Search

Reniform nematodes (Rotylenchulus spp.) have been reported to be associated with a large number of important products all over the world, ranging from important cereals, vegetables and ornamental plants. In this study, morphologic and molecular characters were used to idetify Rotylenchulus population obtained from a soybean field in Adana province of Turkey. Nematodes were extracted from the soil using a modified baermann funnel method. The morphological characters and morphometrics of male and immature females were examined and compared with previous studies. For molecular characterisation, DNA was extracted from immature females and the D2-D3 expansion region of the 28S rRNA gene was amplified using primer pair D2A (5’ACA AGTACCGTGAGGGAAAGTTG 3’) and D3B (5’ TCGGAAGGAACCAGCTACTA 3’). PCR product (780 bp) was sequenced and then compared with sequences of Rotylenchulus species available in the GenBank database. The result obtained from morphologic and molecular studies showed that the reniform nematode population was Rotylenchulus borealis.

In this investigation, the species of root-knot nematodes (RKNs) infesting weeds in kiwifruit orchards were investigated in the Ordu Province, Türkiye. A survey was conducted in 2018 and roots of weeds with RKN infestations were found in kiwifruit orchards. The infested weed samples were collected from 27 kiwifruit fruit orchards located in the Ordu Province. Identification of RKNs was performed using the molecular method based on mitochondrial DNA (mtDNA). The mtDNA region between the cytochrome oxidase II and the large subunit ribosomal RNA was amplified using two pairs of primers TRNAH/MRH106 and MORF/MTHIS. Species-specific primers previously described were used to confirm Meloidogyne species as the last step. Meloidogyne incognita (Kofoid & White, 1919), Meloidogyne arenaria (Neal, 1889) and Meloidogyne hapla (Chitwood, 1949) (Tylenchida: Meloidogynidae) were identified from fifteen weed species (2 unidentified) in eight families. Meloidogyne incognita was the most frequent species with 74.1% of the samples infested, followed by M. hapla at 22.2% and M. arenaria at 3.7%. In this study found Erigeron canadensis L. (Asterales: Asteraceae), Mercurialis annua L. (Malpighiales: Euphorbiaceae), Oxalis pes-caprae L. (Oxalidales: Oxalidaceae), Clinopodium nepeta (L.) Kuntze (Lamiales: Lamiaceae), Fumaria officinalis L. (Ranunculales: Papaveraceae) and Lycopus spp. (Lamiales: Lamiaceae) to be previously unrecorded hosts of M. incognita and Sigesbeckia orientalis L. (Asterales: Asteraceae) and Lythrum spp. (Myrtales: Lythraceae) a host of M. hapla., Bu araştırmada, Ordu ilinde kivi bahçelerinde yabancı otları enfekte eden kök-ur nematod türleri araştırılmıştır. 2018 yılında bir sürvey çalışması ile kivi bahçelerinde kök-ur nematodu ile bulaşık yabancı ot kökleri gözlemlenmiş ve 27 kivi bahçesinden yabancı ot örnekleri toplanmıştır. Tür teşhisleri mitokondriyal DNA'ya dayalı moleküler yöntem kullanılarak yapılmıştır. Sitokrom oksidaz II ve ribozomal RNA büyük alt birimi arasındaki mtDNA bölgesi, iki çift primer TRNAH/MRH106 ve MORF/MTHIS kullanılarak çoğaltılmıştır. Teşhislerin doğrulanması için türe özgü spesifik primerler kullanılmıştır. Sekiz familyaya ait 15 yabancı ot türünden (ikisi tanımlanamayan) Meloidogyne incognita (Kofoid & White, 1919), Meloidogyne arenaria (Neal, 1889) ve Meloidogyne hapla (Chitwood, 1949) (Tylenchida: Meloidogynidae) türleri tespit edilmiştir. Bulaşık bahçelerde M. incognita en sık görülen tür olup, örneklerin %74,1'i enfekteli bulunmuş, bunu %22.2 ile M. hapla ve %3.7 ile M. arenaria izlemiştir. Bu çalışmada Erigeron canadensis L. (Asterales: Asteraceae), Mercurialis annua L. (Malpighiales: Euphorbiaceae), Oxalis pes-caprae L. (Oxalidales: Oxalidaceae), Clinopodium nepeta (L.) Kuntze (Lamiales: Lamiaceae), Fumaria officinalis L. (Ranunculales: Papaveraceae) ve Lycopus spp. (Lamiales: Lamiaceae) türleri M. incognita için, Sigesbeckia orientalis L. (Asterales: Asteraceae) ve Lythrum spp. (Myrtales: Lythraceae) ise M. hapla için daha önce kaydedilmemiş konukçular olarak bulunmuştur.

