, ex M. motleyana, 16 Oct. 1999, coll. S.-P. Quek, SPQ.102 & SPQ.103b, DNA vouchers 2(2); Sabah, Crocker Range, near Majora, 500? m, ex M. glandibracteolata & M. indistincta, 16 Oct. 1999, coll. S.-P. Quek, SPQ. 108b, SPQ.110a & SPQ.111, DNA vouchers 4(4) (3 ANIC, 1 FRIM: SPQ.110a); Sabah, Crocker Range, Tambunan to Kota Kinabalu road, Rafflesia Reserve, 1200 m, ex M. petanostyla, 15 Oct. 1999, coll. S.-P. Quek, SPQ.100b, DNA voucher 1(1); Sabah, Crocker Range, Tambunan to Kota Kinabalu road, 200 m, ex M. bancana, 24 Oct. 1999, coll. S.-P. Quek, SPQ.174b, DNA voucher 1(1); Sabah, Crocker Range, Tambunan to Ranau road, 15 km from Ranau, ex M. indistincta, 22 Oct. 1999, coll. S.-P. Quek, SPQ.155, DNA voucher 1(1) (FRIM); Sabah, Crocker Range, Tambunan to Trusmadi trail, 1200���1300 m, ex M. angulata, M. indistincta & M. puberula, 23���24 Oct. 1999, coll. S.-P. Quek, SPQ.157, SPQ.159, SPQ.160 & SPQ.161, DNA vouchers 4(4). Note. The holotype is not a perfect specimen but was chosen for three reasons: (1) it shows the diagnostic features of the species, (2) it is a DNA voucher specimen included in the analysis of Quek et al. (2017), and (3) it is from northwest Borneo, a region where this species is well sampled. The collection site probably was along Jalan Kampung Tikolod at about 5�� 38'18" N and 116�� 16'15" E. Although the description below is based on measurements of specimens from a range of localities in Borneo, our type series is restricted to specimens from the Crocker Range in Sabah, for the following reasons. Subsequent, especially molecular, research on further samples of these coccids may show cryptic species or subsequent authors may have a more restrictive species concept. Species delineation is problematic because of parthenogenesis (as explained in the Introduction) and thus deciding whether there is one variable species or several more tightly defined species is highly subjective. Other material studied. BORNEO: Brunei, Batu Apoi Forest Reserve, near KBFSC, 4�� 33' N, 115��09' E, ex M. trachyphylla & Macaranga sp., 7, 9���11, 26���28 Aug. 1995, coll. P.J. Gullan, PJG-B15: 5(2 adult females & 16 first-instar nymphs), PJG-B22: 8(7 adult females, including 1 on slide with C. macarangae, & 6 first-instar nymphs), PJG-B23: 6(4 adult females & 28 first-instar nymphs) (coll. P.S. Cranston), PJG-B26: 1(1), PJG-B28: 2(1 adult female & 1 nymphal female), PJG-B51: 1(1), PJG-B52: 2(2), PJG-B56: 6(3 adult females, 2 nymphal females & 8 first-instar nymphs); East Kalimantan, Bukit Bangkirai, 1�� 1.497' S, 118�� 51.949' E, M. pearsonii, 13 Feb. 2005, coll. S.-P. Quek, SPQ.727, DNA voucher 1(1); East Kalimantan, Samarinda, Tenggarong to Kota Bangun Road, M. pearsonii, 11 June 2001, coll. S.-P. Quek, SPQ.321, DNA voucher 1(1); East Kalimantan, Wanariset to Bukit Bangkirai Road, 00�� 59.29' S, 116�� 55.47' E to 1�� 0.72' S, 116�� 52.04' E, M. hosei, M. hypoleuca & M. pearsonii, 13 Feb. 2005, coll. S.-P. Quek, SPQ.722, SPQ.723 SPQ.724a & SPQ.725, DNA vouchers 4(4); North Kalimantan, Long Ampung, Sungai Anai trail, 1�� 42.96' N, 114�� 57.30' E & 1�� 42.97' N, 114�� 57.23' E, 700 m, ex M. glandibracteolata & M. beccariana, 9 Feb. 2005, coll. S.-P. Quek, SPQ.696, & SPQ.698a DNA vouchers 2(2); North Kalimantan, Long Ampung, Sungai Selungei trail, 1�� 42.27' N, 114�� 58.90' E, 700 m, ex M. glandibracteolata, 10 Feb. 2005, coll. S.-P. Quek, SPQ.714, DNA voucher 1(1); West Kalimantan, Siduk to Nanga Tayap, 1�� 21.72' S, 110�� 12.10' E & 1�� 21.67' S, 110�� 12.30' E, M. indistincta / velutina, M. aeth��adenia & M. hosei, 22 June 2001, coll. S.-P. Quek, SPQ.408a, SPQ.412a & SPQ.415, DNA vouchers 3(3); Sabah, Poring, ~ 6�� N, 116�� E, ex M. pearsonii & M. indistincta, 30.x.1992 & 25.xi.1992, coll. B. Fiala, #251a, 252a & 253a, 8(8); Sabah, Poring, ex M. pearsonii, Apr. 2001, coll. B. Fiala, #120 (TK0036) & #128 (TK0038), DNA vouchers 3(3); Sabah, Poring, ex M. glandibracteolata, M. indistincta & M. pearsonii, 17 Apr. 2001, coll. B. Fiala, #39 (TK0021), #40 (TK0023), #48 (TK0043), #106b (TK0031), #110 (TK0035), DNA vouchers 5(5); Sabah, Poring, ex M. pearsonii & M. winkleri, 18 Apr. 2001, coll. B. Fiala, #159 (TK0042) & #158 (TK0044), DNA vouchers 2(2); Sabah, Poring, ex M. pearsonii, 24 Apr. 2002, coll. B. Fiala, #120 (TK0099), DNA voucher 1(1); Sabah, Poring Hot Springs, Kipungit waterfall, ex M. beccariana, Dec 1994, coll. H.-P. Heckroth, #598, 1(2 adult females on slide with 5 adults of C. penangensis); Sabah, Poring Hot Springs, ex M. indistincta, no date, coll. H.-P. Heckroth, #581 & 589, 2(3, including 1 on slide with 1 adult female of C. near circularis) (FRIM); Sabah, Ranau, Kota Kinabalu, roadside, ex M. beccariana, 27 Mar. 2002, coll. B. Fiala. #124 (TK0098), DNA voucher 1(1); Sabah, road from Ranau to Sandakan, ex M. pearsonii, Jan. 1995, coll. H.-P. Heckroth, #631, 3(3); Sabah, road from Ranau to Sandakan, ex M. pearsonii, no date, coll. H.-P. Heckroth, #529, 1(4) (FRIM); Sabah, 10 km south of Ranau, ex M. pearsonii, 1995 or no date, coll. H.-P. Heckroth, #525, 526, 527, 614, 635 & 1203, 6(23, including 2 on slide with 1 adult female of C. secretu s) (FRIM); Sabah, 10 km south of Ranau, ex M. winkleri, no date, coll. H.-P. Heckroth, #646, 1(5) (FRIM); Sabah, 60.5 km south of Ranau, ex M. hypoleuca, 1995, coll. H.-P. Heckroth, #629, 1(1 on slide with 1 adult female of C. secretus) (FRIM); Sabah, Tawau, Air Panas, ex M. motleyana, 15 Mar. 2002, coll. B. Fiala, #55b (TK0110), DNA voucher 1(1); Sabah, Tawau Hills, ex M. glandibracteolata, M. indistincta & M. pearsonii, 5���7 Apr. 2001, coll. B. Fiala, #76 (TK0025), #78b (TK0029), #77 (TK0026), #90 (TK0027), #95 (TK0033), DNA vouchers 5(5); Sabah, Tawau, ex M. indistincta & M. umbrosa [latter now correctly identified as M. lamellata], 12 & 20 Mar. 2002, coll. B. Fiala, #13 (TK0109) & #78b (TK0104), DNA vouchers 2(2); Sabah, Tawau, Bukit Bombalai, ex M. glandibracteolata, 13 Mar. 2002, coll. B. Fiala, #32 (TK0105), DNA voucher 1(1); Sabah, Tawau, ex M. pearsonii, 30 Aug. 2003, coll. B. Fiala, #64, 4(4); Sabah, Tawau Hills, ex M. triloba [now correctly named M. bancana], coll. H.-P. Heckroth, #477, 1(3) (FRIM); Sarawak, 2 km Lambir, ex M. hosei, Dec. 1992, coll. H.-P. Heckroth, #47 & #85, 3(3); Sarawak, Kubah [national park near Kuching], ex M. aeth��adenia, Dec. 1994, coll. H.-P. Heckroth, #377, 1(3); Sarawak, Lambir, 150 m, ex M. beccariana & M. hosei, 3 Sept. 2001, coll. K. Murase, KM.s03, KM.s06, KM.s21 & KM.s24, DNA vouchers 4(4) (FDS); Sarawak, Lambir, 150 m, ex M. beccariana & M. hullettii, 2���4 Aug. 2003, coll. T. Itioka, TI.s45, TI.s54 & TI.s58, DNA vouchers 3(3) (FDS); Sarawak, 2 km Lambir NP, ex M. beccariana, Dec. 1992, coll. H.-P. Heckroth, #30 & #73, 7(7); Sarawak, 2 km Lambir NP, ex M. hosei, Dec. 1992, coll. H.-P. Heckroth, #47, 1(1 on slide with 1 adult female of C. heckrothi) (FRIM); Sarawak, 3 km Lambir NP, ex M. beccariana, Dec. 1992, coll. H.P. Heckroth, #44, 1(1); Sarawak, 3 km Lambir NP, ex M. beccariana, Feb. 1993, coll. H.P. Heckroth, #45, 1(3) (FRIM); Sarawak, 8 km Lambir NP, ex M. lamellata, Dec. 1992, coll. H.-P. Heckroth, #106, #107 & #113, 4(4); Sarawak, Serian, "Serian" waterfall [perhaps Ranchan Waterfall], ex M. hypoleuca, Dec. 1994, coll. H.-P. Heckroth, #404, 1(7); South Kalimantan, Meratus Mts, Kapayang village to Loksado, 381 m & 500 m, 2�� 48.86' S, 115�� 30.70' E & 2�� 48.98' S, 115�� 31.13' E, ex M. bancana & M. motleyana, 18 June 2001, coll. S.-P. Quek, SPQ.346b & SPQ.340, DNA vouchers 2(2); South Kalimantan, Meratus Mts, Loksado to Kandangan, 170���211 m, 2�� 47.48' S, 115�� 25.94' E to 2�� 48.21' S, 110�� 25.52' E, ex M. motleyana, 18 June 2001, coll. S.-P. Quek, SPQ.356a, SPQ.358a & SPQ.362, DNA vouchers 3(3). PENINSULAR MALAYSIA: Gombak, lower logging road, ex M. hosei, Feb. 1993, coll. H.-P. Heckroth, #214, 3(3); Gombak, lower logging road, ex M. hosei, Mar. 1993, coll. H.-P. Heckroth, #270, 6(9) (5 slides in ANIC & 1 slide with 4 adult females in FRIM); Johor, just after Mersing towards Johor Bahru, lowland, ex M. griffithiana, 16 Sept. 1999, coll. S.-P. Quek, SPQ.068a, 2(2); Johor, Labis Air Panas, ex M. hosei, coll. H.-P. Heckroth, #1069, 1(3 on slide with 1 adult female of C. secretus) (FRIM); 6 km Rawang, ex M. griffithiana, Feb. 1993, coll. H.-P. Heckroth, #206, 6(4 adult females + 2 probably third-instar females). Note. This species was recognised as a variety as well as a separate morphospecies and referred to as ��� C. tumuliferus var. C. 84��� and "morphospecies C. 214" by Heckroth et al. (1998). Specimens of this new species form Clade 3, referred to as "near tumuliferus ", in Quek et al. (2017, fig. 3). This clade has several very closely related subgroups, which we consider to be geographic variants, which mostly do not appear to exhibit consistent morphological differences (see below under Comments); thus measurements for the description below were based on adult females from across Borneo, despite some variation in live appearance among females (note that live appearance is unknown for most specimens of this species). Etymology. Early in our study we confused specimens of this species with those of C. tumuliferus, with which it shares many morphological similarities, including the raised areas on the dorsum; hence, we have named this new species "pseudotumuliferus" from the Latin " pseudo -" meaning "false". Adult female. Unmounted material. In life, adult females varied from bright, shining pink to red (Fig. 2E) to brownish-yellow, depending on collection locality and perhaps age. Available adult females preserved in ethanol were bright pinkish red in colour. Body broadly oval to almost circular, having a fairly definite arrangement of dorsal humps (Fig. 11 A���C) with the marginal row of humps most obvious and the central area of dorsum varying from having humps to almost flat; mature females covered dorsally with a brittle, whitish, glassy secretion, easily broken, moulded into elevations corresponding to those of the body, with secretion in the central part of dorsum variable among specimens from different collections (Fig. 11 A���C). Slide-mounted adult female (n=19, all from Borneo and including holotype and 8 paratypes; Fig. 12). Body oval to circular, 1.7���3.6 (holotype 2.45) mm long, 1.2���3.2 (holotype 2.06) mm wide. Dorsum. Derm (dd) completely membranous, weakly areolated, with clear area of each areolation usually 4���7 ��m in widest dimension; with a series of humps (oval, elongate to irregularly circular raised areas of cuticle) present in a submarginal row of 23���25 (11 or more rarely 12 on each side, plus always 1 medially on head), 3 or 4 on each side submedially, and sometimes 3 or 4 slightly raised areas medially but poorly defined. Dorsal setae (dset) very short, each 2.5���3.0 ��m long with rounded apex, scattered on dorsum; humps difficult to discern on younger slide-mounted specimens. Simple pores (sp) each 2.5 ��m wide, scattered evenly on dorsum. Preopercular pores (pop) each 2.5���6.3 (mostly 3.0���5.0) ��m wide, often scarce and easily confused with simple pores, present in a small group of 3���18 anterior to anal plates. Dorsal microducts (dmic) in areolations each about 2.0 ��m wide, appearing bilocular under high magnification. Anal plates (anplt) each broadly triangular with anterolateral margin usually slightly convex and slightly longer than posterolateral margin, length of each plate 1.2���1.8 times width, inner lobes fairly well developed and with a tessellated texture but often difficult to see, each plate 148���183 ��m long, 90���140 ��m wide, anterolateral margin 135���170 ��m long, posterolateral margin 98���133 ��m long; each plate with 12���20 dorsal setae (except for specimens from the Meratus Mountains and some from Gombak; see Comments section for variation), each seta 10���23 ��m long. Anal ring (ar) bearing 10 setae, each 85���125 ��m long. Margin. Eyespots present slightly removed from dorsal margin, each 17.5���22.5 ��m in maximum dimension, often difficult to detect. Marginal setae (mset) variable in length and robustness among specimens, sharply spinose to flagellate, usually present in 2 or 3 rows, rarely (Meratus Mountains specimens only) in an irregular single row on part of margin, each seta 12���65 ��m long, with 25���63 setae between anterior and posterior stigmatic areas on each side of body. Stigmatic setae (stgset) shorter than marginal setae, usually numbering 3 per cleft, occasionally fewer (but often lost from DNA vouchers), spinose with rounded apices, all setae subequal in length or median seta slightly longer, each 3.0���18.0 (mostly 7.5���12.5) ��m long. Venter. Derm membranous. Ventral setae (vset) slender, longest submedially on posterior abdominal segments, each 15���80 ��m long, elsewhere shorter, 10���30 (mostly ���20) ��m long. Interantennal setae numbering 2 pairs, each seta 12���15 ��m long. Ventral tubular ducts (vtd) present in a broad submarginal band; each duct with outer ductule 17���20 ��m long, inner ductule 15���20 ��m long, and duct opening about 2 ��m wide. Ventral microducts (vmic) each 2.0��� 2.5 ��m wide, scattered fairly evenly on venter. Pregenital disc-pores (pgp) each with 7���11 loculi, each pore 5��� 7 ��m wide. Antennae (ant) 7 segmented, each 215���265 ��m long; apical antennal segment 37.5���52.5 ��m long, with apical prolongation 6���15 ��m long and usually ��� 10 ��m on at least 1 antenna (rarely absent); fleshy setae present on last 3 segments. Mouthparts normal; clypeolabral shield 200���258 ��m long, 170���228 ��m wide; labium 90���115 ��m long, 120���150 ��m wide. Legs with hind trochanter + femur 148���175 ��m long; hind tibia + tarsus 140���188 ��m long; all tarsal digitules each 35���45 ��m long; claw digitules each 22���30 ��m long, claws each 20���27 ��m long. Spiracles normal: anterior peritremes each 55���78 ��m wide; posterior peritremes each 65���83 ��m wide. Spiracular pores (spp) each 4���5 ��m wide, almost all with 5 loculi. Comments. Heckroth et al. (1998) pointed out that C. tumulifer us and C. tumuliferus var. C. 84 were morphologically very similar and presumably closely related, and although they thought that these two Coccus species shared the same ant partner, the associations now are known to be more complex (Quek et al. 2017). Heckroth et al. (1998) recorded C. pseudotumuliferus (as var. C. 84) only on Borneo, in both secondary and primary forest, from 14 species of Macaranga but most abundant on M. beccariana. Also, as stated in Quek et al. (2017, table S7), morphospecies C. 214 of Heckroth et al. (1998) resembles C. pseudotumuliferus. PJG examined three Heckroth specimens (collection #214 from M. hosei at Gombak, Peninsular Malaysia) of this morphospecies and considered them to be identifical to adult females from Heckroth collection #270 (also from M. hosei at Gombak), as well as sufficiently similar to Bornean collections of C. pseudotumuliferus to be treated as a geographic form of this species, at least until further information is available. On Borneo, Heckroth et al. (1998) recorded morphospecies C. 214 exclusively from primary forest, but on Peninsular Malaysia, where there is little primary forest left, the few collections were from secondary forest. The only Heckroth specimens from Borneo slide-mounted and identified by him as C. 214 are apparently C. near circularis (#522, 573, 640, 1140 & 1410) and probably C. penangensis (#550), all from Poring Hot Springs (difficult to identify as many specimens are poorly cleared). We assume that Heckroth first recognised his morphospecies C. 214 based on females from Gombak that have this 214 collection number, but later decided that the morphospecies also occurred on Borneo. Probably on Borneo it may have been confused with C. near circularis and C. penangensis because Heckroth's doctoral thesis states that C. 214 is very similar to C. penangensis and cannot be distinguished without slide preparation. As discussed above in the note following the list of specimens examined, there is a small amount of genetic variation among specimens of C. pseudotumuliferus from different areas of Borneo as well as some variation in live appearance (although live appearance is poorly recorded). Morphological variation across the geographic range of this species is discussed in the third paragraph below. Our type series is restricted to specimens from the Crocker Range in Sabah largely because of variation across the range of specimens that we consider to be this species (see Note after the listing of type specimens above). Adult females of C. pseudotumuliferus from Borneo can be disting, Published as part of Gullan, Penny J., Kondo, Takumasa, Fiala, Brigitte & Quek, Swee-Peck, 2018, Taxonomy of coccids (Hemiptera: Coccidae: Coccus L.) associated with Crematogaster ants (Hymenoptera: Formicidae) in the stems of Macaranga plants (Euphorbiaceae) in Southeast Asia, pp. 1-51 in Zootaxa 4521 (1) on pages 34-39, DOI: 10.11646/zootaxa.4521.1.1, http://zenodo.org/record/3770241, {"references":["Heckroth, H. - P., Fiala, B., Gullan, P. J., Idris, A. H. & Maschwitz, U. (1998) The soft scale (Coccidae) associates of Malaysian ant-plants. Journal of Tropical Ecology, 14, 427 - 443. https: // doi. org / 10.1017 / S 0266467498000327","Quek, S. P., Ueda, S., Gullan, P. J., Kondo, T., Hattori, M., Itioka, T., Murase, K. & Itino, T. (2017) Nuclear-DNA-based species delineations of Coccus scale insects in symbiosis with plants and ants, and the role of plant epicuticular wax in structuring associations. Biological Journal of the Linnean Society, 120 (4), 818 - 835. https: // doi. org / 10.1111 / bij. 12917"]}

Coccus heckrothi Gullan & Kondo sp. n. urn:lsid:zoobank.org:act: 86F500BF-88D0-44F0-AE47-F4E76687E9AB (Fig. 5) ��� Coccus sp. Y���, Quek et al. 2017: 823. Type material examined. Holotype: adult female, BORNEO: Sarawak, 2 km from Lambir Hills National Park in direction of Miri, in hollow stem of Macaranga hosei, Dec. 1992, coll. H.-P. Heckroth, #85, 1(1) (FRIM). Paratypes: BORNEO: same data as holotype, 12(12) and 2(2 third-instar females) (ANIC except 4 adult females to FRIM); Sarawak, 2 km Lambir NP, ex M. hosei, Dec. 1992, coll. H.-P. Heckroth, #47, 1(1 on slide with 1 adult female of C. pseudotumuliferus) (FRIM); Sarawak, 3 km Lambir, in hollow stem of Macaranga trachyphylla with C. secretus, Dec. 1992, coll. H.-P. Heckroth, #92, 3(3) (ANIC); Sarawak, 3 km Lambir, in hollow stem of Macaranga hosei, Feb. 1993, coll. H.-P. Heckroth, #50, 1(4) (FRIM); Sarawak, Lambir, ex M. rufescens & M. hosei, 3 Sept. 2001, coll. K. Murase, KM.s11 & KM.s22, DNA vouchers 2(2) (FDS); Sarawak: Lambir, ex M. rufescens (TI.s42 only) & M. hosei, 2���4 Aug. 2003, coll. T. Itioka, TI.s42, TI.s49, TIs.50, TI.s51 & TI.s52a, DNA vouchers 5(5) (FDS). Other material examined. BORNEO: Sabah, Crocker Range, Keningau, 1100 m, ex M. puberula, 17 Oct. 1999, coll. S.-P. Quek, SPQ.113, DNA voucher 1(1); Sabah, Crocker Range, ex M. pearsonii, 13 Apr. 2001, coll. B. Fiala, #8 (TK0016), DNA voucher 1(1); North Kalimantan, Long Ampung, Sungai Anai trail, 700 m, 1�� 42.964' N, 114�� 56.943' E, ex M. a��theadenia & M. bancana / M. indistincta, 9 Feb. 2005, coll. S.-P. Quek, SPQ.701, SPQ.704 & SPQ.705, DNA vouchers 3(3). Note. Specimens of this new species form Clade 7, which is referred to as ��� Coccus sp. Y��� in Quek et al. (2017, fig. 3). This clade has two very closely related subgroups, which are considered to be geographically separated populations���one from Sarawak and Sabah, and the other from North Kalimantan. This species appears to be common in and near Lambir Hills National Park in Sarawak. Etymology. During his Ph.D. studies, Hans-Peter Heckroth recognised this species as Coccus morphospecies 85, but did not specifically refer to it in his publications on the Macaranga coccids (Heckroth et al. 1998, 2001). Here we name the species after him in recognition of his pioneering research on the Macaranga coccids. Adult female. Unmounted material. Not seen. Slide-mounted adult female (n = 10, all from Lambir and including holotype; Fig. 5). Body elongate oval, 1.9���3.5 (holotype 1.9) mm long, 1.4���2.9 (holotype 1.4) mm wide. Dorsum. Derm (dd) with circular to oval areolations, mostly each 10���40 ��m in greatest dimension, and with lightly sclerotised submarginal lines radiating inwards at right angles to margin, often obvious only on more mature females. Dorsal setae (dset) slender, each 6���23 (mostly 10���15) ��m long, sparsely scattered on dorsum. Simple pores (sp) each 2.5���3.2 ��m wide, scattered evenly on dorsum. Preopercular pores (pop) each 4���7 (mostly 5) ��m wide, present in an elongate cluster of 8���16 pores anterior to anal plates. Dorsal microducts (dmic) in areolations each 1.8���2.2 ��m wide, appearing bilocular under high magnification. Anal plates (anplt) each triangular and typically with slightly convex margins, anterolateral margin always slightly longer than posterolateral margin, length of each plate 1.5���1.9 times width, inner lobes swollen, with a tessellated texture, each plate 165���183 ��m long, 85���118 ��m wide, anterolateral margin 125���158 ��m long, posterolateral margin 105���133 ��m long; each plate with 12���23 dorsal setae, each 18���25 ��m long. Anal ring (ar) with 10 setae, each 90���120 ��m long. Margin. Eyespots, if visible, each 20���35 ��m in maximum dimension, on margin but difficult to discern. Marginal setae (mset) in 1 row, most setae sharply spinose, rarely with apices fimbriate or bifurcate, each 12���45 (mostly 20���40) ��m long, setae near anal cleft with tendency to be shorter and more fimbriate at apices than setae of rest of margin; with 10���21 setae between anterior and posterior stigmatic areas on side of body. Stigmatic setae (stgset) well developed, sharply spinose, typically numbering 3 per cleft, median setae longest, each 22���43 ��m long, lateral setae each 12���28 (mostly>15) ��m long. Venter. Derm membranous. Ventral setae (vset) slender, with posterior-most prevulvar pair longest (each seta up to 55 ��m long), elsewhere shorter, each 7���20 ��m long. Interantennal setae numbering 3 pairs, each seta ��� 20 ��m long. Ventral tubular ducts (vtd) present in a broad submarginal band; each duct with outer ductule 15���20 ��m long, inner ductule usually 15���18 ��m long, and duct opening about 2 ��m wide. Ventral microducts (vmic) each about 2 ��m wide, scattered fairly evenly on venter. Pregenital disc-pores (pgp) each with 8���10 loculi, each pore 6���7 ��m wide. Antennae (ant) 7 (rarely 6 or 8) segmented, each 225���270 ��m long, fleshy setae present on last 3 segments. Clypeolabral shield 258���280 ��m long, 205���255 ��m wide; labium 110���120 ��m long, 130���150 ��m wide. Legs with hind trochanter + femur 150���185 ��m long; hind tibia + tarsus 150���190 ��m long; all tarsal digitules each 30���40 ��m long; claw digitules each 20���30 ��m long, claws each 24���32 ��m long. Spiracles normal: anterior peritremes each 60���80 ��m wide; posterior peritremes each 70���88 ��m wide. Spiracular pores (spp) each 4���5 ��m wide, typically with 5 loculi. Comments. Adult females of C. heckrothi can be distinguished from all the other species of Coccus known from Macaranga by having the combination of (i) anal plates each with 12���23 dorsal setae, each seta 18���25 ��m long; (ii) short, slender dorsal setae, each mostly 10���15 ��m long and tapering to apex; and (iii) marginal setae in a single row and with each seta sharply spinose, mostly 20���40 ��m long and rarely with apex fimbriate or bifurcate. The adult females of C. heckrothi are most similar to those of C. penangensis in the number of dorsal setae on each anal plate (11���23 in C. penangensis) and in having short and slender dorsal body setae (mostly C. penangensis), but differ in that the marginal setae of C. heckrothi mostly have sharply pointed apices (mostly bifurcate or fimbriate in C. penangensis) and the lateral stigmatic setae are mostly> 15 ��m (usually C. penangensis). Coccus heckrothi has been collected only on the northern half of Borneo in North Kalimantan, Sabah and Sarawak, at a range of altitudes. The three adult females from North Kalimantan and the two from Crocker Range in Sabah differ from the females collected in the area of Lambir Hills in having shorter (10���17 ��m) setae on the anal plates and, for two Kalimantan specimens, more numerous (20���40) preopercular pores. Coccus heckrothi has been found inside the hollow stems of seven Macaranga species belonging to both sections Pachystemon (three species) and Pruinosae (four species). Specimens of a species very similar to C. heckrothi were collected from Crypteronia?macrophylla (Crypteroniacae) in association with Cladomyrma ants in the Lambir Hills area (Achim Moog, #95/83, 23 Feb. 1995). The adult females of the coccids from Crypteronia differ from those of C. heckrothi in having longer (~ 25 ��m) and more slender setae on the anal plates, shorter (~ 20 ��m long) marginal setae, and smaller (~ 3 ��m diameter) and more numerous (>20) preopercular pores. Mealybugs (Pseudococcidae) and coccids have been reported associated with Cladomyrma ants in the hollowed-out stems of Crypteronia griffithii in Peninsular Malaysia (Maschwitz et al. 1991) but the identity of those coccids is unknown., Published as part of Gullan, Penny J., Kondo, Takumasa, Fiala, Brigitte & Quek, Swee-Peck, 2018, Taxonomy of coccids (Hemiptera: Coccidae: Coccus L.) associated with Crematogaster ants (Hymenoptera: Formicidae) in the stems of Macaranga plants (Euphorbiaceae) in Southeast Asia, pp. 1-51 in Zootaxa 4521 (1) on pages 18-20, DOI: 10.11646/zootaxa.4521.1.1, http://zenodo.org/record/3770241, {"references":["Quek, S. P., Ueda, S., Gullan, P. J., Kondo, T., Hattori, M., Itioka, T., Murase, K. & Itino, T. (2017) Nuclear-DNA-based species delineations of Coccus scale insects in symbiosis with plants and ants, and the role of plant epicuticular wax in structuring associations. Biological Journal of the Linnean Society, 120 (4), 818 - 835. https: // doi. org / 10.1111 / bij. 12917","Heckroth, H. - P., Fiala, B., Gullan, P. J., Idris, A. H. & Maschwitz, U. (1998) The soft scale (Coccidae) associates of Malaysian ant-plants. Journal of Tropical Ecology, 14, 427 - 443. https: // doi. org / 10.1017 / S 0266467498000327","Heckroth, H. - P., Fiala, B. & Maschwitz, U. (2001) Integration of scale insects (Hemiptera: Coccidae) in the South-East Asian ant-plant (Crematogaster (Formicidae) - Macaranga (Euphorbiaceae )) system. Entomologica, 33 (1999), 287 - 295."]}

