Search

Tomato leaf curl New Delhi virus (ToLCNDV) is an emerging plant pathogen, fast spreading in Asian and Mediterranean regions, and is considered the most harmful geminivirus of cucurbits in the Mediterranean. ToLCNDV infects several plant and crop species from a range of families, including Solanaceae, Cucurbitaceae, Fabaceae, Malvaceae and Euphorbiaceae. Up to now, protection from ToLCNDV infection has been achieved mainly by RNAi-mediated transgenic resistance, and non-transgenic fast-developing approaches are an urgent need. Plant protection by the delivery of dsRNAs homologous to a pathogen target sequence is an RNA interference-based biotechnological approach that avoids cultivating transgenic plants and has been already shown effective against RNA viruses and viroids. However, the efficacy of this approach against DNA viruses, particularly Geminiviridae family, is still under study. Here, the protection induced by exogenous application of a chimeric dsRNA targeting all the coding regions of the ToLCNDV DNA-A was evaluated in zucchini, an important crop strongly affected by this virus. A reduction in the number of infected plants and a delay in symptoms appearance, associated with a tendency of reduction in the viral titer, was observed in the plants treated with the chimeric dsRNA, indicating that the treatment is effective against geminiviruses but requires further optimization. Limits of RNAi-based vaccinations against geminiviruses and possible causes are discussed.

Since the 1950s, there have been major changes in the scope, value, and organization of the ornamental plant industry. With fewer individual producers and a strong trend toward consolidation and globalization, increasing quantities of diverse plant genera and species are being shipped internationally. Many more ornamentals are propagated vegetatively instead of by seed, further contributing to disease spread. These factors have led to global movement of pathogens to countries where they were not formerly known. The emergence of some previously undescribed pathogens has been facilitated by high-throughput sequencing, but biological studies are often lacking, so their roles in economic diseases are not yet known. Case studies of diseases in selected ornamentals discuss the factors involved in their spread, control measures to reduce their economic impact, and some potential effects on agronomic crops. Advances in diagnostic techniques are discussed, and parallels are drawn to the international movement of human diseases.

In March 2022, following the annual International Committee on Taxonomy of Viruses (ICTV) ratification vote on newly proposed taxa, the phylum Negarnaviricota was amended and emended. The phylum was expanded by two new families (bunyaviral Discoviridae and Tulasviridae), 41 new genera, and 98 new species. Three hundred forty-nine species were renamed and/or moved. The accidentally misspelled names of seven species were corrected. This article presents the updated taxonomy of Negarnaviricota as now accepted by the ICTV., (© 2022. This is a U.S. Government work and not under copyright protection in the US; foreign copyright protection may apply.)

In March 2021, following the annual International Committee on Taxonomy of Viruses (ICTV) ratification vote on newly proposed taxa, the phylum Negarnaviricota was amended and emended. The phylum was expanded by four families (Aliusviridae, Crepuscuviridae, Myriaviridae, and Natareviridae), three subfamilies (Alpharhabdovirinae, Betarhabdovirinae, and Gammarhabdovirinae), 42 genera, and 200 species. Thirty-nine species were renamed and/or moved and seven species were abolished. This article presents the updated taxonomy of Negarnaviricota as now accepted by the ICTV., (© 2021. This is a U.S. government work and not under copyright protection in the U.S.; foreign copyright protection may apply.)

Tomato spotted wilt virus (TSWV) is a devastating plant pathogen, causing huge crop losses worldwide. Unfortunately, due to its wide host range and emergence of resistance breaking strains, its management is challenging. Up to now, resistance to TSWV infection based on RNA interference (RNAi) has been achieved only in transgenic plants expressing parts of the viral genome or artificial microRNAs targeting it. Exogenous application of double-stranded RNAs (dsRNAs) for inducing virus resistance in plants, namely RNAi-based vaccination, represents an attractive and promising alternative, already shown to be effective against different positive-sense RNA viruses and viroids. In the present study, the protection efficacy of exogenous application of dsRNAs targeting the nucleocapsid ( N ) or the movement protein ( NSm ) coding genes of the negative-sense RNA virus TSWV was evaluated in Nicotiana benthamiana as model plant and in tomato as economically important crop. Most of the plants treated with N -targeting dsRNAs, but not with NSm -targeting dsRNAs, remained asymptomatic until 40 ( N. benthamiana ) and 63 (tomato) dpi, while the remaining ones showed a significant delay in systemic symptoms appearance. The different efficacy of N - and NSm -targeting dsRNAs in protecting plants is discussed in the light of their processing, mobility and biological role. These results indicate that the RNAi-based vaccination is effective also against negative-sense RNA viruses but emphasize that the choice of the target viral sequence in designing RNAi-based vaccines is crucial for its success., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2020 Tabein, Jansen, Noris, Vaira, Marian, Behjatnia, Accotto and Miozzi.)