Swiss Chard (Beta vulgaris subsp. cicla) is a vegetable crops growing in different regions of the world for variying purposes. Root-knot nematodes (Meloidogyne spp.) seem the potantial pest group on Swiss Chard according to the reported species from other countries. In this investigation, the root knot nematode (RKN) extracted from the root of Swiss Chard was identified as M. arenaria by using different primer sets (TRNAH-MRH106 and MORF- MTHIS) targeting the large sub-unit ribosomal DNA (lrDNA) and the intergenic spacer (IGS) of rDNA of mitochondrial (mtDNA). Furthermore, the restriction enzymes (HinfI and MnlI) for the fragments given by TRNAH-MRH106 primer set was also used for restriction and digestion. Finally, species-specific SCAR primers (Far/Rar) were performed to validation of the identification results. M. arenaria is considered as an important species among the major root knot nematodes in the world. In this context, the Swiss Chard as an intercroped, small-scale produced or randomly dispersed commodity must be observed as the potantial host for the nematode. This is especially important in case of any change for long term professional production planning in the same area for more valuable agricultural commodity.

Root-lesion nematode Pratylenchus thornei is one of the most economically important and widely distributed species worldwide. Hazelnut (Corylus avellana L.) is a main perennial crop in Turkey. This study reports the molecular and morphological characterization of P. thornei from hazelnut orchards from Ordu province. In June 2016, soil samples were collected from around the roots of hazelnut trees in Ordu. Nematodes were extracted from soil using a modified Baermann funnel method. The standard morphometric characters were measured for root-lesion nematodes and compared with previous studies. For molecular characterization, DNA was extracted from adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA. The PCR product was purified and sequenced. The sequence was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 100% with P. thornei (e.g., GenBank Accession Nos. KT213559.1, and JX261954.1). This study indicated that P. thornei is the species occurring on hazelnut in Ordu provinces, Turkey.