Key to adult females of Coccus species associated with Macaranga (Note: this key may be difficult to use unless the specimens are cleared thoroughly of body contents and their cuticle is well stained) 1. Dorsal setae (excluding marginal row) appearing absent but present and very short, most setae less than 2 times as long as width of setal socket, rarely setae near body margin up to 3 times as long as setal socket width, never as long as ventral setae..................................................................................................... 2 - Dorsal setae clearly evident, most setae more than 3 times as long as setal socket width, as long or longer than most ventral setae, but may be shorter than long interantennal and pregenital setae............................................ 5 2. Marginal setae mostly fimbriate at apices. Anal plates with dorsal setae usually confined to posterior half of each plate........................................................................................ caviramicolus Morrison - Marginal setae mostly tapering to a point, apices rarely bifurcate or fimbriate (except on some individuals of C. tumuliferus). Anal plates with dorsal setae usually present on posterior two-thirds of each plate................................... 3 3. Legs reduced, each smaller than mouthparts, hind trochanter + femur secretus Morrison - Legs well developed, each much larger than mouthparts, hind trochanter + femur> 130 µm long. Dorsum covered with oval or circular dermal elevations (Fig. 11), sometimes difficult to see on slide-mounted specimens. Anal plate setae tapered, even if robust, and 8–23 µm long. Antennae 7, rarely 6, segmented.................................................... 4 4. Dorsal submarginal raised areas (humps) very rounded, almost always numbering 8 on each side of body plus 1 medially on head. Stigmatic clefts often each with just 1 long robust seta (≤ 25 µm long, frequently damaged or missing), sometimes 2 lateral setae (each 3–8 µm long), rarely 3 subequal very short setae (≤ 5 µm long). Apical antennal segment with a short (2–8 µm) or often no apical prolongation.......................................................... tumuliferus Morrison - Dorsal submarginal raised areas oval or elongate, usually numbering 11, rarely 12, on each side of body plus 1 medially on head. Stigmatic clefts each usually with 3 setae of subequal length (mostly 7–18 µm long, often damaged or missing). Apical antennal segment with an apical prolongation almost always ≥ 10 µm long on at least 1 antenna............................................................................................ pseudotumuliferus Gullan & Kondo sp. n. 5. Dorsal setae knobbed, or with rounded apices, not tapering to a point. Marginal setae sharply spinose, apices never bifurcate or fimbriate. Hind trochanter + femur macarangicolus Takahashi - Dorsal setae with apices not knobbed or rounded, each tapering to a point. Marginal setae spinose, with apices either tapering to a point, bifurcate or fimbriate. Hind trochanter + femur> 100 µm long.......................................... 6 6. Marginal setae in 2 rows, numerous, with 41–45 between stigmatic areas on each side of thorax, each seta sharply spinose with slightly bent tip. Dorsal setae long and flagellate, each 35–90 µm long................. lambirensis Gullan & Kondo sp. n. - Marginal setae in 1 row, not numerous, with 7. Anal plates each with 11–23 dorsal setae................................................................... 8 - Anal plates each with 3–11 (very rarely>9 and mostly 8. Marginal setae mostly sharply spinose, occasionally with slight ‘twigging’ at apices. Lateral stigmatic setae each usually> 15 µm long................................................................... heckrothi Gullan & Kondo sp. n. - Marginal setae with apices mostly bifurcate or fimbriate, rarely sharply spinose. Lateral stigmatic setae each usually penangensis Morrison 9. Dorsal setae rather abundant, sharply spinose, mostly with straight or bent apices, occasionally a few setae with apices bifurcate or fimbriate, each seta 15–40 µm long. Preopercular pores 5–11 µm wide, each generally larger than a pregenital disc-pore................................................................................... macarangae Morrison - Dorsal setae rather sparse, slender, with a flagellate apex, each 15–30 µm long. Preopercular pores usually ≤ 6 µm wide, each about same size as a pregenital disc-pore.................................................... circularis Morrison

Coccus macarangicolus Takahashi urn:lsid:zoobank.org:act: 9873F7EA-9473-4B56-B276-4B26D519309F (Fig. 9) Coccus macarangicolus Takahashi, 1952: 14. Type material examined. Lectotype (here designated): adult female, PENINSULAR MALAYSIA: Kuala Lumpur, ex Macaranga, 26 Mar. 1944, coll. R. Takahashi, BMNH 1955-812, 1(1) (BMNH). Originally, this slide was deposited in the Selangor Museum, Kuala Lumpur, Malaysia, but after the loss of that institution, the remaining insect collections were sent to the BMNH in 1955, as documented by Williams (2017). Takahashi did not specify how many slides were prepared, but his description appears to have been based on a single adult female, which almost certainly is the one now in the BMNH. We believe that no other syntypes of C. macarangicolus exist. We have checked for other Takahashi specimens of this species in the Department of Agriculture Malaysia in Kuala Lumpur, where some of Takahashi's mealybug specimens are deposited (Sartiami et al. 2017), as well as in the Forest Research Institute Malaysia in Kuala Lumpur and in digital databases at the Taiwan Agriculture Research Institute in Taiwan and the University of Hokkaido in Japan. The envelope of the BMNH syntype has a handwritten note: ���Probably young of C. macarangae Morr. ���; TK determined this specimen to be an adult female as it has multilocular pores near the vulva. Other material examined. PENINSULAR MALAYSIA: Selangor, Ulu Gombak, ex durian, 11 May 1944, coll. R. Takahashi, BMNH 1955-812, 1(19) (BMNH). Even though this slide as a small circular BMNH label with the word " Type ", the specimens are not part of the type series because they were not mentioned in Takahashi's original description. Coccus near macarangicolus: BORNEO: West Kalimantan, Siduk to Nanga Tayap, low elevation, ex Macaranga velutiniflora, 21 June 2002, coll. S.-P. Quek, SPQ.392, DNA voucher 1(1); Sarawak, 8 km Lambir, ex M. havilandii, Dec. 1992, coll. H.-P. Heckroth, #170, 2(2). Note. The original description (Takahashi 1952: 15) refers to ��� Kuala Lumpur, a few specimens, in hollow of the stems of Macaranga triloba (26.III.1944). Associated with Crematogaster inhabiting the host plant.��� The correct identity of the host should be M. bancana (refer to M&M). One slide from the BMNH has specimens, which were collected by Takahashi from durian (Durio sp., Malvaceae), that were determined to belong to C. macarangicolus by TK and PJG. The latter specimens are not mentioned by Takahashi (1952). There are no recent collections of this species from near the type locality of Kuala Lumpur. Specimens identified as C. near macarangicolus are all from Borneo and they are discussed below under ���Comments���. The description of the adult female is here based on the one available Takahashi specimen, which is designated here as the lectotype. Unmounted material. ���Yellow in life. Circular, a little convex dorsally, but oval and distinctly longer than wide when mounted on slides.��� (Takahashi 1952: 14). Slide-mounted adult female (n=1; Fig. 9). Body elongate oval, 1.8 mm long, 1.4 mm wide. Dorsum. Derm (dd) membranous, areolated, with lightly sclerotised irregular submarginal lines radiating inwards at right angles to margin. Dorsal setae (dset) slender, each 7���10 ��m long, with apex rounded to slightly knobbed, scattered on dorsum. Simple pores (sp) each 2.0��� 2.5 ��m wide, scattered evenly on dorsum. Preopercular pores (pop) each 5���8 ��m wide, 30 in total number, present in a longitudinal line anterior to anal plates. Dorsal microducts (dmic) in areolations each about 2 ��m wide, appearing bilocular under high magnification. Anal plates (anplt) each triangular, anterolateral margin 1.1 times longer than posterolateral margin and posterolateral margin slightly convex, length of each plate 1.3 times width, inner lobes normal, with a tessellated texture, each plate 130 ��m long, 78 ��m wide, anterolateral margin 100 ��m long, posterolateral margin 88 ��m long; each plate with 4���5 dorsal setae, each seta up to 20 ��m long. Anal ring (ar) probably bearing 10 setae [Takahashi (1952: 15) said "6 stout setae" but he probably only saw the 3 pairs of robust setae], each 80���95 ��m long. Margin. Eyespots not detected. Marginal setae (mset) sharply spinose, present in 1 row, each seta 10���18 ��m long, with 12���14 setae between anterior and posterior stigmatic areas on each side of body. Stigmatic setae (stgset) well developed, sharply spinose with pointed to rounded apices, numbering 3 (rarely 4), median setae longest, each 27���30 ��m long, lateral setae each 12���18 ��m long. Venter. Derm membranous. Ventral setae (vset) slender, with some medial to submedial abdominal setae longest, each 17���38 ��m long, elsewhere shorter, each 7���18 ��m long. Interantennal setae in 2 pairs, each seta up to 18 ��m long. Ventral tubular ducts (vtd) present in a broad submarginal band; each duct with outer ductule 15���18 ��m long, inner ductule up 18 ��m long, and duct opening about 2 ��m wide. Ventral microducts (vmic) each about 2 ��m wide, scattered fairly evenly on venter. Pregenital disc-pores (pgp) each with 8���10 loculi, each pore 6���7 ��m wide. Antennae (ant) 7 segmented, each ~ 200 ��m long; fleshy setae present on last 3 segments. Clypeolabral shield ~ 210 ��m long and ~ 208 ��m wide; labium not measured. Legs with hind trochanter + femur 87���95 ��m long; hind tibia + tarsus 92���115 ��m long; all tarsal digitules each 25���27 ��m long; claw digitules each 12���15 ��m long, claws each ~ 18 ��m long. Spiracles normal: anterior peritremes each 50���58 ��m wide; posterior peritremes each 62���68 ��m wide. Spiracular pores (spp) each 5���6 ��m wide, with 4���7 loculi. Comments. Adult females of C. macarangicolus can be distinguished from all other species of Coccus known from Macaranga by the presence of short (7���10 ��m) dorsal setae each with a rounded or knobbed apex. The adult females of C. macarangicolus are most similar to the adult females of C. circularis and C. macarangae in having fewer than 8 setae on each anal plate and having the marginal setae in a single row, but differ in that the marginal setae of C. macarangicolus never have fimbriate apices. Adult females identified as C. near macarangicolus are from Borneo (lowland, near coastal localities in Sarawak and West Kalimantan) and we consider them to represent disjunct populations of C. macarangicolus. One of the latter females is DNA voucher specimen SPQ.392 that was placed as sister to the holotype of C. lambirensis in figure 3 of Quek et al. (2017), but the two specimens are quite distinct morphologically. The Bornean specimens of C. near macarangicolus are very similar to the lectotype of C. macarangicolus but differ in having fewer (4���8) preopercular pores that are of two sizes (5���6 ��m and 2.5���3.0 ��m). Given the very few specimens of C. macarangicolus available to allow study of variation, we have restricted the redescription to Takahashi's type specimen. Heckroth et al. (1998, table 2) listed C. macarangicolus almost entirely from secondary forest in Borneo and Peninsular Malaysia, although there were very few records of it and we have not seen any of the specimens that Heckroth identified as this species., Published as part of Gullan, Penny J., Kondo, Takumasa, Fiala, Brigitte & Quek, Swee-Peck, 2018, Taxonomy of coccids (Hemiptera: Coccidae: Coccus L.) associated with Crematogaster ants (Hymenoptera: Formicidae) in the stems of Macaranga plants (Euphorbiaceae) in Southeast Asia, pp. 1-51 in Zootaxa 4521 (1) on pages 25-30, DOI: 10.11646/zootaxa.4521.1.1, http://zenodo.org/record/3770241, {"references":["Takahashi, R. (1952) Some species of nondiaspine scale insects from the Malay Peninsula. Insecta Matsumurana, 18, 9 - 17.","Williams, D. J. (2017) The change of depository of a collection of scale insects by Ryoichi Takahashi (Hemiptera: Sternorrhyncha: Coccomorpha). Zootaxa, 4358 (3), 598 - 600. https: // doi. org / 10.11646 / zootaxa. 4358.3.13","Sartiami, D., Watson, G. W., Mohamad Roff, M. N. & Idriss, A. B. (2017) A taxonomic update of Takahashi's historic collection of mealybugs (Hemiptera: Pseudococcidae) from Malaysia and Singapore. Serangga, 22 (2), 91 - 114.","Quek, S. P., Ueda, S., Gullan, P. J., Kondo, T., Hattori, M., Itioka, T., Murase, K. & Itino, T. (2017) Nuclear-DNA-based species delineations of Coccus scale insects in symbiosis with plants and ants, and the role of plant epicuticular wax in structuring associations. Biological Journal of the Linnean Society, 120 (4), 818 - 835. https: // doi. org / 10.1111 / bij. 12917","Heckroth, H. - P., Fiala, B., Gullan, P. J., Idris, A. H. & Maschwitz, U. (1998) The soft scale (Coccidae) associates of Malaysian ant-plants. Journal of Tropical Ecology, 14, 427 - 443. https: // doi. org / 10.1017 / S 0266467498000327"]}

Coccus macarangae Morrison urn:lsid:zoobank.org:act: 30644D80-511B-4645-9BB3-FBFD0D4AC770 (Figs 2A & B, 7, 8) Coccus macarangae Morrison, 1921: 663. Type material examined. Holotype: adult female, PENINSULAR MALAYSIA: Selandar forest, in hollow stem of Macaranga, date not given, coll. I.H. Burkill, Holotype 1(1) (USNM). Paratypes: same data as holotype, 1(6 first-instar nymphs) (USNM). Examined non-type material from original collection. PENINSULAR MALAYSIA: Selandar forest, in hollow stem of Macaranga triloba [now correctly named M. bancana], date not given, coll. I.H. Burkill, 5-a or 6, two slides also with "1319" in pencil, 3(10) (BMNH). These three BMNH slides have similar data to the type collection listed above and one slide has the same Burkill collection number as provided by Morrison (1921) in his original description of this species, but they are not type specimens, as explained in the Materials and methods. Other material examined: BORNEO: Brunei, Batu Apoi Forest Reserve, 4�� 33' N, 115�� 09' E, ex M. beccariana, M. trachyphylla & Macaranga sp., 3���30 Aug. & 1 Sept. 1995, coll. P.J. Gullan, PJG-B7: 12(8 adult females, 3 third-instar females & 8 first-instar nymphs), PJG-B10: 8(4 adult females, 1 pharate adult female, 1 third-instar female & 14 first-instar nymphs), PJG-B14: 4(4), PJG-B15: 5(5), PJG-B16: 9(9), PJG-B21: 8(8), PJG- B22: 2(2 adult females & 1 third-instar female on slide with C. pseudotumuliferus), PJG-B23: 1(1) (coll. P.S. Cranston), PJG-B25: 2(2), PJG-B29: 7(7), PJG-B46: 2(1 adult female & 1 third-instar female), PJG-B47: 7(3 adult females, 3 third-instar females & 1 third-instar female pharate in second-instar cuticle), PJG-B50: 1(1), PJG-B52: 3(2 adult females & 4 first-instar nymphs), PJG-B55: 1(1), PJG-B56: 1(1), PJG-B58: 4(3 adult females & 1 thirdinstar female) & PJG-B70: 3(3); Sabah, Crocker Range, Keningau to Ulu Kimanis trail, ~ 5.28�� N, ~ 116.05�� E, 1100 m, ex M. angulata, 19 Oct. 1999, coll. S.-P. Quek, SPQ.133, DNA voucher 1(1); Sabah, Crocker Range, near Majora, ~ 500 m, ex M. indistincta, 16 Oct. 1999, coll. S.-P. Quek, SPQ.108a, DNA voucher 1(1); Sabah, Crocker Range, Tambunan to Kota Kinabalu Rd, Rafflesia Reserve, 1200 m, M. angulata, 15 Oct. 1999, coll. S.-P. Quek, S.-P. Quek, SPQ.099, DNA voucher 1(1); Sabah, Crocker Range, forest behind Tambunan, 600 m, M. indistincta, 18 Oct. 1999, coll. S.-P. Quek, S.-P. Quek, SPQ.123, DNA voucher 1(1); Sabah, Crocker Range, Tambunan to Trusmadi trail, 1200 m, M. angulata, 23 Oct. 1999, coll. S.-P. Quek, S.-P. Quek, SPQ.156, DNA voucher 1(1); Sabah, Crocker Range, ex M. hullettii, 13 Apr. 2001, coll. B. Fiala, #13 (TK0017), DNA voucher 1(1); Sabah, Luasong, ex M. winkleri, 4 Sept. 2003, coll. B. Fiala, #96, 5(5) (2 ANIC, 3 FRIM); Sabah, Ranau, Langanan [waterfall], ex M. depressa [now correctly named M. angulata], Feb. 1992, coll. B. Fiala, #23a, 2(2); Sabah, Penangpang [=Penampang), roadside, ex M. bancana, 28 Mar. 2002, coll. B. Fiala, #135 (TK0095), DNA voucher 1(1); Sabah, Poring, ex M. angulata, 25 Mar. 2002, coll. B. Fiala, #110 (TK0100), DNA voucher 1(1); Sabah, Poring, ex M. winkleri, 18 Apr. 2001, coll. B. Fiala, #161 (TK0045), DNA voucher 1(1); Sabah, Poring, ex M.? indistincta, 20 Feb. 1992, B. Fiala, #32a, 2(1 adult female & 1 third-instar female); Sabah, Tawau, road to Madai Caves, ex M. motleyana, 11 Mar. 2002, coll. B. Fiala, #4 (TK0108) & #5 (TK0107), DNA vouchers 2(2); Sabah, Tawau Hills, ex M. kingii [now identified as M. lamellata] & M. winkleri, 4 & 7 Apr. 2001, coll. B. Fiala, #62 (TK0024) & #96 (TK0032), DNA vouchers 2(2); Sarawak, Lambir, ex M. near kingii [now identified as M. lamellata], 14 Feb. 1992, B. Fiala, #37a, 2(2) (1 ANIC, 1 FRIM); Sarawak, Lambir, ex M. beccariana, Feb. 1992, coll. B. Fiala, #51a, 2(2); Sarawak, Lambir, ex M. hullettii, 26 Feb. 1992, coll. B. Fiala, #70a, 3(3); Sarawak, Lambir, ex M. hypoleuca, Feb. 1992, coll. B. Fiala, #71a, 3(3); Sarawak, 8 km Lambir NP, ex M. lamellata, Dec. 1992, coll. H.-P. Heckroth, #109, 2(2); Sarawak, Miri, Lambir Nat. Park, ~ 400 m, ex Macaranga sp. [now identified as M. lamellata], 27 Sept 1993, coll. A. Moog, #93/172, 3(3). PENINSULAR MALAYSIA: Fraser's Hill, ex M. hosei & M. hullettii, Mar. 1993, coll. H.-P. Heckroth, #274, #281 & #289, 6(6) (4 ANIC, 2 FRIM: #281); Pasoh, ex M. hosei, Mar. 1992, coll. B. Fiala, #132a & #168a, 3(3); Pasoh, ex M. hypoleuca, 6 Feb. 1992 & Mar. 1992, coll. B. Fiala, #105a: 4(1 adult female & 3 third-instar females) & #193a: 1(1). SUMATRA: Sibolangit, ~ 3�� 40' N, ~ 98�� 20' E, ex M. bancana, 23 Oct. 1992, coll. U. Maschwitz, sent by B. Fiala, #7a, 2(2). Material examined from non- Macaranga host plants: BORNEO: Sabah, Ranau, Poring Hot Springs, ~ 700 m, in domatium of Myrmeconauclea sp. (Rubiaceae), 24 Mar. 1995, coll. A. Moog, #95/149, 1(1). PENINSULAR MALAYSIA: Selangor, Ulu Gombak, ex hollow stem of Ryparosa fasciculata (Achariaceae) in association with Cladomyrma?petalae, 20 Sept. 1993, coll. A. Moog, #93/161, 4(4); Selangor, Ulu Gombak, ex hollow stem of Strychnos vanprukii (Loganiaceae) in association with C.?petalae, 7 Mar. 1993, coll. A. Moog, #93/111, 2(2); Selangor, Ulu Gombak, in Lepisanthus tetraphylla (Sapindaceae) in association with Crematogaster ants, 28 Mar. 1994, coll. G. Riedel, #94-125.2, 1(1); Selangor, Ulu Gombak, in Saraca thaipingensis (Fabaceae) in association with Crematogaster ants, 25 Apr. 1994, coll. G. Riedel, #94-160.2, 3(3). Adult female. Unmounted material. ���Short oval, pale reddish brown, darker in middle, flat, with faint radiating ridges near margin; dorsal surface appearing naked, possibly with a very thin film of secretion;..��� (Morrison 1921: 663). Morrison���s description of probably dried adult females from Singapore agrees fairly well with live specimens photographed in Borneo (Fig. 2A & B). Adult females from M. winkleri in Sabah (Fig. 2A) were orange-brown with some whitish waxy dorsal secretion and ridges radiating inwards from the margin. The amount of dorsal waxy secretion appears to increase as females age but the body margin remains largely devoid of wax, as shown by a mature female from M. beccariana in Brunei (Fig. 2B). Slide-mounted adult female (n=18, including holotype and 4 of Burkill's specimens from Selandar forest; Fig. 7). Body oval to elongate oval, body often truncated anteriorly on head, 2.0��� 4.4 mm long, 1.3���3.1 mm wide. Dorsum. Derm (dd) membranous, areolated and with faint submarginal wrinkle lines radiating inwards at right angles to margin. Dorsal setae (dset) mostly sharply spinose, occasionally with a few setae with open divided apices, each 15���40 (mostly 25���35) ��m long, scattered on dorsum. Simple pores (sp) each 2.0��� 2.5 ��m wide, scattered evenly on dorsum. Preopercular pores (pop) each 5���11 ��m wide, present in a group of 20���50 anterior to anal plates. Dorsal microducts (dmic) in areolations each about 2���3 ��m wide, appearing bilocular under high magnification. Anal plates (anplt) each triangular, anterolateral margin subequal to posterolateral margin (ratio 0.9���1.2) and posterolateral or both margins usually slightly convex, length of each plate 1.4���1.9 times width, inner lobes swollen, with a tessellated texture, each plate 130���145 ��m long, 80���103 ��m wide, anterolateral margin 85��� 120 ��m long, postero-lateral margin 85���115 ��m long; each plate with 3���4 dorsal setae, each 20���40 mm long. Anal ring (ar) bearing 10 setae [Morrison (1921: 664) said apparently 8 setae, but these setae are difficult to see], each 100���135 ��m long. Margin. Eyespots present slightly removed from dorsal margin, each 17���23 ��m in maximum dimension, often not detected or hard to detect. Marginal setae (mset) fimbriate to sharply spinose, present in 1 row, each seta 10���30 ��m long, with 7���30 (mostly 12���24) setae between anterior and posterior stigmatic areas on each side of body. Stigmatic setae (stgset) well developed, numbering 3, lanceolate to tapered spinose with rounded apices, much thicker than marginal setae, bases often swollen, median setae longest, each 18���43 ��m long, lateral setae each 7���25 (mostly 12���20) ��m long. Venter. Derm membranous. Ventral setae (vset) slender, with most posterior prevulvar pair longest (each seta 50���70 ��m long), elsewhere shorter, each 7���35 ��m long. Interantennal setae numbering 2 pairs, each seta ��� 20 ��m long. Ventral tubular ducts (vtd) present in a broad submarginal band; each duct with outer ductule 16���19 ��m long, inner ductule 13���20 ��m long, and duct opening about 2 ��m wide. Ventral microducts (vmic) each about 2 ��m wide, scattered fairly evenly on venter. Pregenital disc-pores (pgp) each with 5���10 (mostly 7 and 8) loculi, and each pore 6���7 ��m wide. Antennae (ant) 7���8 (mostly 8) segmented, each 200���275 ��m long; fleshy setae present on last 3 segments. Clypeolabral shield 240���290 ��m long, 180���230 ��m wide; labium 80���100 ��m long, 135���155 ��m wide. Legs with hind trochanter + femur 113���145 ��m long; hind tibia + tarsus 120���163 ��m long; all tarsal digitules each 25���37 ��m long; claw digitules each 17���25 ��m long, claws each 20���25 ��m long. Spiracles normal: anterior peritremes each 60���93 ��m wide; posterior peritremes each 65���100 ��m wide. Spiracular pores (spp) each 4���5 ��m wide, with 3���5 (mostly 5) loculi, with an occasional pore with 6 or more loculi. Comments. Adult females of C. macarangae can be distinguished from all other species of Coccus known from Macaranga by having the combination of (i) sharply spinose dorsal setae each mostly 25���30 ��m long but a few can be up to 40 ��m long; (ii) marginal setae in a single row, with each seta 10���30 ��m long with apex fimbriate to sharply spinose; and (iii) anal plates each with 3 or 4 setae, each mostly 20���30 (rarely up to 40) ��m long. Adult females of C. macarangae are most similar to the adult females of C. circularis in having fewer than 10 setae on each anal plate and many marginal setae that are apically fimbriate or bifurcate, but differ from C. circularis in that the dorsal setae are sparser, generally longer (up to 40 ��m long) and less slender and the preopercular pores are more numerous (20���50) and usually larger (5���11 ��m wide) in C. macarangae (dorsal setae 15���30 ��m long with flagellate apices and preopercular pores scarce (���10) and 5���6 ��m wide in C. circularis). Coccus macarangae was poorly represented in the molecular phylogeny of Quek et al. (2017), although it appears to be a common and widespread species that is found inside the hollow stems of Macaranga species belonging to each of the three myrmecophytic sections of the genus. It also occurs in the hollow stems of several other myrmecophytic genera, namely Lepisanthus, Myrmeconauclea, Ryparosa, Saraca and Strychnos, each belonging to a different plant family (refer to 'Material examined' list above). Adult female coccids from these different hosts showed no consistent differences from females collected from the hollow stems of Macaranga. Morphological variation in the number and size of the preopercular pores was noted among Macaranga -associated adult females of C. macarangae. The length of the dorsal setae also sometimes varied, with a few females having slightly shorter (15���20 ��m) and others slightly longer (often 30���40 ��m) setae than the typical length of 25���30 ��m. One female from Tawau Hills in Sabah collected from M. winkleri (DNA voucher TK0032, coll. B. Fiala, #96) is unusual in having 6-segmented antennae and few pregenital disc pores near the vulva but was confirmed as C. macarangae based on 12S sequences (T. Kondo & L.G. Cook, unpublished data). First-instar nymph. Slide-mounted material (n=10, all from Brunei, Borneo; Fig. 8). Body oval to elongate oval, body often truncated anteriorly on head, 370���460 ��m long, 205���280 ��m wide. Dorsum. Derm membranous. Dorsal setae (dset) extremely difficult to see and appearing absent except under x100 objective under oil; each seta very short, at most 1 ��m long, in perhaps 4 pairs submedially on thorax and first abdominal segment. One pair of minute simple pores (sp) present on head, but difficult to see except with x100 objective under oil. Preopercular pores and dorsal microducts absent. Anal plates each elongate triangular, 42���58 ��m long, 20���33 ��m wide, anterolateral margin 25���40 ��m long, posterolateral margin 27���40 ��m long; each plate with 2 dorsal setae each 10���12 ��m long, positioned one each side of long apical seta, 110���124 ��m long, plus 1 short inner margin seta. Anal ring (ar) 17���20 ��m wide, bearing 6 setae, each 48���62 ��m long. Margin. Eyespots present as pigmented spots on margin, each 9���12 ��m in maximum dimension. Marginal setae (mset) flagellate and with distinct bend at about half-length, each seta 10���15 ��m long, present in 1 row, with always 2 setae between anterior and posterior stigmatic areas on each side of body, 12 (rarely 13) on head between anterior stigmatic areas and 8 on each side of abdomen with most posterior seta always straight. Stigmatic setae (stgset) numbering 3 in each cleft, thicker than marginal setae, median seta longest, 13���20 ��m long, and spinose with rounded apex, lateral setae very small and rounded at apices, each 2���5 ��m long. Venter. Derm membranous. Ventral setae (vcs) as follows: short setae, each 2���3 ��m long, present in a marginal and a submarginal longitudinal row of 7 setae on each side of abdomen, with 3 pairs of longer setae (called prevulvar setae on adult female), each 20���35 ��m, submedially on posterior abdominal segments; a few setae similar to those on margin of abdomen present marginally on each side of mesothorax and metathorax; 1 pair of ventral cephalic setae (vcs), each 2���4 ��m long, situated near apex of head; 1 pair of interantennal setae, each about 30 ��m long, between bases of antennae. Ventral tubular ducts absent. Ventral microducts (vmic) each about ~ 1 ��m ��m wide, very few, present submarginally around body, between each pair of setae on abdomen, 2 located submarginally between anterior and posterior stigmatic areas, and 1 present between base of antenna and body margin, on each side. Abdominal disc-pores absent. Antennae 6 segmented, each 95���112 ��m long; fleshy setae present on last 3 segments. Clypeolabral shield 65���90 ��m long; labium 25���30 ��m long, with 2 pairs of apical setae. Legs normal; hind trochanter + femur 50���62 ��m long; hind tibia + tarsus 53���65 ��m long; tarsal digitules each 15��� 27 ��m long, one of each pair slightly thicker than other, each with a small knobbed apex; claw digitules each 10���14 ��m long, both knobbed, one thicker than other; claws each 10���14 ��m long, with small denticle present (only easily visible with x100 objective). Spiracles normal: peritremes each 4���6 ��m wide. Spiracular pores (spp) each ~ 2 ��m wide, with 4 loculi; spiracular furrows each with 3 or 4 pores in a line., Published as part of Gullan, Penny J., Kondo, Takumasa, Fiala, Brigitte & Quek, Swee-Peck, 2018, Taxonomy of coccids (Hemiptera: Coccidae: Coccus L.) associated with Crematogaster ants (Hymenoptera: Formicidae) in the stems of Macaranga plants (Euphorbiaceae) in Southeast Asia, pp. 1-51 in Zootaxa 4521 (1) on pages 22-25, DOI: 10.11646/zootaxa.4521.1.1, http://zenodo.org/record/3770241, {"references":["Morrison, H. (1921) Some nondiaspine Coccidae from the Malay Peninsula, with descriptions of apparently new species. The Philippine Journal of Science, 18, 637 - 677.","Quek, S. P., Ueda, S., Gullan, P. J., Kondo, T., Hattori, M., Itioka, T., Murase, K. & Itino, T. (2017) Nuclear-DNA-based species delineations of Coccus scale insects in symbiosis with plants and ants, and the role of plant epicuticular wax in structuring associations. Biological Journal of the Linnean Society, 120 (4), 818 - 835. https: // doi. org / 10.1111 / bij. 12917"]}