The family Alphaflexiviridae includes viruses with flexuous filamentous virions that are 470-800 nm in length and 12-13 nm in diameter. Alphaflexiviruses have a single-stranded, positive-sense RNA genome of 5.5-9 kb. They infect plants and plant-infecting fungi. They share a distinct lineage of alphavirus-like replication proteins that is unusual in lacking any recognized protease domain. With a single exception, cell-to-cell and long-distance movement is facilitated by triple gene block proteins in plant-infecting genera. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Alphaflexiviridae, which is available at www.ictv.global/report/alphaflexiviridae.

Tomato plants can establish symbiotic interactions with arbuscular mycorrhizal fungi (AMF) able to promote plant nutrition and prime systemic plant defenses against pathogens attack; the mechanism involved is known as mycorrhiza-induced resistance (MIR). However, studies on the effect of AMF on viral infection, still limited and not conclusive, indicate that AMF colonization may have a detrimental effect on plant defenses against viruses, so that the term "mycorrhiza-induced susceptibility" (MIS) has been proposed for these cases. To expand the case studies to a not yet tested viral family, that is, Bromoviridae, we investigated the effect of the colonization by the AMF Funneliformis mosseae on cucumber mosaic virus (CMV) infection in tomato by phenotypic, physiological, biochemical, and transcriptional analyses. Our results showed that the establishment of a functional AM symbiosis is able to limit symptoms development. Physiological and transcriptomic data highlighted that AMF mitigates the drastic downregulation of photosynthesis-related genes and the reduction of photosynthetic CO 2 assimilation rate caused by CMV infection. In parallel, an increase of salicylic acid level and a modulation of reactive oxygen species (ROS)-related genes, toward a limitation of ROS accumulation, was specifically observed in CMV-infected mycorrhizal plants. Overall, our data indicate that the AM symbiosis influences the development of CMV infection in tomato plants and exerts a priming effect able to enhance tolerance to viral infection.

Global population forecasts dictate a rapid adoption of multifaceted approaches to fulfill increasing food requirements, ameliorate food dietary value and security using sustainable and economically feasible agricultural processes. Plant pathogens induce up to 25% losses in vegetable crops and their early detection would contribute to limit their spread and economic impact. As an alternative to time-consuming, destructive, and expensive diagnostic procedures, such as immunological assays and nucleic acid-based techniques, Raman spectroscopy (RS) is a nondestructive rapid technique that generates a chemical fingerprinting of a sample, at low operating costs. Here, we assessed the suitability of RS combined to chemometric analysis to monitor the infection of an important vegetable crop plant, tomato, by two dangerous and peculiarly different viral pathogens, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato spotted wilt virus (TSWV). Experimentally inoculated plants were monitored over 28 days for symptom occurrence and subjected to RS analysis, alongside with measuring the virus amount by quantitative real-time PCR. RS allowed to discriminate mock inoculated (healthy) from virus-infected specimens, reaching an accuracy of >70% after only 14 days after inoculation for TYLCSV and >85% only after 8 days for TSWV, demonstrating its suitability for early detection of virus infection. Importantly, RS also highlighted spectral differences induced by the two viruses, providing specific information on the infecting agent.

Plant roots establish interactions with several beneficial soil microorganisms including arbuscular mycorrhizal fungi (AMF). In addition to promoting plant nutrition and growth, AMF colonization can prime systemic plant defense and enhance tolerance to a wide range of environmental stresses and below-ground pathogens. A protective effect of the AMF against above-ground pathogens has also been described in different plant species, but it seems to largely rely on the type of attacker. Viruses are obligate biotrophic pathogens able to infect a large number of plant species, causing massive losses in crop yield worldwide. Despite their economic importance, information on the effect of the AM symbiosis on viral infection is limited and not conclusive. However, several experimental evidences, obtained under controlled conditions, show that AMF colonization may enhance viral infection, affecting susceptibility, symptomatology and viral replication, possibly related to the improved nutritional status and to the delayed induction of pathogenesis-related proteins in the mycorrhizal plants. In this review, we give an overview of the impact of the AMF colonization on plant infection by pathogenic viruses and summarize the current knowledge of the underlying mechanisms. For the cases where AMF colonization increases the susceptibility of plants to viruses, the term "mycorrhiza-induced susceptibility" (MIS) is proposed.

The propensity of viruses to acquire genetic material from relatives and possibly from infected hosts makes them excellent candidates as vectors for horizontal gene transfer. However, virus-mediated acquisition of host genetic material, as deduced from historical events, appears to be rare. Here, we report spontaneous and surprisingly efficient generation of hybrid virus/host DNA molecules in the form of minicircles during infection of Beta vulgaris by Beet curly top Iran virus (BCTIV), a single-stranded DNA virus. The hybrid minicircles replicate, become encapsidated into viral particles, and spread systemically throughout infected plants in parallel with the viral infection. Importantly, when co-infected with BCTIV, B. vulgaris DNA captured in minicircles replicates and is transcribed in other plant species that are sensitive to BCTIV infection. Thus, we have likely documented in real time the initial steps of a possible path of virus-mediated horizontal transfer of chromosomal DNA between plant species.