Buçalışma, bitkilerde ekonomik kayıplara neden olan iki önemli bitki parazitinematodlar kök-ur nematodu (Meloidogyne spp.) ile kök-lezyon nematodu (Pratylenchus spp.)’nun mısır (Zea mays L.) yetiştiriciliği yapılanalanlardaki mevsimsel populasyon dalgalanmalarının belirlenmesiniamaçlamaktadır. Ordu ilinde 2016-2017 yıllarında iki farklı mısıryetiştiriciliğinin yapıldığı alanlardaki (A ve B tarlası) toprak içerisindebulunan kök-ur nematodu ikinci dönem larvaları (J2) ile kök lezyonnematodlarına ait bireylerin populasyon dalgalanması yıl boyunca aylıkperiyotlarda takip edilmiştir. Çalışma sonucunda A tarlasında en yüksekpopulasyon yoğunluğu 2017 yılının Ekim ayında Meloidogyne spp. için 462 (J2/100 cm3 toprak) iken, Pratylenchus spp. için ise 38 (J2 /100cm3 toprak) olarak tespit edilmiştir. B tarlasında yapılansayımlarda ise en yüksek populasyon yoğunluğu Meloidogyne spp. için 2016 yılının Aralık ayında 203 (J2/100 cm3toprak) gözlenirken, Pratylenchusspp. için Ağustos ayındaki yoğunluk 63 (nematod/100 cm3 toprak)olarak bulunmuştur. İki tarlada da kökur nematodunun populasyon yoğunluğunda Sonbahar’a doğru belirgin artışgözlendiği, yaz aylarında ise yoğunluğun düşük seviyede devam ettiğigözlenmiştir. Kök lezyon nematodlarında ise populasyon yoğunluğu topraksıcaklığı ile pozitif ilişki göstererek yıl boyunca belirli bir düzeyde artışgösterdiği tespit edilmiştir., Thisstudy aims to determine the seasonal population fluctuations of two important plantparasitic nematodes root-knot nematodes (Meloidogynespp.) and root-lesion nematodes (Pratylenchusspp.) that causing economic losses in plants in the world in maize (Zea mays L.) growing areas. Populationfluctuations of root-knot nematode infective second-stage larvae (J2) and rootlesion nematode individuals (larvae+female) in soil were monitored monthly intwo different maize growing fields (A and B) during 2016 and 2017 in Orduprovince of Turkey. In the result of the study, the highest population wereobserved in October 2017 as 462 (J2/100 cm3 soil) for Meloidogyne spp. and 38 individuals /100cm3 soil for Pratylenchusspp. at field A. The highest population of Meloidogynespp. were observed as 203 J2/100 cm3 soil in December 2016, while Pratylenchus spp. in August for 63individuals/100 cm3 soil at field B. In both fields, populations of root-knotnematodes in the soil were increased significantly in autumn months, butcontinued in low levels in summer. The root lesion nematodes population densityshowed a positive correlation with the soil temperature and increased at acertain level throughout the year.

Paratylenchus (Gracilacus) straeleni (De Coninck, 1931) Oostenbrink, 1960 was detected for the first time in Turkey. Our studied population was found in the rhizosphere soil of hazelnut orchards in Ordu. Females and males were studied morphologically and morphometrically by light microscopy and molecularly by sequencing the D2-D3 of the 28S rDNA gene. We present here the morphological and molecular characterisation, phylogenetic analysis of examined population and comparison of variability of worldwide known populations of P. straeleni.

This study was conducted to evaluate some effects of hazelnut dried husk extract and husk compost on nematode infection and some plant parameters of tomato inoculated by mixed root-knot nematodes populations of Meloidogyne hapla and M. arenaria in pot experiment. The dried hazelnut husk obtained from after harvest were used. For both husk extract and husk compost treatment, 50 grams of hazelnut husk was used. Approximately 1000 second stage juveniles (J2) was inoculated to susceptible tomato cultivar ( Solanum lycopersicum cv. Rio Grande). At the end of 8 weeks, the gall numbers on the root, number of the juveniles in the pot, plant fresh root weight and total plant fresh weight were measured. As result, the husk compost treated plants had lower gall on the root system and juvenile numbers in the pot soil by comparison with husk extract treatment. For plant growth parameters, the total plant fresh weight was significantly different for husk compost treatment. The all results seemed that the husk compost treatment has more effect on Meloidogyne spp. gall numbers than husk extract application on tomato.

The study was conducted to investigate the status of soil nematode communities in hazelnut orchards in Ordu province, Turkey. Nematodes were identified to genus level and allocated to trophic groups. A total of 50 taxa were found from hazelnut growing areas including 19 plant parasites, 12 bacterivorous, 4 fungivorous, 4 predators and 11 omnivorous. Genera Tylenchus (94.5%), Gracilacus (79.1%) and Helicotylenchus (56.4%) as plant parasites, Acrobeloides (68%) as bacterivores and Aphelenchoides (68.2%) as fungivorous were widespread and found in all districts. The highest abundance of plant parasites was in KabataAŸ (277 individual/ 100 cm3 soil) followed by Golkoy (196.6 ind./ 100 cm3 soil) district. Criconemella, Meloidogyne, Paratylenchus and Pratylenchus were found as important genera by means of the damage potantial on hazelnut as plant parasitic group. The other trophic groups were at desirable level for an healthy soil system. Key words: Hazelnut orchards, hazelnut nematodes, nematode community, nematode abundance, Ordu.