Coccus Linnaeus urn:lsid:zoobank.org:act: D7AFF012-1B2A-4F9B-BA23-795DCC253C10 Coccus Linnaeus, 1758: 455. Type species: Coccus hesperidum L. Lecanium Burmeister, 1835: 69. Unavailable name. Taiwansaissetia Tao, Wong & Chang, 1983: 77; synonymy by Lin et al. 2013: 259. A full synonymy for Coccus is available from ScaleNet (Garc��a Morales et al. 2017). Adult females of all Coccus species from Macaranga share the features of areolations on the dorsal derm, a cluster of preopercular pores anterior to the anal plates, a broad submarginal band of a ventral tubular ducts, and pregenital disc-pores confined to the area lateral to the vulva. Prior to molecular phylogenetic studies, we considered erecting a new genus for these Macaranga -associated coccids but, as discussed in the Introduction above, their close genetic relationship to C. hesperidum (the type species of Coccus) made this action untenable, despite the morphological distinctness of the Macaranga coccid species from C. hesperidum. For example, adult females of C. hesperidum lack ventral tubular ducts in the submarginal area of the body (prominent in the Macaranga coccids) and possess dorsal tubercles (lacking in the Macaranga -associated species)., Published as part of Gullan, Penny J., Kondo, Takumasa, Fiala, Brigitte & Quek, Swee-Peck, 2018, Taxonomy of coccids (Hemiptera: Coccidae: Coccus L.) associated with Crematogaster ants (Hymenoptera: Formicidae) in the stems of Macaranga plants (Euphorbiaceae) in Southeast Asia, pp. 1-51 in Zootaxa 4521 (1) on page 8, DOI: 10.11646/zootaxa.4521.1.1, http://zenodo.org/record/3770241, {"references":["Lin, Y. - P., Kondo, T., Gullan, P. & Cook, L. G. (2013) Delimiting genera of scale insects: molecular and morphological evidence for synonymising Taiwansaissetia Tao, Wong and Chang with Coccus Linnaeus (Hemiptera: Coccoidea: Coccidae). Systematic Entomology, 38, 249 - 264. https: // doi. org / 10.1111 / j. 1365 - 3113.2012.00664. x","Garcia Morales, M., Denno, B., Miller, D. R., Miller, G. L., Ben-Dov, Y. & Hardy, N. B. (2017) ScaleNet: a literature-based model of scale insect biology and systematics. Available from: https: // scalenet. info (accessed 10 June 2017)"]}

Coccus tumuliferus Morrison urn:lsid:zoobank.org:act: 537C7FF2-8E3B-423A-ADE9-96E5AD7DD249 (Figs 11D, 14) Coccus tumuliferus Morrison, 1921: 655. Coccus tumulifer Lindinger, 1932f: 197. Unjustified emendation; discovered by Williams & Ben-Dov, 2009: 46. Type material examined. Holotype: adult female, SINGAPORE: on Macaranga hypotema [sic, see below], E.E. Green letter dated 8.vi.1916, coll. I.H. Burkill, 1(2, holotype clearly marked and 1 paratype adult female) (USNM). Paratypes: same data as holotype but two slides specify "in hollow stems of M. hypotema ", 4(4 adult females, including 1 on slide with holotype, + 2 slides with a number of first-instar nymphs) (USNM; the 1 slide with 3 paratype females not seen). Morrison's original description refers to five adult females and several mounted "larvae", and this accords with the slides listed above, all of which have Morrison type labels on both the slides and their envelopes. However there is another USNM slide of this species which appears to have been prepared and labelled by Green from original Burkill material as its label starts: "Ctenochiton / tumuliferum / Green, ms. / Part of type / material.)" (details listed immediately below), but these specimens are not mentioned by Morrison in the original description of this species. Examined non-type material from original collection. SINGAPORE: in hollow stems of Macaranga hypotema [sic], coll. I.H. Burkill, 1(2 adult females + 1 third-instar female) (USNM; slide labelled by Green and discussed above); in hollow stems of Macaranga hypoleuca, attended by ants, coll. I.H. Burkill, 2(2) (BMNH). The BMNH also has another 10 slides, with a total of 29 adult females and nymphs, of this Singapore collection from Burkill; PJG examined these slides in 1994 and made notes but did not take measurements. All of these BMNH slides have similar data to the type collection listed above, but they are not type specimens, as explained in the Materials and methods. Note. The USNM type slides give the host plant as M. hypotema and Morrison (1921) listed the host as M. hypolema, but there is no such species. The BMNH slides give the host as M. hypoleuca, which is a member of the Pachystemon section of Macaranga (Davies et al. 2001). Other material examined. BORNEO: Sarawak, Santubong, ex M. hypoleuca, Dec. 1994, coll. H.-P. Heckroth, 445, 447, 450, 451 & 453, 5(14 + 1 adult female of C. macarangae) (2 slides ANIC, 3 slides FRIM). PENINSULAR MALAYSIA: Fraser���s Hill, ex M. hypoleuca, Mar. 1993, coll. H.-P. Heckroth, #284, 3(3); Gombak, lower logging road, ex M. hosei, Feb. 1992, coll. H.-P. Heckroth, #230, 2(2; 1 female taken from the mandibles of an ant); Johor, Kota Tinggi to falls, lowland, ex M. hypoleuca, 5 Sept. 1999, coll. S.-P. Quek, SPQ.018, DNA voucher 1(1); Johor, Mawai camp, Ginger Hill, ~ 1.871 N, ~ 103.954 E, M. hypoleuca, 7 Sept. 1999, coll. S.-P. Quek, SPQ.027, SQP.030 & SPQ.032, DNA vouchers 3(2 adult females + 1 immature female); Johor, Sedili, 14 km from Route 3, M. hypoleuca, 5 Dec. 1999, coll. S.-P. Quek, SPQ.182, DNA voucher 1(1); Pahang, near Kuantan on road to Pancing Falls, M. hypoleuca, 15 Sept. 1999, coll. S.-P. Quek, SPQ.054, DNA voucher 1(1); Pahang, Kuantan to Johor Road, 299 km to Johor, lowland, ex M. pruinosa, 16 Sept. 1999, coll. S.-P. Quek, SPQ.062, SPQ.063a & SPQ.064, DNA vouchers 3(3); Pahang, Kuantan to Johor Road, 299 km to Johor, M. hypoleuca, 16 Sept. 1999, coll. S.-P. Quek, SPQ.066 & SPQ.067, DNA vouchers 2(2); Terengganu, Bauk Hill, M. hypoleuca, 12 Sept 1999, S.-P. Quek, SPQ.038, DNA voucher 1(1). SINGAPORE: Old Upper Thompson Road, ~ 1.381 N, ~ 103.813 E, M. hypoleuca, 4 Oct. 1999, coll. S.-P. Quek, SPQ.090, DNA voucher 1(1). Adult female. Unmounted material. ���.. rarely broad oval, but usually broadened behind and triangular with angles rounded; plane of dorsal surface flat, but in dried specimens covered with relatively large knobs having a fairly definite arrangement of a median longitudinal single row and on each side of this two other rows, the outer one forming a continuous row around the body at the margin; dorsally covered with a thin, brittle, whitish but more or less translucent, glassy secretion, very easily broken and usually more or less wanting, molded into elevations and depressions corresponding to those of the body, this covering normally wanting over the flattened extreme margin of the body; body color dull brown, of secretionary covering, as stated, translucent whitish;.. (Morrison 1921: 655). For the present revision, the available adult females preserved in ethanol were pinkish red in colour (Fig. 11D). Although Morrison recorded the body of dry adult females as dull brown, but this is unlikely to reflect the colour in life. Slide-mounted adult female (n=16, including holotype and paratypes; specimens from Santubong in Sarawak excluded; Fig. 14). Body oval to broadly oval, 1.5���2.8 mm long, 1.2���2.4 mm wide, widest in posterior half. Dorsum. Derm (dd) completely membranous, areolated; with a series of humps (oval to circular raised areas of cuticle) present in a submarginal row of 17 (typically 8 on each side plus 1 medially on head), 3 on each side submedially, and usually 3 medially but these often poorly defined. Dorsal setae (dset) very short, each 2���3 ��m long with rounded apex, scattered on dorsum. Simple pores (sp) each 2.5���3.0 ��m wide, scattered evenly on dorsum. Preopercular pores (pop) each 3.8���5.0 ��m wide, scarce, present in a small group of 1���5 anterior to anal plates. Dorsal microducts (dmic) in areolations each 2.0��� 2.5 ��m wide, appearing bilocular under high magnification. Anal plates (anplt) each triangular with anterolateral margin longer than posterolateral margin, inner lobes fairly developed, with a tessellated texture, each plate 150���198 ��m long, 100���125 ��m wide, anterolateral margin 140���163 ��m long, posterolateral margin 90���128 ��m long; each plate with 14���22 dorsal setae, slender spinose, each 8���23 ��m long. Anal ring (ar) probably always bearing 10 setae [Morrison (1921: 657) says 8 setae, but the thinner setae are difficult to see], each 100���155 ��m long. Margin. Eyespots present slightly removed from dorsal margin, each 20���28 ��m in maximum dimension. Marginal setae (mset) of 2 broad types usually not found together on a specimen (but female SPQ.030 with both types): (1) long (20���110 ��m) and flagellate, present in 1 or 2 rows (rarely up to 3 rows on part of margin) (as illustrated in Fig. 14); (2) short (12���28 ��m long) and with apices mostly fimbriate (or at least divided), usually present in a single row, rarely in 2 rows on parts of margin; with about 7���30 marginal setae between anterior and posterior stigmatic areas on each side of body. Stigmatic setae (stgset) of variable length and development, numbering 1���3 but usually 1 (rarely absent) per cleft, median seta 3���25 ��m long, lateral ones if present each 3.0��� 7.5 ��m long, spinose and tapering to a rounded point, rarely 3 very short setae (��� 5 ��m) present. Venter. Derm membranous. Ventral setae (vset) slender, longest submedially on posterior abdominal segments, each 20���88 ��m long, elsewhere shorter, 7.5���40 ��m long. Interantennal setae in 2 pairs, each seta 50���70 ��m long. Ventral tubular ducts (vtd) present in a broad submarginal band; each duct with outer ductule about 15 ��m long, inner ductule about 17.5 ��m long, and duct opening about 2.5 ��m wide. Ventral microducts (vmic) each about 2 ��m wide, scattered fairly evenly on venter. Pregenital disc-pores (pgp) each with 7���9 loculi, each pore 5���7 ��m wide. Antennae (ant) usually 7, rarely 6, segmented [Morrison (1921) recorded 8 segments but this appears to be erroneous], each antenna 210���270 ��m long; apical antennal segment 30���43 mm long, with apical prolongation 2���8 ��m long on at least 1 antenna (often absent on 1 or both antennae of pair); fleshy setae present on last 3 segments when 7 segmented, and on last 2 segments when 6 segmented. Mouthparts normal; clypeolabral shield 210���270 ��m long, 170���235 ��m wide; labium 80���100 ��m long, 120���150 ��m wide. Legs with hind trochanter + femur 155��� 195 ��m long; hind tibia + tarsus 155���200 ��m long; all tarsal digitules each 28���40 ��m long; claw digitules each 25��� 30 ��m long, claws each about 30 ��m long. Spiracles normal: anterior peritremes each 45���58 ��m wide; posterior peritremes each 50���65 ��m wide. Spiracular pores (spp) each 4���5 ��m wide, mostly with 5 loculi, rarely 4. Comments. Adult females of C. tumuliferus can be distinguished from all other species of Coccus known from Macaranga by having the combination of (i) very short dorsal setae that can appear to be absent; (ii) almost always 8 dorsal submarginal raised areas on each side of body plus 1 medially on head (most obvious on live or ethanolpreserved specimens); and (iii) usually 14���22 dorsal setae per anal plate, each slender spinose and mostly ��� 20 ��m long. Adult females of C. tumuliferus are most similar to the adult females of C. caviramicolus, C. pseudotumuliferus and C. secretus, which all also have extremely short dorsal setae, but they differ from females of C. caviramicolus in having marginal setae either flagellate or with few fimbriations (strongly fimbriate in C. caviramicolus) and anal plates with a ratio for the length of the anterolateral margin to posterolateral margin of 1.12 to 1.38 (ratio mostly 1.41 to 2.06 in C. caviramicolus); from C. secretus in having dorsal setae rounded at the apices (tapering to a point in C. secretus) and the dorsal setae of the anal plates are usually much shorter (each 8���23 ��m long in C. tumuliferus compared with 15���45 ��m long in C. secretus); and from C. pseudotumuliferus in the number of submarginal raised areas (typically 8 on each side plus 1 medially on head in C. tumuliferus compared with usually 11 on each side plus 1 medially on head in C. pseudotumuliferus), the shape of these raised areas (usually circular in C. tumuliferus but oval to elongate in C. pseudotumuliferus), and the number of stigmatic setae (0���3 but usually 1 per cleft in C. tumuliferus compared with usually 3 per cleft in C. pseudotumuliferus). Heckroth et al. (1998) recognised C. tumuliferus from both Borneo and Peninsular Malaysia and recorded it as most common on M. hypoleuca, which is a common and widespread tree in both regions (Davies 2001). We had available for study 16 slide preparations, each containing from one to six adult females, made by Heckroth and identified by him as C. tumuliferus from Borneo. Five slides (#445, 447, 450, 451 and 453, ex M. hypoleuca, Santubong [probably on the lower slopes of Mt Santubong], Sarawak) have adult females of C. tumuliferus, but the other 11 slides (#495, 525, 526, 527, 581, 589, 598, 629, 631, 635 and 614, ex either M. bancana, M. hypoleuca, M. indistincta, M. beccariana or M. pearsonii, from three areas in Sabah) contain specimens of C. pseudotumuliferus. Other than the specimens from Santubong, all other records for C. tumuliferus are from Singapore and Peninsular Malaysia and, given that it is unlikely that Heckroth's specimens of C. tumuliferus are mislabelled, the explanation for this distribution is probably geographic. Santubong is in the region of Sarawak closest to Singapore and West Malaysia and may have been isolated from the rest of Sarawak by past geological and environmental conditions. The Kuching area (including Mt Santubong) of western Sarawak is south of the Lupar Valley and a geological fault called the Lupar Line. This fault marks the southwestern boundary of the rock formation called the Rajang Group in Sarawak (Moss 1998; Wang et al. 2016). The Lupar Valley contains a large river, the Batang Lupar, surrounded by extensive swamp forests, which may have created a barrier to the dispersal of some taxa. A barrier effect of the Lupar Valley has been hypothesised for a species of Malaysian frog for which populations from Peninsular Malaysia and western Sarawak were more genetically similar than populations in western Sarawak were to those in northeastern Sarawak (Zainudin et al. 2010). The adult females of C. tumuliferus from Santubong have 7���9 dorsal submarginal humps on each side of the body and of the typical shape for C. tumuliferus; 12���16 dorsal anal plate setae on the six females for which they are visible clearly; flagellate marginal setae up to 90 ��m long (but usually C. tumuliferus from the Kuching region (i.e., south of the Lupar Line) would be valuable. Furthermore, C. tumuliferus may occur in the northwestern part of West Kalimantan but no collections have been made in that region., Published as part of Gullan, Penny J., Kondo, Takumasa, Fiala, Brigitte & Quek, Swee-Peck, 2018, Taxonomy of coccids (Hemiptera: Coccidae: Coccus L.) associated with Crematogaster ants (Hymenoptera: Formicidae) in the stems of Macaranga plants (Euphorbiaceae) in Southeast Asia, pp. 1-51 in Zootaxa 4521 (1) on pages 43-46, DOI: 10.11646/zootaxa.4521.1.1, http://zenodo.org/record/3770241, {"references":["Morrison, H. (1921) Some nondiaspine Coccidae from the Malay Peninsula, with descriptions of apparently new species. The Philippine Journal of Science, 18, 637 - 677.","Williams, D. J. & Ben-Dov, Y. (2009) A review of species names combined with the genus Coccus Linnaeus (Hemiptera: Sternorrhyncha: Coccoidea). Zootaxa, 2285, 1 - 64.","Davies, S. J., Lum, S. K. Y., Chan, R. & Wang, L. K. (2001) Evolution of myrmecophytism in Western Malesian Macaranga (Euphorbiaceae). Evolution, 55, 1542 - 1559. https: // doi. org / 10.1111 / j. 0014 - 3820.2001. tb 00674. x","Heckroth, H. - P., Fiala, B., Gullan, P. J., Idris, A. H. & Maschwitz, U. (1998) The soft scale (Coccidae) associates of Malaysian ant-plants. Journal of Tropical Ecology, 14, 427 - 443. https: // doi. org / 10.1017 / S 0266467498000327","Moss, S. J. (1998) Embaluh Group turbidites in Kalimantan: evolution of a remnant oceanic basin in Borneo during the Late Cretaceous to Palaeogene. Journal of the Geological Society, 155, 509 - 524. https: // doi. org / 10.1144 / gsjgs. 155.3.0509","Wang, P. C., Li, S. Z., Guo, L. L., Jiang, S. H., Somerville, I. D., Zhao, S. J., Zhu, B. D., Chen, J., Dai, L. M., Suo, Y. H. & Han, B. (2016) Mesozoic and Cenozoic accretionary orogenic processes in Borneo and their mechanisms. Geological Journal, 51 (Supplement 1), 464 - 489. https: // doi. org / 10.1002 / gj. 2835","Zainudin, R., Nor, S. M., Ahmad, N., Md-Zain, B. M. & Rahman, M. A. (2010) Genetic structure of Hylarana erythraea (Amphibia: Anura: Ranidae) from Malaysia. Zoological Studies, 49 (5), 688 - 702."]}

Coccus penangensis Morrison urn:lsid:zoobank.org:act: D8A35CBE-4EB3-4492-9C2C-38AD45B77D04 (Figs 2C&D, 10) Coccus penangensis Morrison, 1921: 657. Type material examined. Holotype: adult female, PENINSULAR MALAYSIA: Penang Island, in hollow stems of Macaranga triloba [now correctly named M. bancana], date not given, coll. I.H. Burkill, (USNM). Paratypes: same data as holotype, 2(2 adult females + 3 first-instar nymphs) (USNM). Morrison (1921: 659) states that this species was "described from two mounted adults, three mounted larvae, and few unmounted specimens,...". One of his three slides has a single adult female and is labelled " Holotype " in Morrison's handwriting (on both the slide and its envelope). Another slide has two adult females and includes the word " Paratype ". We assume that Morrison's overlooked the fact that there were two adult females on the paratype slide when he stated that the description was based on two mounted adults. It seems that this species originally was to be named " Lecanium inquilinum " by Green as this name is crossed out on the slide labels and replaced by " Coccus penangensis ". The slide envelope for the holotype also includes the words: "Green, ms: (Part of type material)". Examined non-type material from original collections. PENINSULAR MALAYSIA: Penang Island, in hollow stems of Macaranga triloba [now correctly named M. bancana], coll. I.H. Burkill, No. 2693-b, also labelled: "(type material)", 4(6) (BMNH); Penang Island, in hollow stems of Macaranga, coll. I.H. Burkill, 1(8) (BMNH). These two specimen lots have the same data as the type collection listed above and the same data as provided by Morrison (1921) in his original description of this species, but they are not type specimens, as explained in the Materials and methods. Other material examined. BORNEO: Brunei, Batu Apoi Forest Reserve, 4�� 33' N, 115�� 09' E, ex M. beccariana, M. trachyphylla & Macaranga sp., 2���31 Aug. & 1 Sept. 1995, coll. P.J. Gullan, PJG-B1: 6(6 adult females), PJG-B6: 16(14 adult females & 2 second-instar females), PJG-B9: 6(4 adult females & 2 third-instar females), PJG-B14: 5(4 adult females & 5 first-instar nymphs), PJG-B28: 1(1), PJG-B30: 21(18 adult females, 1 pharate adult female, 5 first-instar nymphs), PJG-B33: 7(7), PJG-B43: 5(4 adult females & 1 third-instar female), PJG-B45: 5(4 adult females & 5 first-instar nymphs), PJG-B48: 7(7), PJG-B51: 9(9), PJG-B58: 3(3), PJG-B59: 5(5), PJG-B64: 6(6), PJG-B70: 8(7 adult females & 2 first-instar nymphs); Brunei, Batu Apoi Forest Reserve, near KBFSC, 4�� 33' N, 115�� 09' E, ex Macaranga sp., 23 Aug. 1995, coll. P.S. Cranston, PJG-B44: 5(5 adult females); Brunei, Batu Apoi Forest Reserve, near KBFSC, 4�� 33' N, 115�� 09' E, ex Macaranga sp., 12 Aug. 1995, coll. C. Maycock, PJG-B31: 3(2 adult females & 1 pharate adult female); North Kalimantan, Long Ampung, Sungei Ampung trail, 1�� 43.367' N, 114�� 59.838' E, 700 m, ex M. hullettii & M. indistincta, 8 Feb. 2005, coll. S.-P. Quek, SPQ.689 & SPQ.691, DNA vouchers 2(2); North Kalimantan, Long Ampung, Sungei Selungei trail, 1�� 42.266' N, 114�� 58.898' E, 700 m, ex M. indistincta, 10 Feb. 2005, coll. S.-P. Quek, SPQ.712, DNA voucher 1(1); Sabah, Crocker Range, Keningau, 1200 m, ex M. angulata, 17 Oct. 1999, coll. S.-P. Quek, SPQ.114, DNA voucher 1(1); Sabah, Crocker Range, Keningau to Ulu Kimanis trail, 5.28�� N, 115.05�� E, 280���1100 m, ex M. angulata, M. bancana & M. indistincta, 19 Oct. 1999, coll. S.-P. Quek, SPQ.130, SPQ.137a, SPQ.141 & SPQ.145, DNA vouchers 4(4); Sabah, Crocker Range, near Majora, 500? m, ex M. indistincta, 16 Oct. 1999, coll. S.-P. Quek, SPQ.105, DNA voucher 1(1); Sabah, Crocker Range, Senagang, past Keningau, ��� 450 m, ex M. glandibracteolata & M. indistincta, 20 Oct. 1999, coll. S.-P. Quek, SPQ.149 & SPQ.151, DNA vouchers 2(2); Sabah, Crocker Range, forest behind Tambunan, 600 m, ex M. hypoleuca, 18 Oct. 1999, coll. S.-P. Quek, SPQ.119, DNA voucher 1(1); Sabah, Crocker Range, Tambunan to Kota Kinabalu road, 200���1300 m, ex M. angulata, M. bancana, M. petanostyla & M. trachyphylla, 24 Oct. 1999, coll. S.-P. Quek, SPQ.162, SPQ.164, SPQ.165, SPQ.166, SPQ.168, SPQ.170, SPQ.172, SPQ.173a & SPQ.174a, DNA vouchers 9(9); Sabah, Crocker Range, Tambunan to Trusmadi trail, 1300 m, ex M. angulata, 10 Oct. 1999, coll. S.-P. Quek, SPQ.158 & SPQ.158b, DNA vouchers 2(2); Sabah, Crocker Range, Tikolod, 650 m, ex M. indistincta, 18 Oct. 1999, coll. S.-P. Quek, SPQ.127, DNA voucher 1(1); Sabah, Crocker Range, ex M. angulata, 14 Apr. 2001, coll. B. Fiala, #20 = TK0020, DNA vouchers 2(2); Sabah, Crocker Range, ex M. angulata, 14 Apr. 2001, coll. B. Fiala, #31, 4(4, including DNA voucher NH5) (2 ANIC, 2 FRIM); Sabah, Crocker Range, Rafflesia Centre, ex M. angulata, 28 Mar. 2002, coll. B. Fiala, #126 (TK0097) & #134 (TK0096), DNA voucher 2(2); Sabah, Poring, ex M.? depressa [now identified as M. angulata], Feb. 1992, coll. B. Fiala, #29a, 4(4); Sabah, Poring, ex Macaranga sp. [now identified as M. motleyana], 16 Apr. 2001, coll. B. Fiala, #36 (TK0034), DNA voucher 1(1); Sabah, Poring, ex Macaranga indistincta, 12 Apr. 2001, coll. B. Fiala, #137 (TK0037), DNA voucher 1(1); Sabah, Poring, ex Macaranga glandibracteolata, 24 Mar. 2002, coll. B. Fiala, #103b (TK0101), DNA voucher 1(1); Sabah, Poring, ex M. glandibracteolata, 24 Aug. 2003, coll. B. Fiala, #2, 3(3) (1 ANIC, 2 FRIM); Sabah, Poring Hot Springs, Kipungit waterfall, ex M. beccariana, Dec. 1994, coll. H.-P. Heckroth, #598, 1(5 adult females plus 2 adult females of C. pseudotumuliferus); Sabah, Poring Hot Springs, ex M. indistincta, no date, coll. H.-P. Heckroth, #550, 1(2 adult females, probably C. penangensis but poorly cleared, + 2 nymphs) (FRIM); Sabah, Tawau, ex M. umbrosa [now identified as M. lamellata], 15 Mar. 2002, coll. B. Fiala, #19 (TK0106) & #65b (TK0103), DNA vouchers 2(2); Sarawak, Lambir, ex M. bancana, 20 Jan. 1999, coll. K. Murase, KM.s27, DNA voucher 1(1) (FDS); Sarawak, Lambir, ex M. kingii [now named M. umbrosa] & M. winkleri, 2���4 Aug. 2003, coll. T. Itioka, TI.s56, TI.s57a & TI.s57b, DNA vouchers 3(3) (FDS); Sarawak, Lambir, ex M. lamellata, 24 Feb. 1992, coll. B. Fiala, #38a, 2(2); Sarawak, Lambir, ex M. kingii var. platyphylla [now named M. umbrosa], 24 Feb. 1992, coll. B. Fiala, #44a, 3(3); Sarawak, 8 km Lambir NP, ex M. lamellata, Dec. 1992, coll. H.-P. Heckroth, #106, #107 &#138, 5(5); Sarawak, 10 km Lambir NP, ex M. hulletti, Dec. 1992, coll. H.-P. Heckroth, #148, 1(2) (FRIM); South Kalimantan, Meratus Mts, Loksado area, 2�� 48.856' N, 115�� 30.695 E, 380 m, ex M. bancana, 18 June 2001, coll. S.-P. Quek, SPQ.345, DNA voucher 1(1); South Kalimantan, Meratus Mts, Loksado to Kandangan, 2�� 47.670' N, 115�� 28.712' E, 170���200 m, ex M. hullettii, M. indistinct / velutina & M. motleyana, 18 June 2001, coll. S.-P. Quek, SPQ.351, SPQ.352, SPQ.353, SPQ.354, SPQ.356b & SPQ.361a, DNA vouchers 6(6); West Kalimantan, Siduk to Nanga Tayap, 1�� 14.672' S, 109�� 59.184' E to 1�� 22.360' S, 110�� 13.686' E, M. aeth��adenia & M. indistinct / velutina, 21 & 22 June 2002, coll. S.-P. Quek, SPQ.393, SPQ.396, SPQ.420 & SPQ.412b, DNA vouchers 4(4). PENINSULAR MALAYSIA: Genting, 900 m, ex M. hullettii, Mar. 1993, coll. H.-P. Heckroth, #222, 2(1 adult female & 1 first-instar nymph); Gombak Field Studies Centre, ex M. triloba [now correctly named M. bancana], Mar. 1993, H.P. Heckroth, #269, 1(1) (BMNH); Gombak, ex M. triloba [= M. bancana] & M. hullettii, 22 Mar. 1992, coll. B. Fiala, #174a & #175a, 4(4); Gombak, lower logging road, ex M. triloba [= M. bancana], Feb. & Mar. 1993, coll. H.-P. Heckroth, #251, 5(5) (3 ANIC, 2 FRIM) & #298, 2(2) (ANIC); Johor, Mawai camp, Ginger Hill, ~ 1.871�� N, ~ 103.954�� E, M. bancana, 7 Sept. 1999, coll. S.- P. Quek, SPQ.031, DNA voucher 1(1); Pahang, Beserah Hill nr Kuantan, ~ 3.867�� N, ~ 103.347�� E, M. bancana, 14 Sept. 1999, coll. S.-P. Quek, SPQ.047, DNA voucher 1(1); Pahang, Tioman Island, Tekek-Juara trail, 2.805�� N, 104.117�� E, ex M. bancana, 21 Sept. 1999, coll. S.-P. Quek, SPQ.084, DNA voucher 1(1); Terengganu, Bauk Hill, 200���300 m, ex M. bancana, 12 Sept. 1999, S.-P. Quek, SPQ.037, SPQ.037b, SPQ.040 & SPQ.041, DNA vouchers 4(4); Perak [state], Taiping Hills, in stems of M. triloba [now correctly named M. bancana], attended by Crematogaster bourensis [sic], 2.iv.1924 (letter), coll. I.H. Burkill, Singapore Field No. 13055, 1(3) (USNM); Perak [state], Straits Settlement, near Tanjong Malim, on Macaranga triloba [now correctly named M. bancana], 5.vii.1924 (letter), Singapore Field No. 13489, coll. I.H. Burkill, 1(3) (USNM). SINGAPORE: Central Catchment, Sime Road, 1�� 21'35" N, 103�� 48'30" E, ex M. bancana, 18 Mar. 2009, coll. P.S. Cranston, 3(3); Old Upper Thompson Road, ~ 1.381�� N, ~ 103.813�� E, M. bancana, 4 Oct. 1999, coll. S.-P. Quek, SPQ.088 & SPQ.089, DNA vouchers 2(2); in hollow stems of Macaranga, coll. I.H. Burkill or C.F. Baker, 3(17 adult females & 1 nymphal female) (BMNH). SUMATRA: Ketambe, ~ 3�� 50' N, 7�� 40' E, ex M. triloba [now correctly named M. bancana], 30 Oct. 1992, coll. U. Maschwitz, sent by B. Fiala, #8a, 2(2); Medan, ~ 3�� 40' N, 98�� 20' E, ex M. triloba [= M. bancana], 20 Oct. 1992, coll. U. Maschwitz, sent by B. Fiala, #4a, 3(3); Sibolangit, ~ 3�� 40' N, 98�� 20' E, ex M. hullettii, 20 Oct. 1992, coll. U. Maschwitz, sent by B. Fiala, #5a & #9a, 8(6 adult females, 1 pharate adult female & 1 third-instar female); Sibolangit, ~ 3�� 40' N, 98�� 20' E, ex M. triloba [= M. bancana], 23 Oct. 1992, coll. U. Maschwitz, sent by B. Fiala, #6a, 2(2). Adult female. Unmounted material. ���Normally short oval, flat, dorsal surface dull, naked, wrinkled radially near margin, outer portion light brown, central disk usually much darker brown to blackish;..��� (Morrison 1921: 657). Morrison���s description of adult females from Penang Island differs in body colour from specimens photographed in Borneo (Fig. 2C & D) probably because Morrison���s specimens were dead and dried. Females from both Brunei and Sabah were pale ochre to salmon pink with a thin dorsal secretion that varied in whiteness among females from different collections. Ridges radiating inwards from the body margin were apparent in all specimens. Slide-mounted adult female (n=27, including holotype and paratypes; Fig. 10). Body oval to elongate oval, 1.6���3.0 mm long, 1.2���2.5 mm wide. Dorsum. Derm (dd) membranous, with numerous areolations and lightly sclerotised irregular submarginal lines radiating inwards at right angles to margin. Dorsal setae (dset) slender, each 7���38 (mostly ���20) ��m long, scattered on dorsum. Simple pores (sp) each 2.5���3.0 ��m wide, scattered evenly on dorsum. Preopercular pores (pop) each 3.5���7.5 (rarely up to 10) ��m wide, scarce, present in an elongate group of 6���25 (usually 10���17) anterior to anal plates. Dorsal microducts (dmic) in areolations each 2.0��� 2.5 ��m wide, appearing bilocular under high magnification. Anal plates (anplt) each broadly triangular with anterolateral margin usually slightly longer than posterolateral margin and latter often slightly convex, length of each plate 1.2���1.7 times width, inner lobes well developed, with a tessellated texture, each plate 120���170 ��m long, 85���125 ��m wide, anterolateral margin 95���140 ��m long, posterolateral margin 85���115 ��m long; each plate with 11���23 dorsal setae, each seta 8���20 ��m long (12��� 18 ��m long on holotype). Anal ring (ar) probably always bearing 10 setae [Morrison (1921: 659) said 8 setae, but the thinner ones are difficult to see], each 75���120 ��m long. Margin. Eyespots indistinct, present on dorsal margin, each 15���28 ��m wide, but not detected on some specimens. Marginal setae (mset) in 1 irregular row, each seta short and usually fairly stout, sometimes slender, each usually 7���20 (rarely up to 40) ��m long, with apex bifurcate or fimbriate, rarely sharply spinose, with 12���31 setae between anterior and posterior stigmatic areas on each side of body. Stigmatic setae (stgset) well developed, spinose and tapering to pointed or rounded apices, usually numbering 3, median setae usually longest, each 10���28 (mostly 13���20) ��m long, lateral setae each 5���18 (mostly 7���15) ��m long. Venter. Derm membranous. Ventral setae (vset) slender, with prevulvar setae each 18���75 ��m long, elsewhere shorter, each 8���18 ��m long. Interantennal setae numbering 2 or 3 pairs, each seta 7���15 ��m long. Ventral tubular ducts (vtd) present in a broad submarginal band; each duct with outer ductule 15���22 ��m long, inner ductule 17���20 ��m long, and duct opening about 2 ��m wide. Ventral microducts (vmic) each 2.0��� 2.5 ��m wide, scattered fairly evenly on venter. Pregenital disc-pores (pgp) each with 5���9 (mostly 7 and 8) loculi, each pore 5���6 ��m wide. Antennae (ant) 7 or 8 (mostly 7, very rarely 6) segmented, each 200���265 ��m long; fleshy setae present on last 3 segments. Clypeolabral shield 180���258 ��m long, 165���210 ��m wide; labium 75���100 ��m long, 103���140 ��m wide. Legs with hind trochanter + femur 140���170 ��m long; hind tibia + tarsus 145���185 ��m long; all tarsal digitules each 27���42 ��m long; claw digitules each 23���33 ��m long, claws each 25���30 ��m long. Spiracles normal: anterior peritremes each 45���77 ��m wide; posterior peritremes each 55���83 ��m wide. Spiracular pores (spp) each 4���5 ��m wide, with 3���6 (mostly 5) loculi. Comments. Adult females of C. penangensis can be distinguished from all other species of Coccus known from Macaranga by having the combination of (i) anal plates each with 11���23 setae, each seta ��� 20 ��m long; (ii) short, slender dorsal setae, each mostly ��� 20 ��m long and tapering to apex; and (iii) marginal setae in a single row with apex of each seta usually bifurcate or fimbriate, and mostly 7���20 ��m long. The adult females of C. penangensis are most similar to those of C. heckrothi in the number of dorsal setae on each anal plate (although the setae of C. heckrothi are often slightly longer) and in the shape and length of the dorsal body setae, but differ in that the marginal setae of C. penangensis mostly have bifurcate or fimbriate apices (mostly with sharply pointed apices in C. heckrothi) and the lateral stigmatic setae are usually 15 ��m in C. heckrothi). Two of five adult females of C. penangensis from Poring Hot Springs in Sabah, all mounted on one slide prepared by H.-P. Heckroth (slide also with 2 adult females of C. pseudotumuliferus), have extremely few and very short (��� 5 ��m long) dorsal setae. The other three females are poor mounts but a few slightly longer dorsal setae are visible on two of them. Thus at least two of these females could erroneously key to the C. tumuliferus group or C. secretus because of these very short and sparse dorsal setae. Coccus penangensis is a very widespread species, occurring in Borneo, Peninsular Malaysia, Singapore and Sumatra. Heckroth et al. (1998) recorded this species as common in both primary and secondary forest on Borneo (inside the stems of 17 Macaranga species) and Peninsular Malaysia plus Sumatra (in five Macaranga species). There is a large amount of morphological variation among adult females of C. penangensis from different localities, but there do not appear to be consistent differences related to geography. However, specimens from Burkill's collections on Penang Island appear to have longer dorsal setae than specimens from most other localities. Coccus penangensis was well represented (over 40 specimens) in the molecular phylogeny of Quek et al. (2017), with specimens from Bauk Hill on the east coast of Peninsular Malaysia and from near Siduk in West Kalimantan each forming a small cluster distinct from the remainder of the specimens. The adult females of these two groups did not appear to differ morphologically from specimens collected elsewhere but, unfortunately, the condition of molecular vouchers often makes detailed morphological comparisons difficult., Published as part of Gullan, Penny J., Kondo, Takumasa, Fiala, Brigitte & Quek, Swee-Peck, 2018, Taxonomy of coccids (Hemiptera: Coccidae: Coccus L.) associated with Crematogaster ants (Hymenoptera: Formicidae) in the stems of Macaranga plants (Euphorbiaceae) in Southeast Asia, pp. 1-51 in Zootaxa 4521 (1) on pages 30-33, DOI: 10.11646/zootaxa.4521.1.1, http://zenodo.org/record/3770241, {"references":["Morrison, H. (1921) Some nondiaspine Coccidae from the Malay Peninsula, with descriptions of apparently new species. The Philippine Journal of Science, 18, 637 - 677.","Heckroth, H. - P., Fiala, B., Gullan, P. J., Idris, A. H. & Maschwitz, U. (1998) The soft scale (Coccidae) associates of Malaysian ant-plants. Journal of Tropical Ecology, 14, 427 - 443. https: // doi. org / 10.1017 / S 0266467498000327","Quek, S. P., Ueda, S., Gullan, P. J., Kondo, T., Hattori, M., Itioka, T., Murase, K. & Itino, T. (2017) Nuclear-DNA-based species delineations of Coccus scale insects in symbiosis with plants and ants, and the role of plant epicuticular wax in structuring associations. Biological Journal of the Linnean Society, 120 (4), 818 - 835. https: // doi. org / 10.1111 / bij. 12917"]}