Hirschmanniella dicksoni n. sp. isolated from the rhizosphere soil of limpograss is described and illustrated based on morphology and molecular characters. The new species is characterized by its body length, 1,582 to 1,929 µm, hemispherical lip region with 6 to 7 annules, stylet length 19 to 21 µm, irregularly areolated lateral fields, oval spermatheca filled with rounded sperm, intestine not overlapping the rectum, and tail length 103 to 149 µm, usually with ventral projection with subterminal notch. Males are similar to the females except for their shorter body length and presence of secondary sexual characteristics, with spicules length 19 to 30 µm. The new species is closely related with H. mucronata, H. belli, and H. oryzae. Compared with these three species, the new species has a relatively longer tail and a terminus shape tail with a ventral projection with a subterminal notch. Other morphological and morphometric characteristics that separate these species are as follows: lip region, number of lip annuli, and spicules length. Molecular sequence analysis using the D2–D3 expansion segments of 28S and the ITS rRNA sequences showed that the new species is genetically distinct. D2–D3 sequence of H. dicksoni n. sp. showed 99 and 95% sequence homology with an undescribed species of Hirschmanniella isolated from the Colorado River in Yuma, Arizona, and H. oryzae, respectively. ITS sequence of the new species also showed 88% sequence homology with H. oryzae. The phylogenetic analysis of D2–D3 and ITS region grouped H. dicksoni n. sp., as sister species, with H. oryzae.

This research was conducted to find out the effect of four plant methanol extracts against the root-knot nematode Meloidogyne incognita (Kofoid and White) Chitwood in laboratory at the University of Gaziosmanpasa, Turkey. For this purpose, bead tree ( Melia azedarach ), hops ( Humulus lupulus ), elderberry ( Sambucus nigra ), poison hemlock (Conium maculatum ) were collected from different zones of the Turkey. Methanol extracts from four plant parts were screened for egg hatchability and nematicidal activity against second stage juveniles (J 2) of M. incognita. The nematode eggs and juveniles were exposed to different concentrations of extracts during 24, 48 and 72 hrs. The concentrations as 0.5%, 1%, 2.5%, 5% and 10% were prepared by diluting stock solution with 10% acetone containing distilled water. As a result, M. azedarach ’s 10% (v/v) concentration significantly reduced the egg hatchability (97%) and it was followed by S. nigra (92.9%). At the end of 24 hrs incubation, 5% and 10% (v/v) concentration of M. azedarach extract and 2.5%, 5.0% and 10% (v/v) concentration of S. nigra produced 100% mortality in juvenile stage of the nematode. The results of our investigation show that four plants contain nematicidal compounds. it seems that the use of plant extracts might have increasing popularity in future as a component or ingredient of biopesticides. Therefore, further research is necessary to found out toxic compounds released by species and carried out experiments in vivo for the control of root-knot nematode M. incognita . Original Research Article