Coccus caviramicolus Morrison urn:lsid:zoobank.org:act: 2272018E-C642-4FDE-A431-2C72F2C7980F (Fig. 3) Coccus caviramicolus Morrison, 1921: 659. Type material examined. Holotype: adult female, SINGAPORE: in hollow stems of Macaranga sp., date not given, coll. I.H. Burkill, 1(1) (USNM). Paratypes: PENINSULAR MALAYSIA: Malacca, Kendong, in hollow stems of Macaranga triloba [now correctly named M. bancana], date not given, coll. I.H. Burkill, 2(2) (USNM; only 1 of these paratypes seen); north of Malacca, foot of Tampin Hill, in hollow stems of M. triloba [now correctly named M. bancana], date not given, coll. I.H. Burkill, 3(1 adult female, 1 third-instar female, 1 first-instar nymph) (USNM). Examined non-type material from original collections. PENINSULAR MALAYSIA: Malacca, Kendong, in hollow stems of M. triloba [now correctly named M. bancana], date not given, coll. I.H. Burkill, 1440, 1(5 adult females + 1 third-instar female; also 1 adult female of C. secretus under same coverglass) (BMNH). SINGAPORE: Botanic Garden, in hollow stems of Macaranga, date not given, coll. I.H. Burkill, No. X-2, 1(4) (BMNH). These two collections have the same data as two of the type collections listed above, but are not type material as explained in the Materials and Methods. Morrison (1921) acknowledges E.E. Green (of the BMNH) for sending him the material upon which he based the description of C. caviramicolus. Other material examined. INDONESIA: Riau Islands, Bintan Island, lowland, ex M. griffithiana, 26 Aug. 1999, coll. S.-P. Quek, SPQ.012, DNA voucher 1(1). PENINSULAR MALAYSIA: Johor, Mawai camp, ~ 1.871�� N, ~ 103.954�� E, M. bancana, M. hypoleuca & M. griffithiana, 5 & 7 Sept. 1999, coll. S.-P. Quek, SPQ.020, SPQ.021, SPQ.034 & SPQ.036, DNA vouchers 4(4); Johor, 119 km to Johor Baru from Mersing, M. griffithiana, 16 Sept. 1999, coll. S.-P. Quek, SPQ.069, DNA voucher 1(1); Johor, Sedili, M. hullettii & M. griffithiana, 5 Dec. 1999, coll. S.-P. Quek, SPQ.175 & SPQ.178, DNA vouchers 2(3); Negeri Sembilan, Felda Pasoh, M. griffithiana & M. hypoleuca, 18 Sept. 1999, coll. S.-P. Quek, SPQ.072: DNA voucher 1(1) & SPQ.075a: DNA vouchers 3(2 adult females & 2 first-instar nymphs); Pahang, near Kuantan, Teluk Chempedak, lowland, ex M. hypoleuca, 14 Sept. 1999, coll. S.-P. Quek, SPQ.052-1 & SPQ.052-2, DNA vouchers 2(2); Pahang, near Kuantan, road to Prancing Falls, M. griffithiana, 15 Sept. 1999, coll. S.-P. Quek, SPQ.053 & SPQ.056, DNA vouchers 2(2); 6 km Rawang, ex M. griffithiana, Feb. 1993, coll. H.-P. Heckroth, #206 1(1); 8 km Rawang, ex M. griffithiana, Feb. 1993 and Mar. 1993, coll. H.-P. Heckroth, #184: 3(3), #185: 4(3 adult females + 4 first-instar nymphs) & #190: 3(3); Terengganu, Bauk Hill, M. griffithiana, 12 Sept. 1999, coll. S.-P. Quek, SPQ.044 & SPQ.045, DNA vouchers 2(2). SINGAPORE: Upper Peirce Reservoir, M. griffithiana, 4 Oct. 1999, coll. S.-P. Quek, SPQ.092, DNA voucher 1(1); Old Upper Thompson Road, M. griffithiana, 10 Oct. 1999, coll. S.-P. Quek, SPQ.095, DNA voucher 1(1). Adult female. Unmounted material. ���Flat, broad oval, approaching circular, dull brown, central area darker, dull or faintly shining, without or with a very slight secretionary coating;..��� (Morrison 1921: 659). Slide-mounted adult female (n=13, including holotype and 2 adult female paratypes; Fig. 3). Body oval to elongate oval, 1.8���3.4 mm long, 1.4���2.8 mm wide. Dorsum. Derm (dd) with distinct round-to-oval areolations, with clear area of each areolation usually 10���25 ��m in widest dimension and areolations largest towards margin, but rarely with any obvious sclerotised submarginal lines radiating inwards at right angles to margin. Dorsal setae (dset) very short, each about 2 ��m long with rounded apex, scattered on dorsum. Simple pores (sp) each 2���3 ��m wide, scattered evenly on dorsum. Preopercular pores (pop) each typically 4���6 ��m wide, scarce, present in a small group of 4���8 anterior to anal plates. Dorsal microducts (dmic) in areolations each 2.0��� 2.5 ��m wide, appearing bilocular under high magnification. Anal plates (anplt) each triangular with anterolateral margin usually much longer than posterolateral margin, width of each plate about half length, inner lobes well developed, with a tessellated texture, each plate 190���225 ��m long, 75���110 ��m wide, anterolateral margin 130���200 ��m long, posterolateral margin 85���120 ��m long; each plate with 16���26 dorsal setae (anpltset), each seta usually short, straight and robust, 5���15 (mostly Margin. Eyespots situated slightly removed from dorsal margin, mostly not detected. Marginal setae (mset) in 1 row, most setae fimbriate at apices, each 10���43 (mostly about 25) ��m long; with 15���28 (rarely Venter. Derm membranous. Ventral setae (vset) slender, longest on posterior abdominal segments, each 17���90 ��m long, elsewhere shorter, each 7���22 ��m long. Interantennal setae in 2 pairs. Ventral tubular ducts (vtd) present in a broad submarginal band; each duct with outer ductule 15���20 ��m long, inner ductule 15���23 ��m long, and duct opening about 2 ��m wide. Ventral microducts (vmic) each about 2 ��m wide, scattered fairly evenly on venter. Pregenital disc-pores (pgp) each with 6���8 (mostly 6���7) loculi, each pore 6���7 ��m wide. Antennae (ant) mostly 7 segmented (rarely 5 or 8 segmented), each 235���290 ��m long; fleshy setae present on last 3 segments when 7 segmented, and on last 2 segments when 6 segmented. Clypeolabral shield 218���268 ��m long, 183���238 ��m wide; labium 85���108 ��m long, 115���153 ��m wide. Legs with hind trochanter + femur 160���190 ��m long; hind tibia + tarsus 165���193 ��m long; all tarsal digitules each 35���43 ��m long; claw digitules each 22���28 ��m long, claws each 22���26 ��m long. Spiracles normal: anterior peritremes each 48���68 ��m wide; posterior peritremes each 50���75 ��m wide. Spiracular pores (spp) each 4���6 ��m wide, with 3���7 (mostly 5) loculi. Comments. Adult females of C. caviramicolus can be distinguished from all other species of Coccus known from Macaranga by having the combination of (i) extremely short dorsal setae (appearing absent); (ii) marginal setae ��� 40 ��m long and each with a fimbriate apex; (iii) anal plates together pyriform in shape; and (iv) the numerous (���15), very short (5���8 ��m) setae on each plate. They are most similar to the adult females of C. pseudotumuliferus, C. secretus and C. tumuliferus in having very short dorsal setae of length mostly less than two times width of setal socket, but differ in that their marginal setae are apically fimbriate (mostly tapering to a point in the other three species) and their anal plates together are pyriform (anal plates together are quadrate to subcircular in other three species). Coccus caviramicolus has been recorded only from Singapore, Peninsular Malaysia and herein also from the Riau Islands of Indonesia. Our records for C. caviramicolus are mostly from M. griffithiana. Heckroth et al. (1998) recorded this species almost exclusively from secondary forest in Peninsular Malaysia and from five species of Macaranga, although most commonly on M. griffithiana (identified then as M. motleyana subspecies griffithiana). The host plants of C. caviramicolus are from both section Pachystemon and section Pruinosae., Published as part of Gullan, Penny J., Kondo, Takumasa, Fiala, Brigitte & Quek, Swee-Peck, 2018, Taxonomy of coccids (Hemiptera: Coccidae: Coccus L.) associated with Crematogaster ants (Hymenoptera: Formicidae) in the stems of Macaranga plants (Euphorbiaceae) in Southeast Asia, pp. 1-51 in Zootaxa 4521 (1) on pages 13-14, DOI: 10.11646/zootaxa.4521.1.1, http://zenodo.org/record/3770241, {"references":["Morrison, H. (1921) Some nondiaspine Coccidae from the Malay Peninsula, with descriptions of apparently new species. The Philippine Journal of Science, 18, 637 - 677.","Heckroth, H. - P., Fiala, B., Gullan, P. J., Idris, A. H. & Maschwitz, U. (1998) The soft scale (Coccidae) associates of Malaysian ant-plants. Journal of Tropical Ecology, 14, 427 - 443. https: // doi. org / 10.1017 / S 0266467498000327"]}

Key to adult females of Coccus species associated with Macaranga (Note: this key may be difficult to use unless the specimens are cleared thoroughly of body contents and their cuticle is well stained) 1. Dorsal setae (excluding marginal row) appearing absent but present and very short, most setae less than 2 times as long as width of setal socket, rarely setae near body margin up to 3 times as long as setal socket width, never as long as ventral setae..................................................................................................... 2 - Dorsal setae clearly evident, most setae more than 3 times as long as setal socket width, as long or longer than most ventral setae, but may be shorter than long interantennal and pregenital setae............................................ 5 2. Marginal setae mostly fimbriate at apices. Anal plates with dorsal setae usually confined to posterior half of each plate........................................................................................ caviramicolus Morrison - Marginal setae mostly tapering to a point, apices rarely bifurcate or fimbriate (except on some individuals of C. tumuliferus). Anal plates with dorsal setae usually present on posterior two-thirds of each plate................................... 3 3. Legs reduced, each smaller than mouthparts, hind trochanter + femur secretus Morrison - Legs well developed, each much larger than mouthparts, hind trochanter + femur> 130 ��m long. Dorsum covered with oval or circular dermal elevations (Fig. 11), sometimes difficult to see on slide-mounted specimens. Anal plate setae tapered, even if robust, and 8���23 ��m long. Antennae 7, rarely 6, segmented.................................................... 4 4. Dorsal submarginal raised areas (humps) very rounded, almost always numbering 8 on each side of body plus 1 medially on head. Stigmatic clefts often each with just 1 long robust seta (��� 25 ��m long, frequently damaged or missing), sometimes 2 lateral setae (each 3���8 ��m long), rarely 3 subequal very short setae (��� 5 ��m long). Apical antennal segment with a short (2���8 ��m) or often no apical prolongation.......................................................... tumuliferus Morrison - Dorsal submarginal raised areas oval or elongate, usually numbering 11, rarely 12, on each side of body plus 1 medially on head. Stigmatic clefts each usually with 3 setae of subequal length (mostly 7���18 ��m long, often damaged or missing). Apical antennal segment with an apical prolongation almost always ��� 10 ��m long on at least 1 antenna............................................................................................ pseudotumuliferus Gullan & Kondo sp. n. 5. Dorsal setae knobbed, or with rounded apices, not tapering to a point. Marginal setae sharply spinose, apices never bifurcate or fimbriate. Hind trochanter + femur macarangicolus Takahashi - Dorsal setae with apices not knobbed or rounded, each tapering to a point. Marginal setae spinose, with apices either tapering to a point, bifurcate or fimbriate. Hind trochanter + femur> 100 ��m long.......................................... 6 6. Marginal setae in 2 rows, numerous, with 41���45 between stigmatic areas on each side of thorax, each seta sharply spinose with slightly bent tip. Dorsal setae long and flagellate, each 35���90 ��m long................. lambirensis Gullan & Kondo sp. n. - Marginal setae in 1 row, not numerous, with 9 and mostly 15 ��m long................................................................... heckrothi Gullan & Kondo sp. n. - Marginal setae with apices mostly bifurcate or fimbriate, rarely sharply spinose. Lateral stigmatic setae each usually penangensis Morrison 9. Dorsal setae rather abundant, sharply spinose, mostly with straight or bent apices, occasionally a few setae with apices bifurcate or fimbriate, each seta 15���40 ��m long. Preopercular pores 5���11 ��m wide, each generally larger than a pregenital disc-pore................................................................................... macarangae Morrison - Dorsal setae rather sparse, slender, with a flagellate apex, each 15���30 ��m long. Preopercular pores usually ��� 6 ��m wide, each about same size as a pregenital disc-pore.................................................... circularis Morrison, Published as part of Gullan, Penny J., Kondo, Takumasa, Fiala, Brigitte & Quek, Swee-Peck, 2018, Taxonomy of coccids (Hemiptera: Coccidae: Coccus L.) associated with Crematogaster ants (Hymenoptera: Formicidae) in the stems of Macaranga plants (Euphorbiaceae) in Southeast Asia, pp. 1-51 in Zootaxa 4521 (1) on page 12, DOI: 10.11646/zootaxa.4521.1.1, http://zenodo.org/record/3770241

Coccus circularis Morrison urn:lsid:zoobank.org:act: DD61FCBF-DC4A-4EDD-818E-9E3875A97319 (Fig. 4) Coccus circularis Morrison, 1921: 665. Type material examined. Holotype: adult female, SINGAPORE: in hollow stems of Macaranga sp., date not given, coll. I.H. Burkill, Holotype 1(1) (USNM). Paratypes: SINGAPORE: same data as holotype, 2(1 adult female + 1 first-instar nymph) (USNM); in hollow stems of Macaranga triloba [now correctly named M. bancana], date not given, coll. I.H. Burkill, 1396, 1(1) (USNM). Examined non-type material from original collection. SINGAPORE: in hollow stems of Macaranga griffithiana, date not given, coll. I.H. Burkill, 1389, 1(2 adult females + 2 nymphs) (BMNH). These four BMNH specimens have similar data to the type collections listed above and one of the same Burkill collection numbers as provided by Morrison (1921) in his original description of this species, but they are not type specimens, as explained in the Materials and methods. Other material examined: PENINSULAR MALAYSIA: Negeri Sembilan, Felda Pasoh, M. hypoleuca, 18 Sept. 1999, coll. S.-P. Quek, SPQ.076, 1(1). SINGAPORE: Lower Peirce Reservoir, M. hypoleuca, 10 Oct. 1999, coll. S.-P. Quek, SPQ.094, 1(1). Other material examined. Coccus near circularis : BORNEO: Brunei, Batu Apoi Forest Reserve, 4�� 33' N, 115�� 09' E, 24 Aug. 1995, coll. P.J. Gullan, PJG-B47, 3(1 adult female & 13 first-instar nymphs); Sabah, Crocker Range, Keningau to Ulu Kimanis trail, 5.28�� N, 116.05�� E, 900 m, ex M. glandibracteolata, 19 Oct. 1999, coll. S.- P. Quek, SPQ.136a, DNA voucher 1(1); Sabah, Crocker Range, Tambunan to Kota Kinabalu Rd, 1000? m, ex M. puberula, 15 Oct. 1999, coll. S.-P. Quek, SPQ.098, DNA voucher 1(1); Sabah, Crocker Range, Tambunan to Kota Kinabalu Rd, 1300 m, ex M. petanostyla, 24. Oct. 1999, coll. S.-P. Quek, SPQ.163, DNA voucher 1(1); Sabah, Poring, ex M. glandibracheolata, 17 Apr. 2001, coll. B. Fiala, #106, 6(6); Sabah, Poring Hot Springs, ex M. depressa, M. motleyana & M. petanostyla, no dates, coll. H.-P. Heckroth, #552, 573, 640, 1140 & 1410, 5(18) (FRIM); Sabah, Poring Hot Springs, ex M. indistincta, no date, coll. H.-P. Heckroth, #589, 1(1 on slide with 1 adult female of C. pseudotumuliferus) (FRIM); Sabah, Ranau, roadside, ex M. beccariana, no date, coll. H.-P. Heckroth, #539, 1(3) (FRIM). Note. Specimens referred to as Coccus near circularis are all from Borneo and three of these specimens form Clade 4 in Quek et al. (2017, fig. 3). At our present state of knowledge, we consider these three specimens from the Crocker Range in Sabah (listed above) together with other specimens from Sabah and a specimen from Brunei, to be geographic variants of C. circularis (discussed below under Comments). Adult female. Unmounted material. ���Nearly to quite circular, dull grayish, appearing as if sprinkled with gray powder or dust; flat, but slightly ridged transversely about the middle and with low radiating ridges around the margin; anal cleft a little less than one-third the body length; extreme margin of body slightly elevated all the way around, forming a more or less distinct marginal ridge;..��� (Morrison 1921: 665). Slide-mounted adult female (n=6, based on adult females from Singapore, including all 5 collected by Burkill; Fig. 4). Body circular to oval, 3.0��� 3.1 mm long, 2.6���3.1 mm wide. Dorsum. Derm (dd) with numerous oval to circular areolations and with lightly sclerotised submarginal lines radiating inwards at right angles to margin. Dorsal setae (dset) slender, each with a flagellate apex, 15���30 ��m long, scattered on dorsum. Simple pores (sp) each 2.5���3.0 ��m wide, scattered evenly on dorsum. Preopercular pores (pop) each 4���6 ��m wide, scarce (7 on holotype), present anterior to anal plates (not counted on most Singapore females but numbering 6���10 pores in non-Singapore females). Dorsal microducts (dmic) in areolations each about 2.0��� 2.5 ��m wide, appearing bilocular under high magnification. Anal plates (anplt) each triangular with anterolateral margin either equal to or slightly longer than posterolateral margin, length of each plate 1.5���1.8 times width, inner lobes well developed, with a tessellated texture, each plate 170���185 ��m long, 100���145 ��m wide, anterolateral margin 110���160 ��m long, posterolateral margin 115���130 ��m long; each plate with 4���7 dorsal setae [females from Sabah with 6���11 setae; see Comments], each seta 15���30 ��m long. Anal ring (ar) bearing 10 setae, each 85���113 ��m long. Margin. Eyespots present on dorsal margin. Marginal setae (mset) in 1 row, each seta sharply spinose, with a pointed or bifurcate or fimbriate apex, 17���38 ��m long. Marginal setae between anterior and posterior stigmatic areas on each side of body totalling 6���12 [females from Sabah with 19���27 setae; see Comments]. Stigmatic setae (stgset) well developed, spinose with pointed apices, numbering 3 per cleft, median setae usually longest, each 17��� 40 ��m long, lateral setae each 10���28 ��m long. Venter. Derm membranous. Ventral setae (vset) slender, prevulvar pairs longest, each 17���60 ��m long, elsewhere shorter, each 10���23 ��m long, with submarginal setae each 10���15 ��m long. Interantennal setae in 2 or 3 pairs, each seta 10���25 ��m long. Ventral tubular ducts (vtd) present in a broad submarginal band; each duct with outer ductule about 15 ��m long, inner ductule 17���20 ��m long, and duct opening about 2 ��m wide. Ventral microducts (vmic) each about 2 ��m wide, scattered fairly evenly on venter. Pregenital disc-pores (pgp) each with 5���8 (mostly 6 and 7) loculi, each pore 5���6 ��m wide. Antennae (ant) each with 7, rarely 8, segments, 225���290 ��m long; fleshy setae present on distal 3 segments. Clypeolabral shield 230���263 ��m long, 230���255 ��m wide; labium 90���100 ��m long, 105���130 ��m wide. Legs with hind trochanter + femur 165���185 ��m long; hind tibia + tarsus 145��� 190 ��m long; all tarsal digitules each 26���33 ��m long; claw digitules each 20���30 ��m long, each claw 20���25 ��m long. Spiracles normal: anterior peritremes each 52���55 ��m wide; posterior peritremes each 57���70 ��m wide. Spiracular pores (spp) each 4 ��m wide, with 3���5 (mostly 5) loculi. Comments. Adult females of C. circularis can be distinguished from all other species of Coccus known from Macaranga by having the combination of (i) slender dorsal setae each> 10 ��m long and with a flagellate apex; (ii) marginal setae in a single row and with each seta spinose, 17���38 ��m long and with a pointed, divided or fimbriate apex; and (iii) anal plates each with 4���7 setae, each seta ��� 30 ��m long. Adult females of C. circularis are most similar to the adult females of C. macarangae in having fewer than 10 setae on each anal plate and some or many marginal setae that are apically fimbriate or bifurcate, but differ from C. macarangae in that the dorsal setae are sparser, generally shorter (��� 30 ��m long) and more slender, and the preopercular pores are usually smaller (5���6 ��m wide) and scarce (���10) in C. circularis (C. macarangae with some dorsal setae up to 40 ��m long and 20���50 preopercular pores each 5���11 ��m wide). Burkill's collections of this species were from two Macaranga species from Singapore. No specific locality was provided on the labels but, during Burkill's time, collections may have been made at various places on the island because there would have been more native vegetation present. Heckroth et al. (1998) mentioned only a single specimen of this species and provided no further information on it. Only specimens from three collections from the Crocker Range in Sabah on Borneo were sequenced for the phylogenetic reconstruction of Quek et al. (2017, fig. 3, Clade 4). These three adult females, referred to as C. near circularis, are very similar morphologically to specimens from Singapore and one from Peninsular Malaysia, but have a greater number (19���27) of marginal setae between the anterior and posterior spiracular clefts on each side of the body compared with the Singaporean and Peninsular Malaysian specimens (5���12 setae), generally shorter marginal setae (12���25 ��m long, but mostly 13���20 ��m, versus 17��� 38 ��m long), shorter dorsal setae (10���15 ��m versus 15���30 ��m long) and often more dorsal setae on each anal plate (6���11 versus 4���7). The specimens from the Crocker Range were collected at higher altitude and are geographically separated from populations found in Singapore and Peninsular Malaysia. There are a number of other specimens from Sabah (from Poring Hot Springs and near Ranau) that seem to be C. near circularis, but most of the specimens are mature, damaged or heavily stained. The latter, however, appear similar to the three females from the Crocker Range, although their marginal setae appear shorter (generally 10���18 ��m long). The single specimen from Brunei is also morphologically similar to the type specimens of C. circularis except that it has very few ventral tubular ducts on the head or the posterior abdomen. More samples are required for molecular analysis to determine the extent of any genetic variation among the regions., Published as part of Gullan, Penny J., Kondo, Takumasa, Fiala, Brigitte & Quek, Swee-Peck, 2018, Taxonomy of coccids (Hemiptera: Coccidae: Coccus L.) associated with Crematogaster ants (Hymenoptera: Formicidae) in the stems of Macaranga plants (Euphorbiaceae) in Southeast Asia, pp. 1-51 in Zootaxa 4521 (1) on pages 14-18, DOI: 10.11646/zootaxa.4521.1.1, http://zenodo.org/record/3770241, {"references":["Morrison, H. (1921) Some nondiaspine Coccidae from the Malay Peninsula, with descriptions of apparently new species. The Philippine Journal of Science, 18, 637 - 677.","Quek, S. P., Ueda, S., Gullan, P. J., Kondo, T., Hattori, M., Itioka, T., Murase, K. & Itino, T. (2017) Nuclear-DNA-based species delineations of Coccus scale insects in symbiosis with plants and ants, and the role of plant epicuticular wax in structuring associations. Biological Journal of the Linnean Society, 120 (4), 818 - 835. https: // doi. org / 10.1111 / bij. 12917","Heckroth, H. - P., Fiala, B., Gullan, P. J., Idris, A. H. & Maschwitz, U. (1998) The soft scale (Coccidae) associates of Malaysian ant-plants. Journal of Tropical Ecology, 14, 427 - 443. https: // doi. org / 10.1017 / S 0266467498000327"]}

Coccus lambirensis Gullan & Kondo sp. n. urn:lsid:zoobank.org:act: CBBDC76D-0BBC-4E83-86C3-9BB452F41D79 (Fig. 6) ��� Coccus sp. X���, Quek et al. 2017: 823 This species was referred to as ��� Coccus sp. X��� in Quek et al. (2017) (use of this name is not intended to be for nomenclatural purposes). The holotype listed below is the only known specimen and is a DNA voucher. Its nucleotide sequence data place it as sister to a specimen identified as Coccus near macarangicolus in figure 3 of Quek et al. (2017). Coccus X is sufficiently distinct morphologically to be described below as a new species. Type material examined. Holotype: young adult female, BORNEO: Sarawak, Lambir Hills National Park, ex Macaranga beccariana, 11���15 Aug. 2002, coll. T. Itioka, TI.s39, DNA voucher 1(1) (FDS). Etymology. This species is named after its collection locality, ���Lambir���, referring to a site in primary forest in Lambir Hills National Park, called Taman Negara Bukit Lambir in Malay. Adult female. Unmounted material. Unknown. Slide-mounted adult female (n=1; Fig. 6). Body oval, 2.83 mm long, 2.56 mm wide. Dorsum. Derm (dd) membranous, with irregular polygonal areas abutting each other, each with a central areolation, and with faint submarginal wrinkle lines radiating inwards from margin. Dorsal setae (dset) slender, flagellate, each 35���88 ��m long, longest from head to anterior abdomen and shortest on area lateral and posterior to anal plates. Simple pores (sp) each about 2.5 ��m wide, scattered evenly on dorsum. Preopercular pores (pop) each 3.8���7.5 ��m wide, 5 in number, present in a medial cluster anterior to anal plates. Dorsal microducts (dmic) in areolations each about 2.0��� 2.5 ��m wide, appearing bilocular under high magnification. Anal plates (anplt) each triangular but outer apex of each plate distorted (perhaps during slide preparation), anterolateral margin 1.3 times longer than posterolateral margin and both margins slightly convex, length of each plate 1.8 times width, inner lobes normal, each plate 200 ��m long, 110 ��m wide, anterolateral margin 162���163 ��m long, posterolateral margin 125 ��m long; each plate with 9 flagellate dorsal setae, each 10���40 ��m long. Anal ring (ar) probably bearing 10 setae (difficult to see), each 75���90 ��m long. Margin. Eyespots not detected. Marginal setae (mset) in 2 rows, each seta fairly robust and almost always flagellate at apex, 27���58 ��m long, with 41���45 setae between anterior and posterior stigmatic areas on each of body. Stigmatic setae (stgset) well developed, spinose with rounded apices, apparently 3 in number, median setae longest, each 25���45 ��m long, lateral setae each 15���35 ��m long. Venter (partially missing on holotype). Derm membranous. Ventral setae (vset) slender, mostly each 10���25 ��m long, except prevulvar setae each up to 88 ��m long. Interantennal setae missing due to damage to ventral cuticle. Ventral tubular ducts (vtd) present in a broad submarginal band; each duct with outer ductule 17���18 ��m long, inner ductule about 20 ��m long, and duct opening about 2 ��m wide. Ventral microducts (vmic) each about 2 ��m wide, scattered fairly evenly on venter. Pregenital disc-pores (pgp) each 6���8 ��m wide and mostly with 10 (occasionally 6, 8 or 9) loculi. Antennae (ant) 7 segmented, each 320 ��m long; fleshy setae present on last 2 segments. Clypeolabral shield missing; labium ~ 100 ��m long, ~ 100 ��m wide. Legs with hind trochanter + femur 172���175 ��m long; hind tibia + tarsus 195���200 ��m long; all tarsal digitules each 47���58 ��m long; claw digitules each 20���23 ��m long, claws each 27���28 ��m long. Spiracles normal: anterior peritremes each 62���63 ��m wide; posterior peritremes each 72���73 ��m wide. Spiracular pores (spp) each 4���5 ��m wide, usually with 5 (rarely 3 or 4) loculi. Comments. The adult female of C. lambirensis can be distinguished from all other species of Coccus found on Macaranga by its possession of numerous marginal setae in two rows and its long flagellate dorsal setae, each mostly 40���80 ��m long, that are longer than the dorsal setae of all other Macaranga coccids. Although adult females of C. pseudotumuliferus and C. tumuliferus group can have marginal setae in two rows, these two species have very short dorsal setae, each of about the same length as the diameter of its setal socket. In addition, in C. lambirensis, each dorsal areolation (clear area with microduct at centre) is situated on an irregularly shaped polygonal area with the abutting polygonal areas giving a cellular appearance to the derm, whereas in other species of Coccus from Macaranga the dorsal areolations are situated on uniform derm. Although molecular data placed C. lambirensis as sister to a specimen (SPQ.392 from Siduk in West Kalimantan) identified as C. near macarangicolus, it differs from that specimen and the examined syntype of C. macarangicolus (from Kuala Lumpur) in the length and shape of its dorsal setae as well as in the number of marginal setae (one row in C. macarangicolus). An unidentified adult female from Poring in Sabah (B. Fiala No. 30a) is similar to C. lambirensis in having a double marginal row of setae but its dorsal setae are shorter and slightly more robust and it has more than 30 preopercular pores anterior to the anal plates. The single adult female most similar to the holotype of C. lambirensis is from Panga in Thailand (probably Phang Nga province) on Xylocarpus granatum (Meliaceae), collected 8 March 2006 by Numakura and sent to TK. The latter unidentified specimen has similar dorsal and marginal setae to the holotype of C. lambirensis, with 45���57 marginal setae between the anterior and posterior stigmatic furrows on each side of body, but has more than 30 preopercular pores anterior to the anal plates. It is possible that Macaranga is not the usual host-plant genus of C. lambirensi s., Published as part of Gullan, Penny J., Kondo, Takumasa, Fiala, Brigitte & Quek, Swee-Peck, 2018, Taxonomy of coccids (Hemiptera: Coccidae: Coccus L.) associated with Crematogaster ants (Hymenoptera: Formicidae) in the stems of Macaranga plants (Euphorbiaceae) in Southeast Asia, pp. 1-51 in Zootaxa 4521 (1) on pages 20-22, DOI: 10.11646/zootaxa.4521.1.1, http://zenodo.org/record/3770241, {"references":["Quek, S. P., Ueda, S., Gullan, P. J., Kondo, T., Hattori, M., Itioka, T., Murase, K. & Itino, T. (2017) Nuclear-DNA-based species delineations of Coccus scale insects in symbiosis with plants and ants, and the role of plant epicuticular wax in structuring associations. Biological Journal of the Linnean Society, 120 (4), 818 - 835. https: // doi. org / 10.1111 / bij. 12917"]}

Coccus secretus Morrison urn:lsid:zoobank.org:act: DE21D89F-17C0-4AC6-8EEC-3D8CD663C7A4 (Figs 2F, 13) Coccus secretus Morrison, 1921: 662. Type material examined. Holotype: adult female, PENINSULAR MALAYSIA: Penang Island, in hollow stems of Macaranga triloba [now correctly named M. bancana], date not given, coll. I.H. Burkill, ex coll. E.E. Green, 1(2, holotype, clearly marked, and 1 paratype adult female) (USNM). Paratypes: PENINSULAR MALAYSIA: same slide as holotype, 1(3) (USNM; a second slide with immature female not seen); SINGAPORE: in hollow stems of Macaranga, date not given, coll. I.H. Burkill, 3(4) (USNM). Morrison (1921) noted slight morphological differences between the females from these two collections, in the length of the dorsal anal plate setae and the length of the middle spiracular seta, but considered these differences insignificant in terms of even varietal segregation. Examined non-type material from original collection. SINGAPORE: Selandar [= Selangor] forest, in hollow stem of Macaranga triloba [now correctly named M. bancana], date not given, coll. I.H. Burkill, 5-b, 1(6) (BMNH); same data as previous slide except '1318' (instead of 5-b), 1(3) (BMNH). PENINSULAR MALAYSIA: Penang Island, in hollow stems of M. triloba [now correctly named M. bancana], coll. I.H. Burkill, 2693, 6(11) (BMNH). These eight BMNH slides have the same data as the type collection listed above and the last two collections have the same Burkill collection numbers (1318 and 2693) as provided by Morrison (1921). However, none of the specimens are types, as explained in the Materials and methods. Other material examined. BORNEO: Brunei, Batu Apoi Forest Reserve, 4�� 33' N, 115�� 09' E, Macaranga sp., M. beccariana, M. tanarius [a doubtful identification, since this species is a non-myrmecophyte] & M. trachyphylla, 2���27 Aug. 1995, coll. P.J. Gullan, PJG-B2: 1(1), PJG-B7: 1(1), PJG-B8: 9(9), PJG-B11: 7(7), PJG- B46: 4(3 adult females & 1 third-instar female), PJG-B47: 5(5) & PJG-B50: 1(1); East Kalimantan, ~ 60 km NW of Balikpapan, 0�� 06' S, 117�� 10' E, 60���200 m, ex M. pearsonii, 15 & 16 Nov. 1992, coll. B. Fiala, #152 & #159a, 4(3 adult females & 1 second-instar female); East Kalimantan, Bukit Bangkirai, 1�� 1.497' S, 118�� 51.949' E, M. velutina, 13 Feb. 2005, coll. S.-P. Quek, SPQ.728, DNA voucher 1(1); East Kalimantan, Samarinda to Kota Bangun, 0�� 15.735' S, 116�� 39.667' E & 0�� 17.866' S, 116�� 41.446' E, M. motleyana & M. pearsonii, 11 June 2001, coll. S.-P. Quek, SPQ.324 & SPQ.325, DNA vouchers 2(2); North Kalimantan, Long Ampung, Sungai Anai trail, 1�� 42.973' N, 114�� 57.344' E, 700 m, ex M.? indistincta, 9 Feb. 2005, coll. S.-P. Quek, SPQ.695a&b, DNA vouchers 2(2); Sabah, Crocker Range, Keningaum to Ulu Kimanis trail, ~ 5.28�� N, ~ 116.05�� E, 250 m, ex. M. bancana, 19 Oct. 1999, coll. S.-P. Quek, SPQ.142 & SPQ.146, DNA vouchers 2(2); Sabah, Crocker Range, Tambunan to Kota Kinabalu Road, Rafflesia Reserve, 1200 m, ex M. hypoleuca, 15 Oct. 1999, coll. S.-P. Quek, SPQ.100a, DNA voucher 1(1); Sabah, Crocker Range, forest behind Tambunan, 600 m, ex M. hypoleuca & M. motleyana, 18 Oct. 1999, coll. S.-P. Quek, SPQ.116 & SPQ.120, DNA vouchers 2(2); Sabah, Luasong, ex M. indistincta & M. winkleri, 4 Sept. 2003, coll. B. Fiala, #95 & 96, 3(3); Sabah, Poring, logging road, ex M. pearsonii, 10 Mar. 2002, coll. B. Fiala, #2 (TK0102), DNA voucher 1(1); Sabah, Poring, 140 km NE of Kota Kinabalu, ~ 6�� N, ~ 116�� E, 500 m, ex M. beccariana & M. indistincta, 28 Oct. 1992 & 3 Nov. 1992, coll. B. Fiala, #8 & #34, 3(3); Sabah, Poring, 140 km NE of Kota Kinabalu, ~ 6�� N, ~ 116�� E, 500 m, ex M. pearsonii, 1 Nov. 1992, coll. B. Fiala, #28a, 4(4) (2 ANIC, 2 FRIM); Sabah, road to Sandakan, ex M. hypoleuca, 16 Feb. 1992, coll. B. Fiala, #12a, 3(3); Sabah, Tawau Hills, ex M. glandibracteolata, 5 Apr. 2001, coll. B. Fiala, #78a (TK0028), DNA voucher 1(1); Sabah, 10 km south of Ranau, ex M. pearsonii, no date, coll. H.-P. Heckroth, #1203, 1(1 with 2 adult females of C. pseudotumuliferus) (FRIM); Sabah, 60.5 km south of Ranau, ex M. hypoleuca, 1995, coll. H.-P. Heckroth, #629, 1(1 on slide with 1 adult female of C. pseudotumuliferus) (FRIM); Sarawak, Lambir, ex Macaranga sp. & M. kingii [the latter now named M. umbrosa], 24 Feb. 1992, coll. B. Fiala, #38a & #39a, 2(2); Sarawak, Lambir, ex M. bancana, M. hullettii & M. trachyphylla, 2003 or 2���4 Aug. 2003, coll. T. Itioka, TI.s32, TI.s38 & TI.s62, DNA vouchers 3(3) (FDS); Sarawak, 2 km Lambir, ex M. trachyphylla & M. hosei, Dec 1992. coll. H.-P. Heckroth, #72 & #85, 6(6); Sarawak, 3 km Lambir, ex M. trachyphylla, Dec 1992. coll. H.-P. Heckroth, #92, 4(4); South Kalimantan, Meratus Mts, Kapayang village, 966 m, ex M. bancana, 17 June 2001, coll. S.-P. Quek, SPQ.334, DNA voucher 1(1). PENINSULAR MALAYSIA: Johor, Mawai camp, ~ 1.871�� N, ~ 103.954�� E, M. hypoleuca & M. pruinosa, 5 Sept. 1999, coll. S.-P. Quek, SPQ.023a & SPQ.024, DNA vouchers 2(2); Johor, Sedili, 14 km from Route 3, M. pruinosa, 5 Dec. 1999, coll. S.-P. Quek, SPQ.180a, DNA voucher 1(1); Pahang, near Kuantan, Pancing Falls, M. bancana, 15 Sept. 1999, coll. S.-P. Quek, SPQ.059, DNA voucher 1(1); Pasoh, ex M. hosei & M. hypoleuca, Mar. 1992 & 11 Mar. 1992, coll. B. Fiala, #125a, #132a, 168a, 193a & 195a, 13(11 adult female & 2 third-instar females); Fraser's Hill, ex M. hosei, Mar. 1993, coll. H.-P. Heckroth, #280, 5(5) (2 ANIC, 3 FRIM); Genting, 950 m, ex M. hullettii, Mar. 1993, coll. H.-P. Heckroth, #212, #213 & 220, 14(14); Gombak, lower logging road, ex M. hosei, Feb. 1992, coll. H.P. Heckroth, #230, 4(4); Gombak, ex M. hosei, Feb. 1993, coll. H.-P. Heckroth, #214, #234 & #235, 9(7 adult females & 2 thirdinstar females); Gombak, lower logging road, ex M. triloba [now M. bancana] & M. hosei, Mar. 1993, coll. H.P. Heckroth, #209, #268 & #270, 7(7); Johor, Labis Air Panas, ex M. hosei, coll. H.-P. Heckroth, #1069, 1(1 on slide with 3 adult females of C. pseudotumuliferus) (FRIM); Sekinchang, ex M. pruinosa, Feb. 1993, coll. H.-P. Heckroth, #239, 5(3 adult females & 2 third-instar females including one with pharate adult). SINGAPORE: Bukit Timah Forest Reserve, inside stem of Macaranga, 1 Mar. 1994, coll. J.H. Martin, JHM6388, 6(23 adult females, 1 nymphal female & 6 first-instar nymphs) (BMNH); Bukit Timah, 1�� 21' N, 103�� 47' E, 100 m, inside stem of Macaranga, 8 Apr. 1989, coll. P.S. Ward, PSW10253, 4(4). SUMATRA: Gunung Leuser area, ~ 3�� 50' N, 97�� 40' E, ex M. hypoleuca, 31 Oct. 1993, coll. U. Maschwitz, sent by B. Fiala, #12a, 1(1); Ketambe, ~ 3�� 50' N, ~ 97�� 40' E, ex M. hypoleuca, 30 Oct. 1992, coll. U. Maschwitz, sent by B. Fiala, #1359, 2(2). Material examined from non- Macaranga host plants: PENINSULAR MALAYSIA: Selangor, Ulu Gombak, in Lepisanthus tetraphylla (Sapindaceae) in association with Crematogaster ants, 28 Mar. 1994, coll. G. Riedel, #94-125.2, 2(2); Selangor, Ulu Gombak, in Pometia pinnata (Sapindaceae) in association with Crematogaster ants, 19 Apr. 1994, coll. G. Riedel, #94-150.2, 5(5); Selangor, Ulu Gombak, ~ 300 m, ex hollow stem of Ryparosa fasciculata (Achariaceae) in association with ants of Cladomyrma?petalae, 20 Sept. 1993, coll. A. Moog, #93/161, 2(2); Selangor, Ulu Gombak, ex hollow stem of Strychnos vanprukii (Loganiaceae) in association with C.?petalae, 7 Mar. 1993, coll. A. Moog, #93/111, 1(1); Selangor, Ulu Gombak, ~ 300 m, ex hollow stem of S. vanprukii in association with Cladomyrma sp., 12 Jan. 1995, coll. A. Moog, #95/4, 1(1); Perak, road 59, 25 km to Tanah Rata, ex hollow stem of Saraca thaipingensis (Fabaceae) in association with C.?petalae, 13 Mar. 1993, coll. A. Moog, #93/116, 1(1). Adult female. Unmounted material. ���Slightly longer than wide, flat, the center usually slightly elevated, with faint radiating ridges around the margin, dirty pale brown, appearing as if covered with a thin film of dust;..��� (Morrison 1921: 662). Morrison���s description probably was based on dried specimens and thus differs in body colour from live specimens photographed from two regions in Borneo. Live adult females varied from pale yellowish-white to pale pink or dark pink (Fig. 2F), depending on age, with the dorsal wax appearing granular due to being composed of small irregularly shaped pieces, and the marginal stigmatic areas were often distinct due to accumulation of white wax. Slide-mounted adult female (n=34, including 7 paratypes; Fig. 13). Body oval, often broadest posteriorly, 1.2���3.4 mm long, 1.0��� 2.7 mm wide. Dorsum. Derm (dd) membranous and areolated, with very distinct, lightly sclerotised submarginal lines radiating inwards at right angles to margin. Dorsal setae (dset) very short, as long as or slightly longer than width of setal base, each 2.5���10.0 (4���5 ��m on paratypes) ��m long, tapering to a point, scattered on dorsum. Simple pores (sp) each 1.5���2.0 ��m wide, scattered evenly on dorsum. Preopercular pores (pop) circular to oval in shape, very variable in size and number (sometimes absent), if present each 2.5���7.5 ��m wide, scarce to numerous, in a group of 2���34 anterior to anal plates. Dorsal microducts (dmic) in areolations each about 2���3 ��m wide, appearing bilocular under high magnification. Anal plates (anplt) each almost subcircular with anterolateral margin slightly longer than posterolateral margin and lateral margin rounded, 1.9���2.7 (mostly 2.1���2.4) times longer than wide, often with apex slightly truncate or indented, inner lobes normal, membranous with a tessellated texture, each plate 140���203 ��m long, 65���85 ��m wide, anterolateral margin 98���150 ��m long, posterolateral margin 75���118 (usually 85���100) ��m long; each plate with 6���16 dorsal setae, each seta stout and typically ��� 2 ��m wide for most of length and 15���45 (mostly 20���30) ��m long with pointed, rounded or expanded apex; setae usually present on posterior two-thirds of each plate. Anal ring (ar) bearing 8 setae [Morrison (1921: 663) says 6 setae, but the thinner pair are difficult to see], each 70���95 ��m long. Margin. Eyespots present slightly removed from dorsal margin, each 12���25 ��m in maximum dimension, often not detected or hard to detect. Marginal setae (mset) sharply spinose, present in 1 row, each 12.5���35.0 (mostly 15��� 30) ��m long, with 10���21 setae between anterior and posterior stigmatic areas on each side of body. Stigmatic setae (stgset) well developed, almost always numbering 3 (very rarely 2) per cleft, sharply spinose, median setae longest, each 20���48 (mostly 25���35) ��m long, lateral setae each 10���33 (mostly 15���25) ��m long. Venter. Derm membranous. Ventral setae (vset) slender, longest submedially on posterior abdominal segments, each 17���70 ��m long, elsewhere shorter, each 10���18 ��m long. Interantennal setae usually numbering 2 pairs, each of a different length, with each seta of each pair either 15���25 ��m or 27���50 ��m long, more rarely 3 or 4 pairs with each seta 10���35 ��m long. Ventral tubular ducts (vtd) present in a broad submarginal band; each duct with outer ductule 12���15 ��m long, inner ductule 17���20 ��m long, and duct opening about 2 ��m wide. Ventral microducts (vmic) each 2���3 ��m wide, scattered fairly evenly on venter. Pregenital disc-pores (pgp) each with 4���8 (mostly 7) loculi, each pore 5���8 ��m wide. Antennae (ant) usually 6 (rarely 5) segmented, each 108���158 ��m long; apical segment 20���33 ��m long; fleshy setae present on last 3 segments when 6 segmented, and on last 2 segments when 5 segmented. Clypeolabral shield 180���250 ��m long, 163���213 ��m wide; labium 80���113 ��m long, 100���132 ��m wide. Legs very small, with hind trochanter + femur 38���68 ��m long; hind tibia + tarsus 43���80 ��m long; all tarsal digitules each 15���25 ��m long; claw digitules each 13���18 ��m long, claws each 10���15 ��m long. Spiracles normal: anterior peritremes each 50���88 ��m wide; posterior peritremes each 55���90 ��m wide. Spiracular pores (spp) each 4��� 6 ��m wide, with 2���7 (mostly 5) loculi. Comments. Adult females of C. secretus can be distinguished from all other species of Coccus known from Macaranga by having the combination of (1) short antennae (each C. secretus are most similar to the adult females of the C. tumuliferus group (C. caviramicolus, C. pseudotumuliferus and C. tumuliferus) in having very short dorsal setae but they differ from those females in that their dorsal setae each taper to a point (apex rounded in the other species), their marginal setae are never in 2 rows and never flagellate or fimbriate (sometimes in 2 or even 3 rows and often fimbriate or flagellate in the other species) and their anal plate setae mostly are longer (typically 20���30 ��m long) and distinctively broad for their full length (tapering to a point and usually ��� 20 ��m long in the other species). Specimens of C. secretus from non- Macaranga host plants were indistinguishable morphologically from females from Macaranga, although four of the five non- Macaranga females measured had a slightly larger length to width ratio for their anal plates (2.5���2.7) compared with Macaranga females (ratio never greater than 2.4). The analysis of Quek et al. (2017) using two nuclear genes found C. secretus to be separated from the other Coccus species on Macaranga by the placement of C. hesperidum. This topology also was recovered in one of the two mitochondrial data sets of Ueda et al. (2010). We have not been able to see and verify the identity of the specimen called C. hesperidum that was used in the papers of Ueda et al. (2008, 2010) and Quek et al. (2017), but its proximity to the Macaranga coccids in the nuclear DNA tree of Quek et al. (2017) is consistent with the observation that C. penangensis is close to C. hesperidum based on analysis of two ribosomal genes, one nuclear gene and COI (Lin et al. 2013). It seems that C. secretus is not closely related to the other specialist Coccus partners of the myrmecophytic Macaranga species. Further analyses including additional genes and a diversity of Coccus species are required to determine the relationships of C. secretus to other Coccus species. Coccus secretus is a widespread species occurring in both primary and secondary forests of Borneo, Peninsular Malaysia, Singapore and Sumatra (Heckroth et al. 1998; list of Material examined above). It also has been collected a number of times from inside the hollow stems of non- Macaranga host plants (see list above) even though such plants have been surveyed much less frequently than Macaranga. Heckroth et al. (1998) recorded C. secretus inside the hollow stems of both myrmecophytes and non-myrmecophytes in association with both the obligatory plant-ant genus Cladomyrma and non-specific Crematogaster species. Quek et al. (2017) found that C. secretus in most cases made up a small proportion of the coccid partners of the specialist Crematogaster ants and myrmecophytic Macaranga species. Thus, it is possible that C. secretus is a more facultative or opportunistic partner than the other Coccus species found in the system., Published as part of Gullan, Penny J., Kondo, Takumasa, Fiala, Brigitte & Quek, Swee-Peck, 2018, Taxonomy of coccids (Hemiptera: Coccidae: Coccus L.) associated with Crematogaster ants (Hymenoptera: Formicidae) in the stems of Macaranga plants (Euphorbiaceae) in Southeast Asia, pp. 1-51 in Zootaxa 4521 (1) on pages 39-43, DOI: 10.11646/zootaxa.4521.1.1, http://zenodo.org/record/3770241, {"references":["Morrison, H. (1921) Some nondiaspine Coccidae from the Malay Peninsula, with descriptions of apparently new species. The Philippine Journal of Science, 18, 637 - 677.","Quek, S. P., Ueda, S., Gullan, P. J., Kondo, T., Hattori, M., Itioka, T., Murase, K. & Itino, T. (2017) Nuclear-DNA-based species delineations of Coccus scale insects in symbiosis with plants and ants, and the role of plant epicuticular wax in structuring associations. Biological Journal of the Linnean Society, 120 (4), 818 - 835. https: // doi. org / 10.1111 / bij. 12917","Ueda, S., Quek, S. - P., Itioka, T., Murase, K. & Itino, T. (2010) Phylogeography of the Coccus scale insects inhabiting myrmecophytic Macaranga plants in Southeast Asia. Population Ecology, 52, 137 - 146. https: // doi. org / 10.1007 / s 10144 - 009 - 0162 - 4","Ueda, S., Quek, S. - P., Itioka, T., Inamori, K., Sato, Y., Murase, K. & Itino, T. (2008) An ancient tripartite symbiosis of plants, ants and scale insects. Proceedings of the Royal Society, B 275, 2319 - 2326. https: // doi. org / 10.1098 / rspb. 2008.0573","Lin, Y. - P., Kondo, T., Gullan, P. & Cook, L. G. (2013) Delimiting genera of scale insects: molecular and morphological evidence for synonymising Taiwansaissetia Tao, Wong and Chang with Coccus Linnaeus (Hemiptera: Coccoidea: Coccidae). Systematic Entomology, 38, 249 - 264. https: // doi. org / 10.1111 / j. 1365 - 3113.2012.00664. x","Heckroth, H. - P., Fiala, B., Gullan, P. J., Idris, A. H. & Maschwitz, U. (1998) The soft scale (Coccidae) associates of Malaysian ant-plants. Journal of Tropical Ecology, 14, 427 - 443. https: // doi. org / 10.1017 / S 0266467498000327"]}