This study was conducted to determine the suppressiveness of obligat parasite P. penetrans against the peanut root-knot nematode Meloidogyne arenaria race 1 in vegetable growing site and to find out whether the field site have infested with other root-knot nematode species, causing the suppression to break down. The study were carried out at four vegetable crops grown sites tomato Lycopersicon lycopersicum cv. Bella Rosa, cucumber Cucumis sativus L. cv. Cobra, okra Abelmoschus (=Hibiscus) esculentus (L.) Moench cv. Clemson Spineless and squash Cucurbita pepo L. cv. Golden Summer at the Plant Science Research and Education Unit-Citra, University of Florida, US. The field site was arranged in a split plot design with eight replicates. To determine the effect of 1,3dichloropropene (1,3-D) on P. penetrans, the split plot was fumigated with 1,3-D (Telone II)at dose of 112 L/ha.. Plant and soil samples were collected from each plot at harvest time. The percentages of M. arenaria race 1 infective juvenile (J2) with endospores attached ranged from 40%to 10%.. Only a very low incidence of M. incognita was extracted from tomato roots galls.. The results indicate that P. penetrans is likely to be one of the important effective agent in the nematode suppression and the reduction M. arenaria race 1 damage, Bu çalışmanın amacı, obligat parazit olan Pasteuria penetrans bakterisinin sebze yetiştirilen alanlarda kök-ur nematodu Meloidogyne arenaria ırk 1’e karşı baskınlığını ortaya çıkarmak, bu baskınlığın etkisinin kırılmasına neden olan diğer kök-ur nematod türlerinin alanda bulunup bulunmadığını tespit etmektir. Bu amaçla 2011 yılının Mart ayında, daha önceden P. penetrans bulaştırılmış ve M. arenaria race 1’e karşı baskın olduğu bilinen Florida Üniversitesi’nin araştırma arazisinde, domates Lycopersicon lycopersicum cv. Bella Rosa, salatalık Cucumis sativus L. cv. Cobra, bamya Abelmoschus (=Hibiscus) esculentus (L.) cv. Clemson Spineless ve kabak Cucurbita pepo L. cv. Golden Summer gibi dört farklı sebze çeşidi yetiştirilmeye başlanmıştır. Çalışma bölünmüş parseller deneme deseninde 8 tekerrürlü olarak yürütülmüştür. Her bir sebze çeşidi için biri ilaçlı diğeri ilaçsız olacak şekilde parseller hazırlanmıştır. Ilaçlı parseller 112 lt/ha oranında 1,3-dichloropropene (1,3-D) (Telone II) ile ilaçlanmıştır. Tüm deneme parsellerinden hasat sonunda bitki kökleri ve toprak örnekleri alınarak inceleme yapılmıştır. Alınan toprak örneklerinden elde edilen M. arenaria ırk 1 juvenillerinin P. penetrans’ın endosporları ile bulaşıklık oranı en yüksek %40 olarak kimyasal uygulanmış kabak parselinde, en düşük endospor bulaşıklık oranı ise kimyasal uygulanmayan bamya parselinde yaklaşık %10 olarak gözlenmiştir. Deneme alanlarında yetiştirilen sebzelerden yalnızca domates bitkisi köklerinde çok düşük oranda diğer nematode türlerinden M. incognita tespit edilmiştir. Çalışmadan elde edilen sonuçlar, sebzelerde M. arenaria race 1 tarafından meydana gelen zararın azaltılmasında ve bu nematodun baskı altında tutulmasında P. penetrans’ın önemli bir etmen olduğunu ortaya koymuştur

Background Dispersal is an important nematode behavior. Upon crowding or food depletion, the free living bacteriovorus nematode Caenorhabditis elegans produces stress resistant dispersal larvae, called dauer, which are analogous to second stage juveniles (J2) of plant parasitic Meloidogyne spp. and infective juveniles (IJ)s of entomopathogenic nematodes (EPN), e.g., Steinernema feltiae. Regulation of dispersal behavior has not been thoroughly investigated for C. elegans or any other nematode species. Based on the fact that ascarosides regulate entry in dauer stage as well as multiple behaviors in C. elegans adults including mating, avoidance and aggregation, we hypothesized that ascarosides might also be involved in regulation of dispersal behavior in C. elegans and for other nematodes such as IJ of phylogenetically related EPNs. Methodology/Principal Findings Liquid chromatography-mass spectrometry analysis of C. elegans dauer conditioned media, which shows strong dispersing activity, revealed four known ascarosides (ascr#2, ascr#3, ascr#8, icas#9). A synthetic blend of these ascarosides at physiologically relevant concentrations dispersed C. elegans dauer in the presence of food and also caused dispersion of IJs of S. feltiae and J2s of plant parasitic Meloidogyne spp. Assay guided fractionation revealed structural analogs as major active components of the S. feltiae (ascr#9) and C. elegans (ascr#2) dispersal blends. Further analysis revealed ascr#9 in all Steinernema spp. and Heterorhabditis spp. infected insect host cadavers. Conclusions/Significance Ascaroside blends represent evolutionarily conserved, fundamentally important communication systems for nematodes from diverse habitats, and thus may provide sustainable means for control of parasitic nematodes.