Cryptes utzoni Lin, Kondo & Cook sp. n. (Fig. 4) urn:lsid:zoobank.org:act: 8509AE5F-35CB-4546-9E78-2217 ED214152 Material examined. Holotype. Adult female (ID: LGC02307 f6). Yeo Lake Nature Reserve, WA,/ Australia. - 28.08° S, 124.32° E./ ex Acacia aneura, 1.x.2013,/ L. G. Cook (WAM: 1 female on 1 slide). GenBank accession numbers: 18S: MH 844470; 28S: MH 886632; COI: MH 886618; EF-1 α: MH 886635. Paratype. Adult female (ID: LGC02307 f4). Same data as for holotype (WAM: 1 female on 1 slide). GenBank accession numbers: 18S: MH 844468; 28S: MH 886630; COI: MH 886616; EF-1 α: MH 886633. Paratype. Adult female (ID: LGC02307 f5). Same data as for holotype (ANIC: 1 female on 1 slide). GenBank accession numbers: 18S: MH 844469; 28S: MH886631; COI: MH886617; EF-1 α: MH886634. Paratypes. Adult females (ID: LGC02307 f1, LGC02307 f2). Same data as for holotype (WAM: 2 females on 2 slides). Paratypes. Adult females (ID: LGC02307 f3, LGC02307 f7, LGC02307 f8). Same data as for holotype (ANIC: 3 females on 3 slides). Diagnosis. Adult females of C. utzoni can be identified and distinguished from C. baccatus and A. hakearum by the following combination of morphological character states (the contrasting states for the other two species are given in Table 3): (i) live adult female with a pale linear stripe with irregular black borders running longitudinally from head to area anterior to anal plates on mid dorsum; slide-mounted female with (ii) dorsal setae of two sizes; (iii) tubular ducts abundant on body margin and submargin on dorsum; on venter, present throughout more abundant near margin, but absent from anterior to mouthparts (iv) each anal plate almost half-circular in shape, appearing crescentic when open, with three apical setae and two discal setae; (v) marginal setae setose, often with slightly curved apices; (vi) sclerotised areas on derm near stigmatic spines absent; (vii) anterior stigmatic areas each with two stigmatic spines, posterior stigmatic areas each with a single stigmatic spine; (viii) anal cleft shallow; (ix) each antenna 8-segmented; (x) cup-shaped invaginations of ventral tubular ducts of two sizes; (xi) tibio-tarsal articulatory sclerosis absent; (xii) claw denticle present; and (xiii) both claw digitules slender. Cryptes utzoni differs from C. baccatus at the following DNA sequence positions (mapped to the GenBank reference sequence listed for each gene). Dashes (-) represent deletions. 18S: Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH844467. Site# 156 (A), 171 (T), 252 (T), 314 (T). 28S: Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH886629. Site# 11 (T), 29 (G), 31–53 (TGGTCGTCGCGCTCGCGCGACGG), 55–56 (TT), 146 (C), 155 (A), 162–163 (GT), 176–193 (ACGTTTAGGCGTGCGTGG), 195 (T), 209 (A), 249 (A), 275 (G), 277–288 (TG), 280–281 (GT), 283 (A), 285 (G), 289–296 (AAAT----), 298–300 (TTA), 303–305 (CGC), 337 (C), 420 (A), 429–430 (--), 437–445 (--- ------), 4 47–450 (----), 453 (G), 456–459 (---A), 461 (A), 467 (A), 469–470 (AA), 477 (C), 485 (G), 554 (C), 572 (G), 576 (C), 598 (T), 600 (A), 604 (A), 607–608 (CT), 617 (G), 649–650 (AT), 661 (C), 677–688 (TGCTTTTCGGAG), 694–695 (CG), 701 (A). COI: Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH886615. Site# 6 (T), 9 (G), 27 (T), 32 (T), 64 (T), 66 (A), 69 (C), 90 (C), 96 (G), 108 (C), 120 (A), 126 (A), 133 (A), 135 (T), 142 (A), 159 (C), 177 (T), 207 (T), 221–223 (CAA), 227 (T), 234 (G), 241–242 (AC), 245–246 (GA), 248–249 (GA), 252 (G), 257 (A), 264 (G), 273 (A), 279 (T), 282–283 (AT), 288 (C), 300 (T), 303 (T), 306 (T), 342–343 (TA), 351 (A), 355 (T), 363 (T), 366 (G), 380–381 (GG), 387–388 (AT), 390 (G), 397 (A), 399 (T), 404 (G), 408 (G), 410 (A), 412 (A), 415–417 (TAT), 420 (T), 423–426 (AAGA), 435 (C), 438 (G), 447 (T), 453 (T), 456 (A), 459 (A), 466 (G), 477 (C), 489 (A), 492 (G), 534 (G), 543 (C), 546–547 (CT), 558 (A), 573 (C), 579 (T). EF-1α: Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH886640. Site# 15 (G), 66 (C), 87 (C), 102–103 (AC), 107 (G), 111 (C), 113 (C), 117–119 (TGG), 124 (T), 128 (A), 130–132 (TGT), 136–137 (AG), 143–144 (GT), 151 (C), 153 (T), 157 (A), 161 (C), 195 (C), 207 (C), 219 (T), 222 (A), 258 (C), 267 (C), 279 (C), 300 (T), 321 (G), 339 (C), 369 (G), 372 (T), 378–379 (TT), 399 (T), 408 (C), 423 (G), 426 (T), 451 (T), 455 (A), 458 (C), 463 (T), 467–470 (TTGT), 474–475 (GC), 483 (G), 486 (A), 490–491 (GT), 495 (C), 500 (A), 508–510 (TCT), 516 (C), 522 (C), 561 (T), 573 (T), 597 (T), 600 (T), 609 (T). Description. Adult female (Figs 4, 1B) (drawing and measurements based on eight specimens: LGC02307 f1 to LGC02307 f8, all in good condition). Unmounted specimens. Live adult female (Fig. 1B) body highly convex, truncated dorsally, yellowish to light brown in colour; with a white longitudinal stripe with irregular black border that is composed of pigments (which disappear during slide-mounting processes) running longitudinally from head to area anterior to anal plates on mid dorsum (Fig. 1); with some small, raised, irregularly-rounded black spots on the dorsum of unmounted specimens. Part of body margin covered by a thin layer of white wax, with ventral and upper part of body devoid of wax, at least on young females. All specimens were found on the stems of the host plant. Slide-mounted specimens. Body of young adult female (Fig. 4) circular, 2.0– 3.6 mm long, 1.5–3.4 mm wide. Dorsum. Dorsum mostly membranous but sclerotised around anal plates on older specimens (not illustrated on Figure 4 as drawing was based on a young adult female). Dorsal setae setose and of 2 sizes: (i) shorter setae each 8–10 Μ m long, sparsely scattered throughout dorsum except absent medially from end of head to anal plates; and (ii) longer setae each 20–40 Μ m long, restricted to a broad band submedially on each side. Dorsal tubular ducts of 1 type, each with a cup-shaped invagination 5–7 Μ m wide, a broad outer ductule 25–40 Μ m long, a narrow inner ductule 13–20 Μ m long, with a well-developed terminal gland; abundant in a broad marginal to submedial band around dorsum. Dorsal pores flat, simple and ovoid, each about 3–4 Μ m in maximum dimension, scattered throughout dorsum. Dorsal microducts, dorsal tubercles and preopercular pores absent. Anal plates each half- circular, 145–165 Μ m long, 50–65 Μ m wide; with 3 setae apically on each plate plus 2 discal setae, each seta 45–55 Μ m long. Ano-genital fold probably with 2 pairs of setae on anterior margin and 5 pairs laterally. Anal ring well sclerotised, 45–50 Μ m in diameter, probably bearing 5 pairs of setae, each about 125 Μ m long (but only 1 female, LGC02307 f5, could be measured). Margin. Marginal setae setose and often with apex slightly bent, 30–55 Μ m long, arranged in a single marginal row; with 11–18 setae on head between stigmatic areas, 2–5 on each side between anterior and posterior stigmatic areas, and 10–14 on each side of abdomen; marginal setae at apex of abdomen not differentiated from others. Anal cleft present, shallow. Stigmatic cleft absent; stigmatic spines each 21–30 Μ m long with a rounded apex, some with apex slightly bent; sometimes bifurcated in anterior stigmatic area (e.g., on specimen LGC02307 f7); with 2 spines in each anterior stigmatic area and with 1 in each posterior stigmatic area. No eyespots detected. Venter. Derm entirely membranous; segmentation visible on mid-areas of thorax and abdomen. Ventral setae setose, each 10–15 µ m long, sparsely scattered across venter. Pregenital segment (VII) with a single pair of pregenital setae, each seta 23–33 Μ m long. Multilocular disc-pores each about 8 Μ m in diameter and with 8–10 loculi; abundant around genital opening, becoming progressively less frequent across preceding abdominal segments where present in irregular transverse rows, plus in submedial clusters on each abdominal and meta- and mesothoracic segments. Each stigmatic furrow with a band of spiracular disc-pores, each pore mostly with 5 loculi and about 6 Μ m in diameter, with 22–25 pores present between each spiracle and body margin. Ventral microducts each with an outer ductule 3 Μ m wide and an inner ductule that divides into 2–4 long filaments; sparsely scattered throughout venter but abundant on head between antennae and posterior to labium. Ventral tubular ducts each with a broad outer ductule 25–33 Μ m long, and a narrow inner ductule 13–15 Μ m long with a well-developed terminal gland; ducts of two types: one with a cup-shaped invagination 5–7 Μ m wide, mostly present in a broad marginal to submarginal band and sparsely present in median areas of abdomen and thorax but absent from the area immediately anterior to mouthparts; and another with a cup-shaped invagination 4–5 Μ m wide present medially on thorax, especially near mouthparts. Spiracles well developed: anterior spiracle + peritreme 102–114 Μ m long, peritreme 48–66 Μ m wide; posterior spiracle + peritreme 108–120 Μ m long, peritreme 60–66 Μ m wide. Legs well developed; each with tibio-tarsal articulation but no articulatory sclerosis; each claw 33–36 Μ m long, with a denticle; both claw digitules fine and slightly shorter than thin tarsal digitules; trochanter + femur 1 50–180 Μ m and tibia + tarsus 150–180 Μ m. Antennae each with 8 segments, total length 210–252 Μ m; scape and pedicel each with about 2 setae, segments III and IV without setae, segment V with 1 short seta and 2 longer setae, segment VI with 1 fleshy seta, segment VII with 1 fleshy and 2 setose setae, and segment VIII with a pair of fleshy setae, about 4 stiff setae and 3 setose setae. Clypeolabral shield 192–210 Μ m long, 186–210 Μ m wide. Labium 66–72 Μ m long, 90–120 Μ m wide, with 3 pairs of setae. Etymology. The species epithet honours Danish architect Jørn Utzon, who designed the UNESCO World Heritage-Listed Sydney Opera House (Sydney, Australia) and frequently used sculptural curves in his designs. In life, the adult females of C. utzoni (Utzon's scale) and their tests invoke the curves of the arching white shells of the Sydney Opera House., Published as part of Lin, Yen-Po, Kondo, Takumasa, Gullan, Penny J. & Cook, Lyn G., 2018, A newly recognised species of Cryptes Maskell 1892 (Hemiptera: Coccidae) from Western Australia, pp. 101-114 in Zootaxa 4508 (1) on pages 108-112, DOI: 10.11646/zootaxa.4508.1.6, http://zenodo.org/record/2606878

Lin, Yen-Po, Kondo, Takumasa, Gullan, Penny J., Cook, Lyn G. (2018): A newly recognised species of Cryptes Maskell 1892 (Hemiptera: Coccidae) from Western Australia. Zootaxa 4508 (1): 101-114, DOI: https://doi.org/10.11646/zootaxa.4508.1.6

La libélula Erpetogomphus sabaleticus Williamson, 1918 (Odonata: Anisoptera: Gomphidae) se reporta por primera vez depredando a Diaphorina citri Kuwayama (Hemiptera: Liviidae). Se provee una lista compilada de más de 63 especies de enemigos naturales de D. citri distribuidos en siete órdenes y diecisiete familias de artrópodos (insectos y arañas).

La escama blanda Coccus moestus De Lotto, 1959 (Hemiptera: Coccidae) se registra por primera vez para Cuba. Los ejemplares fueron recolectados en la Ciénaga de Majaguillar, al noreste de la provincia de Matanzas, Cuba, sobre Calophyllum antillanum Britton (Calophyllaceae). La especie se diagnostica e ilustra con base en material colectado en este estudio. Se provee una clave taxonómica para separar las especies del género Coccus Linnaeus registradas en Cuba.

Kondo, Takumasa, González, Héctor (2018): Description of a new species of Toumeyella Cockerell (Hemiptera: Coccomorpha: Coccidae) on Crataegus mexicana Moc. and Sessé ex DC. (Rosaceae). Insecta Mundi 2018 (634): 1-9, DOI: http://doi.org/10.5281/zenodo.4645883, {"references":["Moorillon. 2011. Moleculas pecticas: extraccion y su potencial aplicacion como empaque. Tecnociencia Chihuahua 5: 76-82.","Barrera, J. F. 2008. Coffee pests and their management. p. 961-998. In: J. L. Capinera (ed.). Ency- clopedia of Entomology. 2nd ed. Springer. Dordrecht; The Netherlands. 4346 p.","Borys, M. W., and H. Leszczynska-Borys. 2004. Roots attributes of Mexican Crataegus spp. trees. Revista Chapingo Serie Horticultura 10: 85-95. Available at https://chapingo.mx/revistas/revistas/ articulos/doc/rchshX181.pdf. (Last accessed January 18, 2018.)","Clarke, S. R., G. L. DeBarr, and C. W. Berisford. 1989. The life history of Toumeyella pini (King) (Homoptera: Coccidae) in loblolly pine seed orchards in Georgia. The Canadian Entomologist 121(10): 853-860.","Cockerell, T. D. A. 1895. New scale-insects from Arizona. Bulletin Arizona Agricultural Experiment Station 14: 1-56.","Garcia Morales, M., B. D. Denno, D. R. Miller, G. L. Miller, Y. Ben-Dov, and N. B. Hardy. 2016. ScaleNet: A literature-based model of scale insect biology and systematics. Database. Available at http://scalenet.info. (Last accessed January 18, 2018.)","Garonna, A. P., S. Scarpato, F. Vicinanza, and B. Espinosa. 2015. First report of Toumeyella parvicornis (Cockerell) in Europe (Hemiptera: Coccidae). Zootaxa 3949(1): 142-146.","Hamon, A. B., and M. L. Williams. 1984. The soft scale insects of Florida (Homoptera: Coccoidea: Coccidae). Arthropods of Florida and Neighboring Land Areas. Florida Department of Agriculture & Consumer Services, Division of Plant Industries, Gainesville. 194 p.","ICZN. 1999. International Code of Zoological Nomenclature. Fourth Edition. The International Trust for Zoological Nomenclature; London, UK. 306 p.","Kondo, T. 2013. A new species of Toumeyella Cockerell (Hemiptera: Coccoidea: Coccidae) on coffee roots, Coffea arabica L. (Rubiaceae), from Colombia and Venezuela. Revista Corpoica - Ciencia y Tecnologia Agropecuaria 14(1): 39-51.","Kondo, T. 2018. A new combination and an update of Neotoumeyella Kondo and Williams, 2009 (Hemiptera: Coccomorpha: Coccidae). Insecta Mundi 0618: 1-5.","Kondo, T., and H. Gonzalez. 2014. A new species of Toumeyella Cockerell (Hemiptera: Coccidae) on Myrtillocactus geometrizans (Cactaceae) from Mexico with a checklist of known species of Toumeyella. Insecta Mundi 0396: 1-10.","Kondo, T., and G. Pellizzari. 2011. Description of a new species of Toumeyella Cockerell (Hemiptera: Coccidae) from Mexico; with a taxonomic key to Mexican species. Revista Brasileira de Entomologia 55(2): 229-233.","Kondo, T., and M. L. Williams. 2003a. A new species of Toumeyella (Hemiptera: Coccoidea: Coccidae) on Erythrina in Mexico. TIP Revista Especializada en Ciencias Quimico-Biologicas 6(1): 11-15.","Kondo, T., and M. L. Williams. 2003b. Redescription of the Mexican soft scale insect Toumeyella sallei (Signoret, 1874), comb. n. (Insecta: Hemiptera: Coccidae). Annalen des Naturhistorischen Museums in Wien Serie B Botanik and Zoologie 105B: 211-215.","Kondo, T., and M. L. Williams. 2009. Redescriptions of Neolecanium leucaenae Ckll., Toumeyella cerifera Ferris and T. sonorensis Ckll. & Parrott and their transfer to Neotoumeyella gen. nov. (Hemiptera: Coccidae), with descriptions of two new species from the southeastern U.S.A. and Colombia, South America. International Journal of Insect Science 2: 11-27.","Malumphy, C., M. A. Hamilton, B. N. Manco, W. C. Green, M. D. Sanchez, M. Corcoran, and E. Salamanca. 2012. Toumeyella parvicornis (Hemiptera: Coccidae) causing severe decline of Pinus caribaea var. bahamensis in the Turks and Caicos Islands. Florida Entomologist 95(1): 113-119.","Myartseva, S. N., E. Ruiz-Cancino, J. M. Coronado-Blanco, J. R. Lomeli-Flores, and R. C. Hernandez-de la Cruz. 2016. Parasitoids (Hymenoptera: Chalcidoidea) of Toumeyella scales (Hemiptera: Coccidae) in the New World, with description of a new species from Mexico. Florida Entomologist 99(4): 781-784.","Nieto-Angel, R., A. Barrientos-Villasenor, and M. W. Borys. 1996. Domesticacion del tejocote (Crataegus spp.) en Mexico, un potencial fruticola. ITEA volumen extra No. 17: 229-235.","Nunez Colin, C. A., D. Escobedo Lopez, M. A. Hernandez-Martinez, and C. Ortega Rodriguez. 2012. Modelos de las zonas adecuadas de adaptacion del tejocote (Crateagus mexicana), por efecto del cambio climatico. Agronomia Mesoamericana 23: 241-246. Available at http://www.scielo.sa.cr/ pdf/mlcr/v23n2/a03v23n2.pdf. (Last accessed January 18, 2018.)","Vivar-Vera, M. A, J. A. Salazar-Montoya, G. Calva-Calva, E. G. Ramos-Ramirez. 2007. Extraction, thermal stability and kinetic behavior of pectinmethylesterase from hawthorn (Crataegus pubescens) fruit. Food Science and Technology 40: 278-284.","Williams, D. J., and M. C. Granara de Willink. 1992. Mealybugs of Central and South America. CAB International; London, U.K. 635 p.","Williams, M. L., and T. Kondo. 2008. Status and current composition of the soft scale insect genus Toumeyella (Hemiptera: Coccoidea). p. 29-32. In: M. Branco, J. C. Franco, and C. Hodgson (eds.). Proceedings of the XIth International Symposium on Scale Insect Studies. September 24-27, 2007; Oeiras, Portugal. 322 p.","Williams, M. L., and M. Kosztarab. 1972. Morphology and systematics of the Coccidae of Virginia with notes on their biology (Homoptera: Coccoidea). Research Division Bulletin, Virginia Polytechnic Institute and State University 74: 1-215."]}

Toumeyella crataegi Kondo and Gonz��lez, sp. nov. Description. Adult female (Fig. 1 and 2)., Published as part of Kondo, Takumasa & Gonz��lez, H��ctor, 2018, Description of a new species of Toumeyella Cockerell (Hemiptera: Coccomorpha: Coccidae) on Crataegus mexicana Moc. and Sess�� ex DC. (Rosaceae), pp. 1-9 in Insecta Mundi 2018 (634) on page 3, DOI: 10.5281/zenodo.4645883

Cryptinglisia ica Montes & Kondo (Figs 1F, 3) Proposed common names. Spanish: Escama blanda del Ica; English: Ica��s rosemary scale. Type material studied. Holotype. Adult female. COLOMBIA: Antioqu��a: San Vicente, vereda El Porvenir, finca Villa Mar��a, 22.ix.2014, coll. Maria Fernanda Diaz, ex Rosmarinus officinalis, ICA No. 14-991-5, 1(1) (CTNI). Paratypes. Same data as Holoype except: No. 14-991: 9(9), No. 14-991-2: 1(1), No. 14-991-4: 1(1) (CTNI), 5(5) (USNM); Antioqu��a: municipio Rionegro, vereda Rio Abajo, finca Cultivos del R��o, 18.xi.2014, coll. Mar��a Fernanda Diaz, ex R. officinalis, ICA No. 14-1494-1, 14-1494-2, 14-1494-3, 14-1494-4, 14-1494-5, 5(5) (CTNI). Adult female (measurements based on n=22) Unmounted material (Fig. 1F). Adult female oval, slightly convex, border of margins thickened. Alcoholpreserved specimens reddish brown to yellowish brown. Insects covered by a shiny and vitreous layer of semitransparent, striated brittle wax; with a visible midline that divides the wax cover into two halves (Fig. 1F). Slide-mounted material (Fig. 3). Body 1.23���1.95 (1.27) mm long, 0.78���1.48 (0.87) mm wide, oval. Dorsum. Derm membranous, without areolations. In older specimens a dorsal longitudinal sclerotized line becomes visible. Dorsal setae absent. Dorsal microducts oval, bilocular, each about 1.8���2.0 ��m wide, scattered over dorsum, present in a continuous row around body margin and abundant on a mid-longitudinal line, intermixed with simple pores and preopercular pores. Simple pores of 2 sizes: i) a small pore, each 2.0��� 2.2 ��m wide, scattered throughout dorsum, more abundant in a continuous row around body margin and in a mid-dorsal longitudinal line; and a larger pore, each about 3.0 ��m wide, sparsely scattered over dorsum. Dorsal tubular ducts, dorsal tubercles and pocket-like sclerotizations absent. Preopercular pores circular, each about 2.5���5.0 ��m wide, with a thick rim, extending along midline from area anterior to anal plates anteriorly to about mesothorax or metathorax, some pores occasionally present on area laterad to anal plates. Anal plates together subquadrate, plates located at about 1/5 of body length from posterior margin, each plate 110.0���127.5 (120.0���122.5) ��m long, 62.5���82.5 (70.0���72.5) ��m wide, anterolateral margin 75.0���100.0 (77.5���87.5) ��m long, posterolateral margin 70.0���95.0 (90.0���92.5) ��m long, with about 4 bluntly spinose apical setae, 1 pair of sharply spinose fringe setae, and about 5 long ventral subapical setae; hypopygial setae not detected. Anal ring bearing 6 setae. A sclerotic area present around anal plates. Margin. Marginal setae spinose and conical, straight, present in a continuous row around body, most setae each 25.0��� 37.5 ��m long, longest setae at apex up to 50 ��m long, each base 10.0��� 12.5 ��m wide at widest point (width of sclerotized setal socket); 1 or 2 pairs of marginal setae present next to stigmatic setae, often on dorsal submargin; with about 20���27 (25) setae on each side between anterior and posterior stigmatic areas. Stigmatic clefts very shallow or absent. Stigmatic spines sharply spinose, straight, gradually tapering to a point, present on dorsal submargin, with 1 stigmatic spine in each stigmatic area, anterior stigmatic setae each 60.0���70.0 (60.0���62.5) ��m long, posterior stigmatic setae each 62.5���80 (62.5���65.0) ��m long. Eyes each about 25.0���32.5 (25) ��m wide, located on margin between marginal setae. Venter. Derm entirely membranous. Perivulvar pores each 4.0���6.0 ��m wide, each with mainly 5 loculi, rarely with 4 or 6 loculi, present in a group of about 5���20 pores on each side along anal fold just posterior to vulvar area, with a few pores present anteriorly up to area of posterior legs. Spiracular pores each 4.0���6.0 ��m wide, mostly with 5 loculi, but with occasional pores with 3 or 4 loculi and 6���10 loculi, pores often fused, largest pores 6.5���7.5 ��m wide; present in a band about 2���5 pores wide, with line of pores extending laterally from each spiracle to body margin and slightly onto dorsum up to base of each stigmatic seta. Ventral microducts each 2.0���3.0 ��m wide, scattered throughout venter, most abundant in a submarginal band, absent from anterior to vulva on last 2 abdominal segments and around body margin. Simple pores present on ventral margin only, scattered, absent from elsewhere on venter, each pore circular, about 2.0��� 2.2 ��m wide, similar in shape and size to the smaller simple pores on dorsum. Ventral tubular ducts present in a submarginal band and also scattered medially on venter, on head, thorax and abdomen, absent from last 2 abdominal segments anterior to vulva and body margin; outer ductule 30.0���50.0 ��m long, inner ductule 15.0��� 22.5 ��m long, with terminal filament ending in a flower-shaped gland. Ventral setae slender, straight or slightly bent, each 7.5���15.0 ��m long, present on all abdominal segments; setae on last 3 abdominal segments thicker, 15.0���20.0 ��m long; ventral submarginal setae present in a single row, stouter than other ventral setae, each 10.0��� 17.5 ��m long; with a pair of thick and long ventral cephalic setae, each 32.5��� 42.5 ��m long, and a thick and long large anal lobe seta present at apex of each posterior anal lobe, each seta tapering to a point, rarely bifurcate, 20.0��� 42.5 ��m long. Spiracles well developed, anterior spiracular peritremes each 70.0���80.0 (70.0���72.5) ��m long, 42.5���50.0 (42.5���47.5) ��m wide, posterior peritremes each 65.0���77.5 (65.0��� 72.5) ��m long, 42.5���50.0 (45.0���47.5) ��m wide, with a slight sclerotization around each spiracle; quinquelocular pores present within atrium, totalling about 3���10 per spiracular sclerotization, often hard to detect. Legs well developed, each coxa (excluding coxal process) 107.5���127.5 (107.5���122.5) ��m long, trochanter + femur 157.5��� 175.0 (157.5���165.0) ��m long; tibia + tarsus 200.0���225.0 (200.0���222.5) ��m long, without a tibio-tarsal sclerosis; claw 20.0���25.0 (20.0���22.5) ��m long, without a denticle. Tarsal digitules similar, knobbed, shorter digitule 35.0��� 42.5 (35.0���42.5) ��m long, longer digitule 40.0���62.5 (40.0���62.5) ��m long; claw digitules similar and broad, each 20.0���25.0 (22.5���25.0) ��m long. Antennae each 230���270.0 (235���250) ��m long, 7 or 8 segmented (one specimen with a 6-segmented antenna on left side), with fleshy setae present on last 3 (rarely 2) antennal segments; with a very long, slender seta present on segment II. Interantennal setae numbering 3 or 4 pairs, each seta 10.0���67.0 ��m long. Mouthparts relatively large; clypeolabral shield 160.0���200.0 (172.5) ��m long, 145.0���165.0 (145.0) ��m wide; labium 1 segmented, 57.5���87.5 (82.5) ��m long, 95.0���125.0 (97.5) ��m wide, with 4 pairs of labial setae; basal part of labium membranous. Diagnosis. The adult female of C. ica can be diagnosed by the combination of the following features: (1) insects covered by a shiny and vitreous layer of semi-transparent, striated, brittle wax; with a visible midline that divides the wax cover into 2 halves; (2) dorsal derm membranous, without areolations; (3) dorsal microducts bilocular, scattered over dorsum and in a continuous row around body margin, and abundant in a mid-longitudinal line; (4) dorsal simple pores of 2 sizes, (5) preopercular pores each with a thick rim, present along midline from area anterior to anal plates anteriorly to about mesothorax or metathorax; (6) anal plates together subquadrate, each plate with about 4 bluntly spinose apical setae, 1 pair of sharply spinose fringe setae, and about 5 long ventral subapical setae, but without hypopygial setae; (7) anal ring bearing 6 setae; (8) marginal setae of 1 type, spinose and conical, straight, present in a continuous row around body; (9) 1 stigmatic spine per stigmatic area; (10) ventral microducts scattered throughout venter, most abundant in a submarginal band, absent from anterior to vulva on last two abdominal segments and from around margins; (11) simple pores present on ventral margin only, scattered, absent from elsewhere on venter; (12) ventral tubular ducts in a submarginal band and also scattered medially on head, thorax and abdomen, absent from last 2 abdominal segments anterior to vulva and along body margin; (13) a pair of submarginal thick, large ventral setae present anteriorly on head, 1 also present at apex of each anal lobe; (14) antennae each 7 or 8 segmented. Etymology. The species is named after the Instituto Colombiano Agropecuario [Colombian Agricultural and Livestock Institute] (ICA). The species epithet is a noun in apposition. Notes. Cryptinglisia ica sp. nov. was found on rosemary in the department of Antioquia, Colombia. Other material studied. Saissetia coffeae (Walker). COLOMBIA: Cundinamarca: Municipio de Subachoque, vereda Galdamez, Hacienda el Hato, 4.91608�� N, - 74.16416�� W, 4.xii.2014, coll. Angela Castro / Vicente Triana, ex Rosmarinus officinalis, No. 0000004, 1(1) (ICALNDF); Cundinamarca: municipio de Anolaima, vereda La Pica, finca Las Teresitas, 4.78739�� N, - 74.41674�� W, 2309 m a.s.l., 5.ix.2017. coll. Karen Morales, ex R. officinalis, No. 0000272, 2(2) (ICALNDF); Cundinamarca: municipio de Alb��n, vereda Trinidad, finca Villa Mercedes, 4.52491�� N, - 74.2898�� W, 1711 m a.s.l., 5.xi.2017, coll. Karen Morales, ex R. officinalis, No. 0000270, 3(3) (ICALNDF); Cundinamarca: municipio de El Rosal, vereda Punta de Cuero, finca Cristian��a, 4.83935�� N, - 74.2591�� W, 2589 m a.s.l., 5.xi.2017, coll. Karen Morales, ex R. officinalis, No. 0000271, 3(4) (ICALNDF); Cundinamarca: municipio de La Ceja, vereda San Nicol��s, finca Claro de Luna, 22.ix.2014, coll. Mar��a Fernanda D��az, ex R. officinalis, No. 0000389, 1(1) (ICALNDF). Parasaissetia nigra (Nietner). Colombia: Antioquia: Municipio de Guarne, vereda Chaparral, finca Pure organics, 22.ix.2014, coll. Mar��a Fernanda D��az, ex R. officinalis, No. 0000390, 3(3) (ICALNDF)., Published as part of Kondo, Takumasa, Rodr��guez, Jos�� Mauricio Montes, D��az, Mar��a Fernanda, Luna, Oscar Javier Dix & Goenaga, Edgard Palacio, 2018, Description of two new species of Cryptinglisia Cockerell (Hemiptera: Coccomorpha: Coccidae) associated with rosemary, Rosmarinus officinalis L. (Lamiaceae) in Colombia, pp. 379-390 in Zootaxa 4420 (3) on pages 386-389, DOI: 10.11646/zootaxa.4420.3.4, http://zenodo.org/record/1455363

Cryptinglisia corpoica Kondo & Montes, sp. nov. (Figs 1A, B & C; 2) Proposed common names. Spanish: Escama blanda de Corpoica; English: Corpoica��s rosemary scale. Type material studied. Holotype. Adult female. COLOMBIA: Antioquia: San Vicente, vereda Altos de la Campi��a, Finca Bioga, 18.xi.2014, coll. Maria Fernanda Diaz, ex Rosmarinus officinalis, ICA No. 14-1496-3: 1(1) (CTNI). Paratypes. Same data as holotype, except: ICA No. 14-1496, 14-1496-1, 14-1496-2, 14-1496-3: 3(3) (CTNI); Antioquia: Marinilla, Las Mercedes, 6.15632�� N, - 75.33821�� W, 2112 m a.s.l., 27.v.2015, coll. Andrea Villegas, ex R. officinalis, No. 0000047, 1(1) (ICALNDF); Boyac��: Villa de Leyva, vereda Monquir��, finca Villa Paola, 3.vi.2015, coll. Maria Fernanda Diaz, ex R. officinalis, ICA No. 15-1796, 2(2) (CTNI). Boyac��: Villa de Leyva, vereda Cardonal, finca La Pila, 3.vi.2015, coll. Mar��a Fernanda Diaz, ex R. officinalis, ICA No. 15-1797, 2(2) (CTNI); Boyac��: S��chica, vereda El Espino, finca Samicha, 3.vi.2015, coll. Maria Fernanda Diaz, ex R. officinalis, ICA No. 15-1798, 1(1) (CTNI). Cundinamarca: Bogot��, vereda Chorrillo, finca Coruntas, ca 2500 m a.s.l., 4�� 34��� N, 74�� 17��� W, 12.xii.2014, coll. V. Triana and A. Castro, ex R. officinalis, ICA No. 1410753, 1(1) (CTNI); Cundinamarca: Granada, San Jos��, finca La Conquista, 4.52508�� N, - 74.33865�� W, 2501 m a.s.l., 31.x.2016, coll. Marcela Useche, ex R. officinalis, No. 0000423, 1(1) (ICALNDF), same data except: 4�� 54��� N, 74�� 10��� W, ICA No. 1607745, 1(1) (CTNI); Cundinamarca: Subachoque, vereda Galdamez, finca El Hato, 4�� 54��� N, 74�� 9��� W, 2722 m a.s.l., 11.ix.2015, coll. E.D. Espinosa-M., ex R. officinalis, 1(1) (CTNI); Cundinamarca: Subachoque, Galdamez, El Hato, 4.55054�� N, - 74.09888�� W, 2665 m a.s.l., 22.v.2017, coll. Marcela Useche, ex R. officinalis, No. 0000442, 1(1) (ICALNDF); Cundinamarca: Subachoque, vereda Galdamez, finca El Hato, 4.vi.2015, coll. Oscar J. Dix Luna, ex R. officinalis, 33 slides (55 adult females, 2 second-instar nymphs + 9 first-instar nymphs) (CTNI), 5(5) (USNM); Cundinamarca: Subachoque, vereda Galdamez, finca Hacienda El Hato, 13.v.2015, coll. Angela Castro, ex R. officinalis, ICA No. 15-1471 4 (4) (CTNI); Cundinamarca: Subachoque, vereda Galdamez, finca El Danubio, 4�� 30���01��� N, 74�� 21���12��� W, 2230 m a.s.l., 6.viii.2014, coll. Maria F. Diaz, ex R. officinalis, 3(7) (CTNI); Cundinamarca: Rosal, Buena Vista, Zerta, 4.87986�� N, - 74.25831�� W, 2711 m a.s.l., 22.v.2017, coll. Marcela Useche, ex R. officinalis, No. 0000441, 1(1) (ICALNDF); Cundinamarca: Simijaca, El Pantano, Lote Santamar��a, 5.30508�� N, - 73.47838�� W, 2555 m a.s.l., 25.iv.2017, coll. Marcela Useche, ex R. officinalis, No. 0000180, 1(1) (ICALNDF); Cundinamarca: Tena, vereda Catalomonte, finca La Tartaria, 23.vi.2015, coll. Mar��a Fernanda Diaz, ex R. officinalis, No. 0960, No. 0957, No. 0958, 3(6) (CTNI); same data except: ICA No. 15-2372, 2(2) (CTNI). Adult female (measurements based on n=50). Unmounted material (Fig. 1A). Adult female in life about 1.5���4.0 mm long, 1.0���3.0 mm wide, oval, slightly convex. Test glassy, whitish to semi-transparent, of a granulose texture. Body creamy yellow to brownish. Anal plates and sclerotization around anal plates reddish brown (Figs 1A, B & D). Second-instar nymphs light yellowgreen and covered by a glassy semi-transparent test (Fig. 1C). Slide-mounted material (Fig. 2). Body 1.40���3.83 (1.92) mm long, 0.98���2.90 (1.56) mm wide, oval. Dorsum. Derm membranous, with areolations clearly visible over entire dorsum in older specimens. Dorsal setae absent. Dorsal microducts each oval, bilocular, about 2.0 ��m wide, fairly abundant, scattered over dorsum. Simple pores each 1.4���3.4 (mostly 2.0���3.0) ��m wide, fairly abundant, scattered over dorsum. Dorsal tubular ducts, dorsal tubercles and pocket-like sclerotizations absent. Preopercular pores circular, with a thick rim, each about 2.5���4.0 ��m wide, extending anteriorly along midline from area anterior to anal plates to about mesothorax, some pores occasionally present on area laterad to anal plates. Anal plates together subquadrate, located at about 1/5 of body length from posterior margin, each plate 97.5���115.0 (97.5���102.5) ��m long, 12.5���60.0 (50.0���52.5) ��m wide, anterolateral margin 50.0���80.0 (67.5���80.0) ��m long, posterolateral margin 67.5���80.0 (67.5���72.5) ��m long, with about 4 bluntly spinose setae on dorsal surface: 3 apical and 1 inner marginal seta; anogenital fold with 4 long, sharply spinose fringe setae; ventral subapical setae and hypopygial setae not detected; anal plates often heavily sclerotized, so structural details difficult to observe in most specimens. Anal ring bearing 6 setae. A sclerotic area present around anal plates. Margin. Marginal setae each spinose and conical, with a bulbous base, straight, 12���30 ��m long, some setae evidently much shorter than others, arranged in a single irregular row, with 3���10 (7���9) on each side between anterior and posterior stigmatic areas. Stigmatic clefts very shallow or absent. Stigmatic spines sharply spinose, straight or slightly curved, gradually or abruptly tapering to a point, rarely bifurcate; anterior stigmatic spines totalling 1 (rarely 2) in each anterior stigmatic area, each 51.0���112.5 (77.5���85.0) ��m long; posterior stigmatic spines totalling 1 or 2 (1 on holotype) in each stigmatic area, each 68.0���120.0 (100.0���110.0) ��m long. Eyes well developed, circular, domed, each 20���30 (20) ��m wide, located on dorsal margin, often between marginal setae. Venter. Derm entirely membranous. Perivulvar pores each 4.0��� 5.5 ��m wide, mainly with 5 loculi (rarely a pore with 4, 6, 7 or 8 loculi), present in a group of 11���16 pores on each side along anal fold just posterior to vulvar area. Spiracular pores each 3.0���5.0 ��m wide, mostly with 5 loculi (but occasional pores with 3 or 4 loculi), present in a narrow band about 2 or 3 pores wide, extending laterally from each spiracle to body margin; each anterior pore band with 14���27 (14���15) spiracular pores, each posterior spiracular pore band with 25���40 (17���24) spiracular pores. Ventral microducts each about 2.5���3.0 ��m wide, scarce on mid venter, absent from around margins but abundant in a submarginal band. Simple pores scattered on ventral margin and submargin, absent from mid venter, each pore circular, about 2.0���3.0 ��m wide, similar in shape and size to simple pores on dorsum. Ventral tubular ducts present in a submarginal band and scattered on mid venter; each duct with outer ductule 17.5���20.0 ��m long, inner ductule 7.5���10.0 ��m long, with terminal filament ending in a flower-shaped gland. Ventral setae slender, straight or slightly bent, present on all abdominal segments and submedially around body, each 6.3���17.0 ��m long; ventral submarginal setae slender, straight or slightly bent, stouter than other ventral setae, each 10���16 ��m long; long prevulvar setae absent. Spiracles well developed, with a sclerotization around each spiracle, anterior spiracular sclerotization 60.0���105.0 (60.0���75.0) ��m long, 42.5���92.5 (62.5���65.0) ��m wide, posterior spiracular sclerotization 65.0���112.5 (60.0���77.5) ��m long, 42.5���115.0 (62.5���65.0) ��m wide; quinquelocular pores present within atrium, totalling about 3���8 per spiracular sclerotization, often hard to detect. Legs well developed, each coxa (excluding coxal process) 100.0���117.5 (97.5���112.5) ��m long, trochanter + femur 140.0���157.5 (137.5���150.0) ��m long; tibia + tarsus 187.5���230.0 (187.5���222.0) ��m long, without tibio-tarsal sclerosis; claw 15.0��� 22.5 ��m (20.0���22.5) long, with a minute denticle. Tarsal digitules both knobbed, one shorter than other, shorter digitule 37.5���42.5 (37.5���40.0) ��m long, longer digitule 45.0���52.5 (45.0���50.0) ��m long; claw digitules similar and broad, each 15.0���25.0 (20.0���25.0) ��m long. Antennae each 182���250 (192.5���195.0) ��m long, usually with 6, more rarely 7 segments (6 in holotype); fleshy setae generally present on last 3 antennal segments, although specimens with fleshy setae on last 2 antennal segments also present; segments II and IV each usually with a very long slender seta. With 3 or 4 pairs of interantennal setae, each seta 12.5���50.0 ��m long. Mouthparts relatively large; clypeolabral shield 145.0���187.5 (180) ��m long, 127.5���160.0 (150) ��m wide; labium 1 segmented, 75.0���105.0 (92.5) ��m long, 77.5���130.0 (127.5) ��m wide, with 4 pairs of labial setae. Diagnosis. The adult female of C. corpoica can be diagnosed by the combination of the following features: (1) test glassy, whitish to semi-transparent, of a granulose texture; (2) dorsal derm with areolations; (3) dorsal microducts bilocular; (4) simple pores of 1 size type; (5) dorsal tubular ducts, dorsal tubercles and pocket-like sclerotizations absent; (6) preopercular pores thick rimmed, present along midline from area anterior to anal plates anteriorly to about mesothorax; (7) anal plates together subquadrate, with about 4 bluntly spinose setae on dorsal surface, and with 4 pairs of long sharply spinose fringe setae; without ventral subapical and hypopygial setae; (8) anal ring bearing 6 setae; (9) marginal setae each spinose and conical, with a bulbous base, of 2 length types; (10) each stigmatic area with 1 or 2 stigmatic spines; (11) ventral microducts scarce on mid venter, absent from around margins but abundant in a submarginal band; (12) simple pores scattered on ventral margin and submargin, absent from mid venter; (13) long prevulvar setae absent; and (14) antennae 6 or 7 segmented. Etymology. The species is named after the Corporaci��n Colombiana de Investigaci��n Agropecuaria [Colombian Corporation for Agricultural Research] (Corpoica). The species epithet is a noun in apposition. Notes. Cryptinglisia corpoica sp. nov. was collected on rosemary in the departments of Antioquia, Boyaca and Cundinamarca. Sooty mold symptoms were found associated with C. corpoica (Fig. 1E)., Published as part of Kondo, Takumasa, Rodr��guez, Jos�� Mauricio Montes, D��az, Mar��a Fernanda, Luna, Oscar Javier Dix & Goenaga, Edgard Palacio, 2018, Description of two new species of Cryptinglisia Cockerell (Hemiptera: Coccomorpha: Coccidae) associated with rosemary, Rosmarinus officinalis L. (Lamiaceae) in Colombia, pp. 379-390 in Zootaxa 4420 (3) on pages 383-386, DOI: 10.11646/zootaxa.4420.3.4, http://zenodo.org/record/1455363

Cryptinglisia corpoica Kondo & Montes, sp. nov. (Figs 1A, B & C; 2) Proposed common names. Spanish: Escama blanda de Corpoica; English: Corpoicaʼs rosemary scale. Type material studied. Holotype. Adult female. COLOMBIA: Antioquia: San Vicente, vereda Altos de la Campiña, Finca Bioga, 18.xi.2014, coll. Maria Fernanda Diaz, ex Rosmarinus officinalis, ICA No. 14-1496-3: 1(1) (CTNI). Paratypes. Same data as holotype, except: ICA No. 14-1496, 14-1496-1, 14-1496-2, 14-1496-3: 3(3) (CTNI); Antioquia: Marinilla, Las Mercedes, 6.15632° N, - 75.33821° W, 2112 m a.s.l., 27.v.2015, coll. Andrea Villegas, ex R. officinalis, No. 0000047, 1(1) (ICALNDF); Boyacá: Villa de Leyva, vereda Monquirá, finca Villa Paola, 3.vi.2015, coll. Maria Fernanda Diaz, ex R. officinalis, ICA No. 15-1796, 2(2) (CTNI). Boyacá: Villa de Leyva, vereda Cardonal, finca La Pila, 3.vi.2015, coll. María Fernanda Diaz, ex R. officinalis, ICA No. 15-1797, 2(2) (CTNI); Boyacá: Sáchica, vereda El Espino, finca Samicha, 3.vi.2015, coll. Maria Fernanda Diaz, ex R. officinalis, ICA No. 15-1798, 1(1) (CTNI). Cundinamarca: Bogotá, vereda Chorrillo, finca Coruntas, ca 2500 m a.s.l., 4° 34′ N, 74° 17′ W, 12.xii.2014, coll. V. Triana and A. Castro, ex R. officinalis, ICA No. 1410753, 1(1) (CTNI); Cundinamarca: Granada, San José, finca La Conquista, 4.52508° N, - 74.33865° W, 2501 m a.s.l., 31.x.2016, coll. Marcela Useche, ex R. officinalis, No. 0000423, 1(1) (ICALNDF), same data except: 4° 54′ N, 74° 10′ W, ICA No. 1607745, 1(1) (CTNI); Cundinamarca: Subachoque, vereda Galdamez, finca El Hato, 4° 54′ N, 74° 9′ W, 2722 m a.s.l., 11.ix.2015, coll. E.D. Espinosa-M., ex R. officinalis, 1(1) (CTNI); Cundinamarca: Subachoque, Galdamez, El Hato, 4.55054° N, - 74.09888° W, 2665 m a.s.l., 22.v.2017, coll. Marcela Useche, ex R. officinalis, No. 0000442, 1(1) (ICALNDF); Cundinamarca: Subachoque, vereda Galdamez, finca El Hato, 4.vi.2015, coll. Oscar J. Dix Luna, ex R. officinalis, 33 slides (55 adult females, 2 second-instar nymphs + 9 first-instar nymphs) (CTNI), 5(5) (USNM); Cundinamarca: Subachoque, vereda Galdamez, finca Hacienda El Hato, 13.v.2015, coll. Angela Castro, ex R. officinalis, ICA No. 15-1471 4 (4) (CTNI); Cundinamarca: Subachoque, vereda Galdamez, finca El Danubio, 4° 30′01″ N, 74° 21′12″ W, 2230 m a.s.l., 6.viii.2014, coll. Maria F. Diaz, ex R. officinalis, 3(7) (CTNI); Cundinamarca: Rosal, Buena Vista, Zerta, 4.87986° N, - 74.25831° W, 2711 m a.s.l., 22.v.2017, coll. Marcela Useche, ex R. officinalis, No. 0000441, 1(1) (ICALNDF); Cundinamarca: Simijaca, El Pantano, Lote Santamaría, 5.30508° N, - 73.47838° W, 2555 m a.s.l., 25.iv.2017, coll. Marcela Useche, ex R. officinalis, No. 0000180, 1(1) (ICALNDF); Cundinamarca: Tena, vereda Catalomonte, finca La Tartaria, 23.vi.2015, coll. María Fernanda Diaz, ex R. officinalis, No. 0960, No. 0957, No. 0958, 3(6) (CTNI); same data except: ICA No. 15-2372, 2(2) (CTNI). Adult female (measurements based on n=50). Unmounted material (Fig. 1A). Adult female in life about 1.5–4.0 mm long, 1.0–3.0 mm wide, oval, slightly convex. Test glassy, whitish to semi-transparent, of a granulose texture. Body creamy yellow to brownish. Anal plates and sclerotization around anal plates reddish brown (Figs 1A, B & D). Second-instar nymphs light yellowgreen and covered by a glassy semi-transparent test (Fig. 1C). Slide-mounted material (Fig. 2). Body 1.40–3.83 (1.92) mm long, 0.98–2.90 (1.56) mm wide, oval. Dorsum. Derm membranous, with areolations clearly visible over entire dorsum in older specimens. Dorsal setae absent. Dorsal microducts each oval, bilocular, about 2.0 µm wide, fairly abundant, scattered over dorsum. Simple pores each 1.4–3.4 (mostly 2.0–3.0) µm wide, fairly abundant, scattered over dorsum. Dorsal tubular ducts, dorsal tubercles and pocket-like sclerotizations absent. Preopercular pores circular, with a thick rim, each about 2.5–4.0 µm wide, extending anteriorly along midline from area anterior to anal plates to about mesothorax, some pores occasionally present on area laterad to anal plates. Anal plates together subquadrate, located at about 1/5 of body length from posterior margin, each plate 97.5–115.0 (97.5–102.5) µm long, 12.5–60.0 (50.0–52.5) µm wide, anterolateral margin 50.0–80.0 (67.5–80.0) µm long, posterolateral margin 67.5–80.0 (67.5–72.5) µm long, with about 4 bluntly spinose setae on dorsal surface: 3 apical and 1 inner marginal seta; anogenital fold with 4 long, sharply spinose fringe setae; ventral subapical setae and hypopygial setae not detected; anal plates often heavily sclerotized, so structural details difficult to observe in most specimens. Anal ring bearing 6 setae. A sclerotic area present around anal plates. Margin. Marginal setae each spinose and conical, with a bulbous base, straight, 12–30 µm long, some setae evidently much shorter than others, arranged in a single irregular row, with 3–10 (7–9) on each side between anterior and posterior stigmatic areas. Stigmatic clefts very shallow or absent. Stigmatic spines sharply spinose, straight or slightly curved, gradually or abruptly tapering to a point, rarely bifurcate; anterior stigmatic spines totalling 1 (rarely 2) in each anterior stigmatic area, each 51.0–112.5 (77.5–85.0) µm long; posterior stigmatic spines totalling 1 or 2 (1 on holotype) in each stigmatic area, each 68.0–120.0 (100.0–110.0) µm long. Eyes well developed, circular, domed, each 20–30 (20) µm wide, located on dorsal margin, often between marginal setae. Venter. Derm entirely membranous. Perivulvar pores each 4.0– 5.5 µm wide, mainly with 5 loculi (rarely a pore with 4, 6, 7 or 8 loculi), present in a group of 11–16 pores on each side along anal fold just posterior to vulvar area. Spiracular pores each 3.0–5.0 µm wide, mostly with 5 loculi (but occasional pores with 3 or 4 loculi), present in a narrow band about 2 or 3 pores wide, extending laterally from each spiracle to body margin; each anterior pore band with 14–27 (14–15) spiracular pores, each posterior spiracular pore band with 25–40 (17–24) spiracular pores. Ventral microducts each about 2.5–3.0 µm wide, scarce on mid venter, absent from around margins but abundant in a submarginal band. Simple pores scattered on ventral margin and submargin, absent from mid venter, each pore circular, about 2.0–3.0 µm wide, similar in shape and size to simple pores on dorsum. Ventral tubular ducts present in a submarginal band and scattered on mid venter; each duct with outer ductule 17.5–20.0 µm long, inner ductule 7.5–10.0 µm long, with terminal filament ending in a flower-shaped gland. Ventral setae slender, straight or slightly bent, present on all abdominal segments and submedially around body, each 6.3–17.0 µm long; ventral submarginal setae slender, straight or slightly bent, stouter than other ventral setae, each 10–16 µm long; long prevulvar setae absent. Spiracles well developed, with a sclerotization around each spiracle, anterior spiracular sclerotization 60.0–105.0 (60.0–75.0) µm long, 42.5–92.5 (62.5–65.0) µm wide, posterior spiracular sclerotization 65.0–112.5 (60.0–77.5) µm long, 42.5–115.0 (62.5–65.0) µm wide; quinquelocular pores present within atrium, totalling about 3–8 per spiracular sclerotization, often hard to detect. Legs well developed, each coxa (excluding coxal process) 100.0–117.5 (97.5–112.5) µm long, trochanter + femur 140.0–157.5 (137.5–150.0) µm long; tibia + tarsus 187.5–230.0 (187.5–222.0) µm long, without tibio-tarsal sclerosis; claw 15.0– 22.5 µm (20.0–22.5) long, with a minute denticle. Tarsal digitules both knobbed, one shorter than other, shorter digitule 37.5–42.5 (37.5–40.0) µm long, longer digitule 45.0–52.5 (45.0–50.0) µm long; claw digitules similar and broad, each 15.0–25.0 (20.0–25.0) µm long. Antennae each 182–250 (192.5–195.0) µm long, usually with 6, more rarely 7 segments (6 in holotype); fleshy setae generally present on last 3 antennal segments, although specimens with fleshy setae on last 2 antennal segments also present; segments II and IV each usually with a very long slender seta. With 3 or 4 pairs of interantennal setae, each seta 12.5–50.0 µm long. Mouthparts relatively large; clypeolabral shield 145.0–187.5 (180) µm long, 127.5–160.0 (150) µm wide; labium 1 segmented, 75.0–105.0 (92.5) µm long, 77.5–130.0 (127.5) µm wide, with 4 pairs of labial setae. Diagnosis. The adult female of C. corpoica can be diagnosed by the combination of the following features: (1) test glassy, whitish to semi-transparent, of a granulose texture; (2) dorsal derm with areolations; (3) dorsal microducts bilocular; (4) simple pores of 1 size type; (5) dorsal tubular ducts, dorsal tubercles and pocket-like sclerotizations absent; (6) preopercular pores thick rimmed, present along midline from area anterior to anal plates anteriorly to about mesothorax; (7) anal plates together subquadrate, with about 4 bluntly spinose setae on dorsal surface, and with 4 pairs of long sharply spinose fringe setae; without ventral subapical and hypopygial setae; (8) anal ring bearing 6 setae; (9) marginal setae each spinose and conical, with a bulbous base, of 2 length types; (10) each stigmatic area with 1 or 2 stigmatic spines; (11) ventral microducts scarce on mid venter, absent from around margins but abundant in a submarginal band; (12) simple pores scattered on ventral margin and submargin, absent from mid venter; (13) long prevulvar setae absent; and (14) antennae 6 or 7 segmented. Etymology. The species is named after the Corporación Colombiana de Investigación Agropecuaria [Colombian Corporation for Agricultural Research] (Corpoica). The species epithet is a noun in apposition. Notes. Cryptinglisia corpoica sp. nov. was collected on rosemary in the departments of Antioquia, Boyaca and Cundinamarca. Sooty mold symptoms were found associated with C. corpoica (Fig. 1E).

Genus Cryptinglisia Cockerell Cryptinglisia Cockerell, 1900: 173. Type species: Cryptinglisia lounsburyi Cockerell, 1900: 173. By monotypy. Generic diagnosis. Members of the genus Cryptinglisia can be diagnosed as follows: (1) insects in life covered by a semi-transparent, glassy and brittle test; (2) derm entirely membranous apart from a heavily sclerotized crescent around anal plates; (3) dorsal setae entirely absent; (4) anal plates heavily sclerotized, with thick spinose setae (usually less than 4 setae in each plate); (5) preopercular pores present in a linear group anterior to anal plates; (6) marginal setae sharply spinose or conical, with a broad base and well-developed basal socket; (7) legs usually well developed, with distinguishable coxa, trochanter, femur, tibia and tarsi, without tibio-tarsal sclerosis (but legs reduced in C. elytropappi and C. millari); (8) spiracles each surrounded by a sclerotization; (9) spiracular pores mostly with 5 loculi; (10) a single stigmatic spine (some specimens of C. corpoica sp. nov. with 2 stigmatic setae) per stigmatic cleft; (11) perivulvar pores usually mostly with 5 loculi (but perivulvar pores not known in C. elytropappi and C. millari); and (12) ventral tubular ducts of 1 type, present in a broad submarginal band, and medially. Remarks. The two new species herein described fit well in the subfamily Cardiococcinae in Hodgson`s (1994) book on the identification of coccid genera. However, they do not fit well in the genus Cryptinglisia in Hodgson`s (1994) key because the two new species from Colombia have well-developed eyes, a feature that puts them close to Dicyphococcus Borchsenius and Cardiococcus Cockerell. However, the latter two genera both have a group of stigmatic setae in each stigmatic cleft. Other than the presence of eyes, the two new species fit well in Cryptinglisia., Published as part of Kondo, Takumasa, Rodr��guez, Jos�� Mauricio Montes, D��az, Mar��a Fernanda, Luna, Oscar Javier Dix & Goenaga, Edgard Palacio, 2018, Description of two new species of Cryptinglisia Cockerell (Hemiptera: Coccomorpha: Coccidae) associated with rosemary, Rosmarinus officinalis L. (Lamiaceae) in Colombia, pp. 379-390 in Zootaxa 4420 (3) on page 382, DOI: 10.11646/zootaxa.4420.3.4, http://zenodo.org/record/1455363, {"references":["Cockerell, T. D. A. (1900) A new genus of Coccidae, injuring the roots of the grapevine in South Africa. The Entomologist, 33, 173 - 174."]}

Neotoumeyella Kondo and Williams, 2009 Type species Neolecanium leucaenae Cockerell, 1903 Generic diagnosis based on adult female (adapted from Kondo and Williams 2009). Body convex to globular, often irregular in outline, with thin glassy test, or covered with dull white waxy secretion. Ovisac reported as present for one species (i.e., N. cerifera), but generally absent. Dorsum. Dorsal derm generally becoming heavily sclerotized at maturity. Dorsal tubercles, dorsal tubular ducts and pocket-like sclerotizations absent. Dorsal setae slender, stout, spine-like or lanceolate, with a round or pointed apex. All species with convex discoidal pores (preopercular pores) present around anal plates only or found widespread over dorsum. Dorsal microducts present, of 1 or 2 types, generally of 1 type, i) a microduct with well-developed septa, and a long terminal filament, distributed evenly throughout dorsum; ii) a type of microduct found so far in N. ferum; known as a sclerotic pore, is a microduct surrounded by a large circular sclerotized plate (in N. ferum these are scattered on dorsum and form groups of 3���6 sclerotic pores in a rosette pattern around body margins). Anal plates with four apical setae, with variable numbers of subapical, fringe and hypopygial setae. Anal ring variable, with 6, 8, 10 or 12 setae. Margin. Marginal setae slender or stout and pointed or blunt. Stigmatic setae generally totaling three per stigmatic area (1���2 reported for T. ferum), present on margin or slightly dorsal of margin. Eyes not detected. Venter. Ventral body setae sharply spinose, slender, straight or slightly bent; with a row of submarginal setae; interantennal setae totaling four or six; with three pairs of long prevulvar setae (reported as not differentiated in T. ferum). Antennae and legs greatly reduced, with main segments present, occasionally indistinct or fused; without tibio-tarsal sclerotization. Antennae 3���6 segmented. Mouthparts normal, with eight labial setae. Spiracles usually large, about same size as legs. Spiracular pores with 3���8 loculi, mostly with five loculi (normally with 7 and 8 in T. ferum). Ventral tubular ducts of 1���3 sizes, generally with a terminal filament, but without a terminal filament in T. ferum, present around vulvar area and anterior abdominal segments, always present in a submarginal band on abdomen and reaching area around posterior spiracular pore band, often found submarginally as far as anterior spiracular pore band, mouthparts and antennae. Multilocular pores (other than spiracular pores) variable, with 5���12 loculi, but pores with 5���10 loculi most common. Ventral microducts present, with a short terminal filament. Remarks. Neotoumeyella ferum fits well the diagnosis of the genus., Published as part of Kondo, Takumasa, 2018, A new combination and an update of Neotoumeyella Kondo and Williams, 2009 (Hemiptera: Coccomorpha: Coccidae), pp. 1-5 in Insecta Mundi 616 on page 2, DOI: 10.5281/zenodo.3699393, {"references":["Kondo, T., and M. L. Williams. 2009. Redescriptions of Neolecanium leucaenae Ckll., Toumeyella cerifera Ferris and T. sonorensis Ckll. & Parrott and their transfer to Neotoumeyella gen. nov. (Hemiptera: Coccidae), with descriptions of two new species from the southeastern U. S. A. and Colombia, South America. International Journal of Insect Science 2: 11 - 27.","Cockerell, T. D. A. 1903. Five new Coccidae from Mexico. The Entomologist 36: 45 - 48."]}

Kondo, Takumasa (2018): A new combination and an update of Neotoumeyella Kondo and Williams, 2009 (Hemiptera: Coccomorpha: Coccidae). Insecta Mundi 616: 1-5, DOI: http://doi.org/10.5281/zenodo.3699393, {"references":["Ben-Dov, Y. 1993. A systematic catalogue of the soft scale insects of the world (Homoptera: Coccoidea: Coccidae). Sandhill Crane Press; Gainesville, FL. 536 p.","Cockerell, T. D. A. 1903. Five new Coccidae from Mexico. The Entomologist 36: 45-48.","Granara de Willink, M. C. 2012. Revision sistematica de Mesolecanium Cockerell de la region Neotropical (Hemiptera: Coccidae), con sinonimia y combinaciones nuevas. Insecta Mundi 0262: 1-33.","Hempel, A. 1920. Descripcoes de coccidas novas e pouco conhecidas. [Descriptions of new and littleknown coccids.] Revista do Museu Paulista 12: 329-377.","Kondo, T. 2010. Taxonomic revision of the myrmecophilous, meliponiphilous and rhizophilous soft scale genus Cryptostigma Ferris (Hemiptera: Coccoidea: Coccidae). Zootaxa 2709: 1-72.","Kondo, T., and M. L. Williams. 2009. Redescriptions of Neolecanium leucaenae Ckll., Toumeyella cerifera Ferris and T. sonorensis Ckll. & Parrott and their transfer to Neotoumeyella gen. nov. (Hemiptera: Coccidae), with descriptions of two new species from the southeastern U.S.A. and Colombia, South America. International Journal of Insect Science 2: 11-27."]}

Tillancoccus koreguajae Caballero & Ramos, sp. nov. Material studied. Holotype: adult female. Colombia: Caquet��, Florencia, Vda. San Luis, 388 m a.s.l., 01��41���01���N, 75��37���42���W, 11.x.2013, Coll. A. Caballero, ex leaves of sugarcane, S. officinarum, associated with Pheidole sp. (Hymenoptera: Formicidae), UNAB voucher N�� 836. Paratypes: collection data same data as holotype, 1 adult female + 2 third-instar female nymphs. Only slide mounted specimens are available. Males not observed. Description of adult female (Fig. 1) Note: data in brackets refer to the paratype female. Mounted material. Body broadly oval, 2.1 (3.9) mm long and 1.2 (2.6) mm wide. Stigmatic clefts shallow, distinct. Anal cleft about 1/5 body length. Dorsum. Derm membranous, except for a slightly sclerotized area around anal plates. Anal ring with 8 setae and two rows of wax pores. Anal plates (anpl) together subquadrate; each anal plate 138 (149) ��m long, 86 (86) ��m wide, anterolateral-margin 99 (104���106) ��m long, posterolateral margin 114 (123���124) ��m long, with 4 dorsal setae located on posterior end of each plate. Ducts: tubular ducts absent. Dorsal microducts (dmic) each 1.5 ��m wide, evenly scattered throughout. Pores: Dorsal simple pores (dsp) each 1���2 ��m wide, evenly scattered. Preopercular pores (pop) arranged in two rows on mid-dorsum anterior to anal plates, extending anteriorly up to middle of mesothorax, numbering 132 (109); each row 2���3 pores wide, each pore 6���8 ��m wide. Setae: two types: a) sharply spinose setae (sss), large, each 23���36 ��m long, with a narrow and well-sclerotized basal socket, arranged in about 25 radial rows as follows: seven radial rows present anteriorly between anterior stigmatic clefts on head; two to four (often not well-defined) radial rows between each anterior and posterior stigmatic cleft, and 12 radial rows present posteriorly between posterior stigmatic cleft and body apex; b) small pointed setae (dps), very short, slender, straight, 3���5 ��m long, scattered. Dorsal tubercles and pocket-like sclerotizations absent. Venter. Derm entirely membranous. Eyes present on margin, each about 24 (27) ��m in diameter. Antennae slender, filiform, eight segmented, 335 (391) ��m long, length of each segment as follows: I: 34 (37) ��m, with 2 flagellate setae; II: 48 (59) ��m, with 2 flagellate setae and one campaniform sensillium; III: 44 (51) ��m, without setae; IV: 45 (53) ��m, without setae; V: 52 (73) ��m, with 3 flagellate setae; VI: 33 (43) ��m, with 1 fleshy seta; VII: 31 (29) ��m, with 1 fleshy seta and VIII: 45 (44) ��m, with 4 fleshy setae, 4 stiff setae and 4 flagellate setae. Legs well developed; hind leg measurements as follows: coxa 97 (116) ��m long, 94 (110) ��m wide; trochanter 83 (96) ��m long, 46 (57) ��m wide; tibia 169 (212) ��m long, 30 (30) ��m wide; tarsus 108 (137) ��m long, 26 (32) ��m wide; claw 29 (30) ��m long; claw denticle absent, claw digitules each about 28 (28) ��m long, knobbed; tarsal digitules each about 55 (56) ��m long, knobbed. Spiracles well developed, anterior spiracles each 46 (57) ��m wide, posterior spiracles each 54 (61) ��m wide. Tubular ducts absent. Ventral microducts (vmic) about 3 ��m wide, evenly scattered throughout. Pores: Perivulvar pores (pvp), each 5���7 ��m wide, with 5���7 loculi (mostly 7), present only around vulvar region. Spiracular pores (spp) each 4���5 ��m wide, with 5 loculi, present in a narrow band 2���3 pores wide, extending laterally from each spiracle to body margin, numbering 40���50 pores on each furrow. Setae: i) interantennal setae (is): two pairs, one pair of long flagellate setae, each 74 (56) ��m long, and one pair of shorter hair-like setae, each 7 (7) ��m long; ii) prevulvar setae (pvs) hair-like, present on last three abdominal segments: one pair on mid region of segment V, each 13 (18) ��m long, one pair on mid region of segment VI, each 15 (19) ��m long, and one pair on mid region of segment VII, each 59 (89) ��m long; iii); and a iv) short type of setae herein termed as ventral pointed setae (vps): very short, slender, straight, about 3���5 ��m long, evenly scattered. Dermal spinules present on medial and submedial areas of body, between base of antennae and the anal cleft. Margin. Setae of two types: i) flagellate setae (mfs), slightly bent, each 28���46 (25���50) ��m long, arranged in a single row, with 23 (24) setae anteriorly between the eyes, 11 (10) between each eye and anterior stigmatic setae on each side, 15 (11) between anterior and posterior stigmatic spines on each side, 47���49 (42���51) setae between each posterior stigmatic setae and body apex on each side; intermixed with ii) pointed setae (mps), very short, slender, straight, about 3���5 ��m long, similar to ventral pointed setae. Stigmatic cleft well developed, with 3 stigmatic spines per stigmatic area; stigmatic spines (stgs) each sharply spinose, median stigmatic spine longest, 63���69 (80) ��m long (one seta bifurcated on anterior stigmatic cleft on right side in paratype), lateral stigmatic spines 27���46 (52��� 58) ��m long. Etymology. The species is named in honor of the Colombian native tribe from the Type locality, the Koreguajae (Marin 2013), a noun in apposition. Tillancoccus koreguajae is most similar to Tillancoccus tillandsiae in having the same type of dorsal setae and in lacking dorsal tubercles and dorsal setae with associated pores (present in T. mexicanus); however, the two species differ in the number of rows of setae on the dorsum, number of antennal segments, and the number of loculi in the spiracular pores. Tillancoccus tillandsiae differs from the other two species in the presence of very short and slender pointed setae, which have not been reported in either T. tillandsiae or T. mexicanus . Differences between Tillancoccus koreguajae from the other two known species in the genus (i.e., T. mexicanus and T. tillandsiae) are summarized in Table 1. Characters Attribute T. koguajerae T. mexicanus & T. tillandsiae, Published as part of Caballero, Alejandro, Ramos-Portilla, Andrea Amalia & Kondo, Takumasa, 2017, Scale insects (Hemiptera: Coccomorpha) on sugarcane in Colombia, with description of a new species of Tillancoccus Ben-Dov (Coccidae), pp. 490-500 in Zootaxa 4258 (5) on pages 492-493, DOI: 10.11646/zootaxa.4258.5.6, http://zenodo.org/record/570450, {"references":["Marin, P. (2013) Introduccion historica a la etnia Coreguaje: Cultura Tucano occidental de Colombia. Revista Brasileira de Lingusitica Antropologica, 5 (1), 193 - 215."]}

Saccharicoccus sacchari (Cockerell, 1895) Hosts. Oligophagous, only known from Poaceae, on 11 plant species in 8 genera (Williams & Granara de Willink 1992, Ben-Dov 1994, Garcia et al. 2016). Distribution. Cosmopolitan. In Colombia, it has been recorded in the departments of Antioquia, Caldas, Cauca, Nari��o, Norte de Santander, Risaralda, Santander, Tolima and Valle del Cauca (Kondo 2001, Kondo et al. 2008). Here we report S. sacchari for the first time from the department of Caquet��. Diagnostic characters. Circulus large, commonly described either as ���hour-glass��� shaped or ���dumb-bell��� shaped; with long setae on each margin of the fifth and posterior abdominal segments; minute flat or duct-like pores present on integument surrounding each hind coxa (Williams & Granara de Willink 1992) Economic importance and control. Saccharicoccus sacchari is a common pest of sugarcane in Hawaii (Beardsley 1960; 1962). It has been considered as a possible vector of rice diseases in Cuba and India (Uichanco & Villanueva 1932). In Colombia, it is considered a secondary pest of sugarcane crops, and rarely reaches levels to cause economic damage (Bustillo 2013). Material studied. COLOMBIA: Caldas: Sup��a, Vda. El Descanso, Fca. Ulises Valencia, 1136 m a.s.l., 05��25���13���N, 75��38���53���W, 21.x.2005, coll. A. Ramos, 10 ♀, UNAB voucher N�� 835; Sup��a, Vda. Mudarra, Fca. Ren�� Posada, 1259 m a.s.l., 05��25���28���N, 75��38���33���W, 21.x.2005, coll. A. Ramos, 10 ♀, UNAB voucher N�� 835; Caquet��: Florencia, Vda. Avenida Sebastopol, 826 m a.s.l., 01��44���57���N, 75��39���13���W, 13.x.2013, coll. J. Silva, associated with Pheidole biconstricta, 10 ♀, UNAB voucher N�� 835; Florencia, Vda. La Carbona, 674 m a.s.l., 01��42���01���N, 75��02���26���W, 12.x.2013, coll. J. Silva, associated with Crematogaster sp. (Formicidae) and Wasmannia auropunctata (Formicidae), 27 ♀, UNAB voucher N�� 835; Florencia, Vda. San Luis, 458 m a.s.l., 01��41���09���N, 75��37���53���W, 12.x.2013, coll. J. Silva, associated with Linepithema sp. and Pheidole sp. (Formicidae), 18 ♀, UNAB voucher N�� 835; Florencia, Vda. San Luis, 388 m a.s.l., 01��41���01���N, 75��37���42���W, 11.x.2013, coll. E. Rojas, associated with Pheidole sp., 12 ♀, UNAB voucher N�� 835; Putumayo: Mocoa, Vda. Pumiyaco, Fca. Heraldo Viejo, 600 m a.s.l., 01��07��6��N, 76��39��15��W, 4.iii.2016, coll L. Parra, 11 ♀, UNAB voucher N�� 835; Tolima: L��bano, Vda. Aguadurri, Fca. Ca��abrava, 1280 m a.s.l., 04��55���36���N, 75��01���04���W, 7.vii.2006, coll. L. Lique, 8 ♀, UNAB voucher N�� 835. Note. All material collected off stems of S. officinarum., Published as part of Caballero, Alejandro, Ramos-Portilla, Andrea Amalia & Kondo, Takumasa, 2017, Scale insects (Hemiptera: Coccomorpha) on sugarcane in Colombia, with description of a new species of Tillancoccus Ben-Dov (Coccidae), pp. 490-500 in Zootaxa 4258 (5) on page 497, DOI: 10.11646/zootaxa.4258.5.6, http://zenodo.org/record/570450, {"references":["Cockerell, T. D. A. (1895) A new mealy-bug on sugar cane. Journal of the Trinidad Field Naturalists' Club, 2, 195.","Williams, D. J. & Granara de Willink, M. C. (1992) Mealybugs of Central and South America. CAB International, London, 635 pp.","Ben-Dov, Y. (1994) A systematic catalogue of the mealybugs of the world (Insecta: Homoptera: Coccoidea: Pseudococcidae and Putoidae) with data on geographical distribution, host plants, biology and economic importance. Intercept Ltd, Andover, 686 pp.","Garcia Morales, M., Denno, B., Miller, D. R., Miller, G. L., Ben-Dov, Y. & Hardy, N. B. (2016) ScaleNet: A Literature-based model of scale insect biology and systematics. Available from: http: // scalenet. info (accessed 31 May 2016)","Kondo, T. (2001) Las Cochinillas de Colombia (Hemiptera: Coccoidea). Biota Colombiana, 2 (1), 31 - 48.","Kondo, T., Ramos-Portilla, A. R. & Vergara, V. (2008) Updated list of Mealybugs and Putoids from Colombia (Hemiptera: Pseudococcidae and Putoidae). Boletin del Museo Entomologico de la Universidad del Falle, 9 (1), 29 - 53.","Beardsley, J. W. (1960) Observations on sugar cane mealybugs in Hawaii. Proceedings of the International Society of Sugarcane Technologists, 10 th Congress, Hawaii, 1959, 1954 - 961.","Beardsley, J. W. (1962) Notes on the biology of the pink sugar cane mealybug, Saccharicoccus sacchari (Cockerell), in Hawaii (Homoptera: Pseudococcidae). Proceedings of the Hawaiian Entomological Society, 18, 55 - 59.","Uichanco, L. B. & Villanueva, F. E. (1932) Biology of the pink mealybug of sugar cane, Trionymus sacchari (Cockerell), in the Philippines. Philippine Agriculture, 21, 205 - 276.","Bustillo, A. (2013) Insectos plaga y organismos beneficos del cultivo de la cana de azucar en Colombia. Centro de Investigacion de la Cana de Azucar de Colombia Cenicana, Cali, 157 pp."]}

Serenaspis minima (Maskell, 1884) Despite this species having been recorded on sugarcane from Colombia by Posada (1989) and Gallego & V��lez (1992), there are good reasons to believe these records were misidentifications. As far as we know, S. minima is present only in the Australasian region (Australia, New Zealand), and there are no records from the New World. In order to corroborate this record from Colombia, a careful search of the voucher specimens was carried out in four Colombian entomological museums, i.e., the Museo de Entomolog��a, Corporaci��n Colombiana de Investigaci��n Agropecuaria (Corpoica), Centro de Investigaci��n Palmira, Valle del Cauca (MECP); the Francisco Lu��s Gallego Entomology Museum, Medell��n, Antioquia (MEFLG); the entomology collection at the Universidad Nacional, Palmira campus, Valle del Cauca (CEUNP); and the ���Luis Mar��a Murillo��� entomology collection held at Corpoica, Tibaitat�� (CTNI). Specimens studied by Posada should be deposited at CTNI; those studied by Gallego & V��lez (1992) are held at MEFLG. However, no voucher specimens of S. minima were found in any of these depositories. Furthermore, Gallego & V��lez (1992) referred to Pinnaspis minor by the common name: "piojo blanco del algodonero", but this name was assigned by Figueroa (1952) to Pinnaspis temporaria Ferris (now Pinnaspis strachani (Cooley)) collected on cotton from Valle del Cauca. Figueroa (1952) treated Chionaspis minor, Hemichionaspis minor and Pinnaspis minor as junior synomyms of P. strachani. Pinnaspis strachani is a highly polyphagous species and has a worldwide distribution, including many countries in the New World and is here reported feeding on S. officinarum for the first time. We believe that Serenaspis minor is not present on S. officinarum in Colombia and that the above records were probably misidentifications of P. strachani., Published as part of Caballero, Alejandro, Ramos-Portilla, Andrea Amalia & Kondo, Takumasa, 2017, Scale insects (Hemiptera: Coccomorpha) on sugarcane in Colombia, with description of a new species of Tillancoccus Ben-Dov (Coccidae), pp. 490-500 in Zootaxa 4258 (5) on page 496, DOI: 10.11646/zootaxa.4258.5.6, http://zenodo.org/record/570450, {"references":["Maskell, W. M. (1884) Art. V. - Further notes on Coccidae in New Zealand, with descriptions of new species. Transactions and Proceedings of the New Zealand Institute, 16, 120 - 144.","Posada, L. (1989) Lista de insectos daninos y otras plagas en Colombia. Boletin Tecnico No. 43. Instituto Colombiano Agropecuario, Bogota, Colombia, 660 pp.","Gallego, F. & Velez, R. (1992) Lista de insectos que afectan los principales cultivos, plantas forestales, animales domesticos y al hombre, en Colombia. Universidad Nacional de Colombia, Medellin, Colombia, 141 pp.","Figueroa, A. (1952) Catalogo de los artropodos de las clases Arachnida e Insecta encontrado en el hombre, los animales y las plantas de la Republica de Colombia. Acta Agronomica, 2 (4), 198 - 223."]}

Pseudococcus calceolariae (Maskell, 1879) This species was recorded in Colombia by Kondo et al. (2008) based on previous information, occurring on a native fig tree known as ���caucho sabanero���, Ficus americanus (Moraceae), in the city of Bogot��. Although Ps. calceolariae is a polyphagous species (Ben-Dov 1994, McKenzie 1967, Kondo et al. 2008), there are no reports of it feeding on other hosts in Colombia (Kondo et al. 2008). Although Figueroa (1977) recorded Ps. calceolariae on the roots of sugarcane in the department of Valle del Cauca, Colombia, there are no voucher specimens in any of the entomological depositories listed above. Therefore, we suggest that the record of Ps. calceolariae on sugarcane from Colombia should be treated as doubtful., Published as part of Caballero, Alejandro, Ramos-Portilla, Andrea Amalia & Kondo, Takumasa, 2017, Scale insects (Hemiptera: Coccomorpha) on sugarcane in Colombia, with description of a new species of Tillancoccus Ben-Dov (Coccidae), pp. 490-500 in Zootaxa 4258 (5) on page 498, DOI: 10.11646/zootaxa.4258.5.6, http://zenodo.org/record/570450, {"references":["Maskell, W. M. (1879) On some Coccidae in New Zealand. Transactions and Proceedings of the New Zealand Institute, 11, 187 - 228.","Kondo, T., Ramos-Portilla, A. R. & Vergara, V. (2008) Updated list of Mealybugs and Putoids from Colombia (Hemiptera: Pseudococcidae and Putoidae). Boletin del Museo Entomologico de la Universidad del Falle, 9 (1), 29 - 53.","Ben-Dov, Y. (1994) A systematic catalogue of the mealybugs of the world (Insecta: Homoptera: Coccoidea: Pseudococcidae and Putoidae) with data on geographical distribution, host plants, biology and economic importance. Intercept Ltd, Andover, 686 pp.","McKenzie, H. L. (1967) Mealybugs of California with taxonomy, biology, and control of North American species (Homoptera: Coccoidea: Pseudococcidae). University of California Press Berkeley, 526 pp.","Figueroa, A. (1977) Insectos y Acarinos de Colombia. Facultad de Ciencias Agropecuarias, Universidad Nacional de Colombia, Palmira, Colombia, 685 pp."]}

Dysmicoccus boninsis (Kuwana, 1909) Hosts. Polyphagous, known to feed on 39 species belonging to ten plant families (Garc��a Morales et al. 2016). In Colombia, D. boninsis has been previously recorded feeding on stems of sugarcane. In this study, this species was found for the first time feeding on the roots of sugarcane. Diagnosis. Dorsum: numerous oral collar tubular ducts present; with only 8 or 9 pairs of cerarii, each containing 2 enlarged setae. Venter: multilocular disc pores present on the fifth and posterior abdominal segments; translucent pores present on hind coxa and a few on the hind tibia; circulus normally notched at each side and divided by an intersegmental line, but sometimes small and oval (Williams & Granara de Willink 1992). Distribution. Cosmopolitan. In Colombia, it has been previously recorded from the departments of Antioquia, Caldas, Cauca, Nari��o, Norte de Santander, Quind��o, Santander, Tolima and Valle del Cauca (Kondo et al. 2008). Here it is recorded for the first time from the department of Caquet��. Economic importance and control. The gray sugarcane mealybug has been recorded from a wide range of grasses, as well as host plants from other families. On sugarcane, this species has been generally recorded as a minor pest but, when attended by ants, it may kill young shoots (Bartlett 1978). Kondo et al. (2008) recorded eight ant species associated with D. boninsis in Colombia: Brachymyrmex sp., Crematogaster sp., Ectatoma ruidum Roger, Linepithema sp., Neilanderia sp., Solenopsis sp., Pheidole sp. and Wasmania auropunctata Roger. Dysmicoccus boninsis is not considered a pest of sugarcane in Colombia (Lastra & G��mez 2000, Bustillo 2013). Material studied. COLOMBIA: Antioquia, Medell��n, 1560 m a.s.l., 25.iii.2010, 5 ♀, UNAB voucher N�� 843; Boyac��: Togui, Vda. Garibal, Fca El Milagro, 1664 m a.s.l., 05��55���00���N, 73��30���54���W, 23.iii.2012, coll. H. Matheus, 9 ♀, UNAB voucher N�� 843; Caquet��: Florencia, Vda. La Carbona, 674 m a.s.l., 01��42���01���N, 75��02���26���W, 12.x.2013, coll. J. Silva, tended by Crematogaster sp. (Formicidae) and Wasmannia auropunctata (Formicidae), 1 ♀, UNAB voucher N�� 843; Florencia, Vda. Avenida Sebastopol, 826 m a.s.l., 01��44���57���N, 75��39���13���W, 13.x.2013, coll. J. Silva, tended by Pheidole biconstricta Mayr (Formicidae), 6 ♀, UNAB voucher N�� 843; Florencia, Vda. San Luis, 388 m a.s.l., 01��41���01���N, 75��37���42���W, 11.x.2013, coll. E. Rojas, tended by Pheidole sp. (Formicidae), 4 ♀, UNAB voucher N�� 843; Choc��: Acand��, Sapzurro, 8.i.2005, coll. F. Serna & E. Vergara, 19 ♀, UNAB voucher N�� 843; Tolima, Coello, Ibagu��, San Francisco, 1158 m a.s.l., 04��23���56���N, 75��17���18���W, 13.xii.2005, coll. A. Ramos, 6 ♀, UNAB voucher N�� 843. Note. All material collected off stems of S. officinarum, except for those from Boyac��, which were collected from roots. Observations. This is the first record of D. boninsis being associated with Pheidole biconstricta in Colombia., Published as part of Caballero, Alejandro, Ramos-Portilla, Andrea Amalia & Kondo, Takumasa, 2017, Scale insects (Hemiptera: Coccomorpha) on sugarcane in Colombia, with description of a new species of Tillancoccus Ben-Dov (Coccidae), pp. 490-500 in Zootaxa 4258 (5) on pages 496-497, DOI: 10.11646/zootaxa.4258.5.6, http://zenodo.org/record/570450, {"references":["Kuwana, S. I. (1909) Coccidae of Japan (IV). A list of Coccidae from Bonin Islands (Ogasawarajima), Japan. Journal of the New York Entomological Society, 17 (4), 158 - 164.","Garcia Morales, M., Denno, B., Miller, D. R., Miller, G. L., Ben-Dov, Y. & Hardy, N. B. (2016) ScaleNet: A Literature-based model of scale insect biology and systematics. Available from: http: // scalenet. info (accessed 31 May 2016)","Williams, D. J. & Granara de Willink, M. C. (1992) Mealybugs of Central and South America. CAB International, London, 635 pp.","Kondo, T., Ramos-Portilla, A. R. & Vergara, V. (2008) Updated list of Mealybugs and Putoids from Colombia (Hemiptera: Pseudococcidae and Putoidae). Boletin del Museo Entomologico de la Universidad del Falle, 9 (1), 29 - 53.","Bartlett, B. R. (1978) Pseudococcidae. Introduced Parasites and Predators of Arthropod Pests and Weeds: a World Review. Agricultural Research Service, United States Department of Agriculture Washington, D. C., 545 pp. Beardsley, J. W. & Gonzalez, R. H. (1975) The biology and ecology of armored scales. Annual Review of Entomology, 20, 47 - 73.","Lastra, L. A. & Gomez, L. A. (2000) Las plagas de la cana de azucar: su manejo y control. In: Conferencia de Proveedores en el Ingenio Risaralda. Centro de Investigacion de la Cana de Azucar de Colombia Cenicana, Cali, 12 pp.","Bustillo, A. (2013) Insectos plaga y organismos beneficos del cultivo de la cana de azucar en Colombia. Centro de Investigacion de la Cana de Azucar de Colombia Cenicana, Cali, 157 pp."]}

Tillancoccus koreguajae Caballero & Ramos, sp. nov. Material studied. Holotype: adult female. Colombia: Caquetá, Florencia, Vda. San Luis, 388 m a.s.l., 01°41′01″N, 75°37′42″W, 11.x.2013, Coll. A. Caballero, ex leaves of sugarcane, S. officinarum, associated with Pheidole sp. (Hymenoptera: Formicidae), UNAB voucher N° 836. Paratypes: collection data same data as holotype, 1 adult female + 2 third-instar female nymphs. Only slide mounted specimens are available. Males not observed. Description of adult female (Fig. 1) Note: data in brackets refer to the paratype female. Mounted material. Body broadly oval, 2.1 (3.9) mm long and 1.2 (2.6) mm wide. Stigmatic clefts shallow, distinct. Anal cleft about 1/5 body length. Dorsum. Derm membranous, except for a slightly sclerotized area around anal plates. Anal ring with 8 setae and two rows of wax pores. Anal plates (anpl) together subquadrate; each anal plate 138 (149) µm long, 86 (86) µm wide, anterolateral-margin 99 (104–106) µm long, posterolateral margin 114 (123–124) µm long, with 4 dorsal setae located on posterior end of each plate. Ducts: tubular ducts absent. Dorsal microducts (dmic) each 1.5 µm wide, evenly scattered throughout. Pores: Dorsal simple pores (dsp) each 1–2 µm wide, evenly scattered. Preopercular pores (pop) arranged in two rows on mid-dorsum anterior to anal plates, extending anteriorly up to middle of mesothorax, numbering 132 (109); each row 2–3 pores wide, each pore 6–8 µm wide. Setae: two types: a) sharply spinose setae (sss), large, each 23–36 µm long, with a narrow and well-sclerotized basal socket, arranged in about 25 radial rows as follows: seven radial rows present anteriorly between anterior stigmatic clefts on head; two to four (often not well-defined) radial rows between each anterior and posterior stigmatic cleft, and 12 radial rows present posteriorly between posterior stigmatic cleft and body apex; b) small pointed setae (dps), very short, slender, straight, 3–5 µm long, scattered. Dorsal tubercles and pocket-like sclerotizations absent. Venter. Derm entirely membranous. Eyes present on margin, each about 24 (27) µm in diameter. Antennae slender, filiform, eight segmented, 335 (391) µm long, length of each segment as follows: I: 34 (37) µm, with 2 flagellate setae; II: 48 (59) µm, with 2 flagellate setae and one campaniform sensillium; III: 44 (51) µm, without setae; IV: 45 (53) µm, without setae; V: 52 (73) µm, with 3 flagellate setae; VI: 33 (43) µm, with 1 fleshy seta; VII: 31 (29) µm, with 1 fleshy seta and VIII: 45 (44) µm, with 4 fleshy setae, 4 stiff setae and 4 flagellate setae. Legs well developed; hind leg measurements as follows: coxa 97 (116) µm long, 94 (110) µm wide; trochanter 83 (96) µm long, 46 (57) µm wide; tibia 169 (212) µm long, 30 (30) µm wide; tarsus 108 (137) µm long, 26 (32) µm wide; claw 29 (30) µm long; claw denticle absent, claw digitules each about 28 (28) µm long, knobbed; tarsal digitules each about 55 (56) µm long, knobbed. Spiracles well developed, anterior spiracles each 46 (57) µm wide, posterior spiracles each 54 (61) µm wide. Tubular ducts absent. Ventral microducts (vmic) about 3 µm wide, evenly scattered throughout. Pores: Perivulvar pores (pvp), each 5–7 µm wide, with 5–7 loculi (mostly 7), present only around vulvar region. Spiracular pores (spp) each 4–5 µm wide, with 5 loculi, present in a narrow band 2–3 pores wide, extending laterally from each spiracle to body margin, numbering 40–50 pores on each furrow. Setae: i) interantennal setae (is): two pairs, one pair of long flagellate setae, each 74 (56) µm long, and one pair of shorter hair-like setae, each 7 (7) µm long; ii) prevulvar setae (pvs) hair-like, present on last three abdominal segments: one pair on mid region of segment V, each 13 (18) µm long, one pair on mid region of segment VI, each 15 (19) µm long, and one pair on mid region of segment VII, each 59 (89) µm long; iii); and a iv) short type of setae herein termed as ventral pointed setae (vps): very short, slender, straight, about 3–5 µm long, evenly scattered. Dermal spinules present on medial and submedial areas of body, between base of antennae and the anal cleft. Margin. Setae of two types: i) flagellate setae (mfs), slightly bent, each 28–46 (25–50) µm long, arranged in a single row, with 23 (24) setae anteriorly between the eyes, 11 (10) between each eye and anterior stigmatic setae on each side, 15 (11) between anterior and posterior stigmatic spines on each side, 47–49 (42–51) setae between each posterior stigmatic setae and body apex on each side; intermixed with ii) pointed setae (mps), very short, slender, straight, about 3–5 µm long, similar to ventral pointed setae. Stigmatic cleft well developed, with 3 stigmatic spines per stigmatic area; stigmatic spines (stgs) each sharply spinose, median stigmatic spine longest, 63–69 (80) µm long (one seta bifurcated on anterior stigmatic cleft on right side in paratype), lateral stigmatic spines 27–46 (52– 58) µm long. Etymology. The species is named in honor of the Colombian native tribe from the Type locality, the Koreguajae (Marin 2013), a noun in apposition. Tillancoccus koreguajae is most similar to Tillancoccus tillandsiae in having the same type of dorsal setae and in lacking dorsal tubercles and dorsal setae with associated pores (present in T. mexicanus); however, the two species differ in the number of rows of setae on the dorsum, number of antennal segments, and the number of loculi in the spiracular pores. Tillancoccus tillandsiae differs from the other two species in the presence of very short and slender pointed setae, which have not been reported in either T. tillandsiae or T. mexicanus . Differences between Tillancoccus koreguajae from the other two known species in the genus (i.e., T. mexicanus and T. tillandsiae) are summarized in Table 1. Characters Attribute T. koguajerae T. mexicanus & T. tillandsiae

Dysmicoccus brevipes (Cockerell, 1893) Hosts. Polyphagous, known to feed on 191 species belonging to 63 plant families (Garc��a Morales et al. 2016). Diagnosis. Adult female without tubular ducts on dorsum; translucent pores present on hind femur and tibia; dorsal setae on segments VII and VIII conspicuously longer than remaining dorsal setae (Williams & Granara de Willink 1992, Granara de Willink 2009). Distribution. Cosmopolitan (Garc��a Morales et al. 2016). The distribution of this species in Colombia is unknown but it is probably widespread throughout the country. Economic importance and control. In Hawaii, it occurs infrequently on sugarcane and is of minor economic importance (Beardsley 1960). In Colombia, it is not considered a pest of sugarcane (Lastra & G��mez 2000, Bustillo 2013). Remarks. Since the record of Williams & Granara de Willink (1992), D. brevipes has not been recorded on sugarcane in Colombia. Although the species is common in Colombia, on many hosts including pineapple (Kondo 2001), orange, plantain, cacao, coffee, Cecropia sp. (Kondo et al. 2008), there are no specimens collected from sugarcane in any of the Colombian Museums studied. Many specimens studied by Williams & Granara de Willink (1992) are deposited at the US National Museum of Natural History Coccoidea Collection in Beltsville, Maryland, USA (USNM), but no specimens of D. brevipes on sugarcane from Colombia were found in that museum (Dr. Greg Evans (USNM), personal communication 2016)., Published as part of Caballero, Alejandro, Ramos-Portilla, Andrea Amalia & Kondo, Takumasa, 2017, Scale insects (Hemiptera: Coccomorpha) on sugarcane in Colombia, with description of a new species of Tillancoccus Ben-Dov (Coccidae), pp. 490-500 in Zootaxa 4258 (5) on page 497, DOI: 10.11646/zootaxa.4258.5.6, http://zenodo.org/record/570450, {"references":["Cockerell, T. D. A. (1893) The West Indian species of Dactylopius. The Entomologist, 26, 177 - 179.","Garcia Morales, M., Denno, B., Miller, D. R., Miller, G. L., Ben-Dov, Y. & Hardy, N. B. (2016) ScaleNet: A Literature-based model of scale insect biology and systematics. Available from: http: // scalenet. info (accessed 31 May 2016)","Williams, D. J. & Granara de Willink, M. C. (1992) Mealybugs of Central and South America. CAB International, London, 635 pp.","Granara de Willink, M. C. (2009) Dysmicoccus de la Region Neotropical (Hemiptera: Pseudococcidae). Revista de la Sociedad Entomologica Argentina, 68 (1), 11 - 95.","Beardsley, J. W. (1960) Observations on sugar cane mealybugs in Hawaii. Proceedings of the International Society of Sugarcane Technologists, 10 th Congress, Hawaii, 1959, 1954 - 961.","Lastra, L. A. & Gomez, L. A. (2000) Las plagas de la cana de azucar: su manejo y control. In: Conferencia de Proveedores en el Ingenio Risaralda. Centro de Investigacion de la Cana de Azucar de Colombia Cenicana, Cali, 12 pp.","Bustillo, A. (2013) Insectos plaga y organismos beneficos del cultivo de la cana de azucar en Colombia. Centro de Investigacion de la Cana de Azucar de Colombia Cenicana, Cali, 157 pp.","Kondo, T. (2001) Las Cochinillas de Colombia (Hemiptera: Coccoidea). Biota Colombiana, 2 (1), 31 - 48.","Kondo, T., Ramos-Portilla, A. R. & Vergara, V. (2008) Updated list of Mealybugs and Putoids from Colombia (Hemiptera: Pseudococcidae and Putoidae). Boletin del Museo Entomologico de la Universidad del Falle, 9 (1), 29 - 53."]}