The Lolium latent virus (LoLV) major coat protein sequence contains a typical chloroplast transit peptide (cTP) domain. In infected Nicotiana benthamiana leaf tissue, LoLV coat proteins can be detected at the chloroplast. In transient expression, several N-terminal deletions of the CP sequence, increasing in length, result in disruption of the domain functionality, markedly affecting intracellular localization. A yeast two-hybrid-based study using LoLV CP as bait identified several potentially interacting Arabidopsis host proteins, most of them with chloroplast-linked pathways. One of them, an ankyrin repeat protein, was studied in detail. The N. benthamiana homologue (NbANKr) targets chloroplasts, is able to co-localize with LoLV CP at chloroplast membranes in transient expression and shows a robust interaction with LoLV CP in vivo by BiFC, which has been confirmed by yeast two-hybrid data. Silencing NbANKr genes in N. benthamiana plants, prior to challenging with LoLV by mechanical inoculation, affects LoLV infection, significantly reducing the level of viral RNA in young leaves, compared to levels in control plants, and suggesting an inhibition of virus movement. Silencing of NbANKr has no obvious effect on plant phenotype, but is able to interfere with LoLV infection, opening the way for a new strategy for virus infection control.

Chickpea chlorotic dwarf virus (CpCDV), a polyphagous mastrevirus, family Geminiviridae , has been recently linked to the onset of the "hard fruit syndrome" of watermelon, first described in Tunisia, that makes fruits unmarketable due to the presence of white hard portions in the flesh, chlorotic mottling on the rind, and an unpleasant taste. To investigate the etiological agent of this disease, total RNA extracted from symptomatic watermelon fruits was subjected to small RNA sequencing through next generation sequencing (NGS) techniques. Data obtained showed the presence of CpCDV and two other viral species. However, following validation through polymerase chain reaction (PCR), CpCDV was the only viral species consistently detected in all samples. Watermelon seedlings were then challenged by an agroinfectious CpCDV clone; several plants proved to be CpCDV-infected, and were able to produce fruits. CpCDV infected and replicated in watermelon fruits and leaves, leading to abnormality in fruits and in seed production, similar to those described in field. These results indicate that CpCDV is the etiological agent of the "hard fruit syndrome" of watermelon., Competing Interests: The authors declare no conflict of interest. The funding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.

The Ophioviridae is a family of filamentous plant viruses, with single-stranded negative, and possibly ambisense, RNA genomes of 11.3-12.5 kb divided into 3-4 segments, each encapsidated separately. Virions are naked filamentous nucleocapsids, forming kinked circles of at least two different contour lengths. The sole genus, Ophiovirus, includes seven species. Four ophioviruses are soil-transmitted and their natural hosts include trees, shrubs, vegetables and bulbous or corm-forming ornamentals, both monocots and dicots. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Ophioviridae, which is available at http://www.ictv.global/report/ophioviridae.

Different isolates of Alternanthera mosaic virus (AltMV; Potexvirus), including four infectious clones derived from AltMV-SP, induce distinct systemic symptoms in Nicotiana benthamiana. Virus accumulation was enhanced at 15 °C compared to 25 °C; severe clone AltMV 3-7 induced systemic necrosis (SN) and plant death at 15 °C. No interaction with potexvirus resistance gene Rx was detected, although SN was ablated by silencing of SGT1, as for other cases of potexvirus-induced necrosis. Substitution of AltMV 3-7 coat protein (CPSP) with that from AltMV-Po (CP(Po)) eliminated SN at 15 °C, and ameliorated symptoms in Alternanthera dentata and soybean. Substitution of only two residues from CP(Po) [either MN(13,14)ID or LA(76,77)IS] efficiently ablated SN in N. benthamiana. CPSP but not CP(Po) interacted with Arabidopsis boron transporter protein AtBOR1 by yeast two-hybrid assay; N. benthamiana homolog NbBOR1 interacted more strongly with CPSP than CP(Po) in bimolecular fluorescence complementation, and may affect recognition of CP as an elicitor of SN., (Published by Elsevier Inc.)

In the early spring of 2011 and 2012, severe necrotic leaf symptoms were observed on freesia (Freesia refracta, family Iridaceae) in several greenhouses around Plovdiv (south central Bulgaria). The disease spread and symptom severity in several cultivars (Medeo, Calvados, and Pink Fountain) led to nearly complete production failure for some growers. Initial symptoms consisted of scattered pale, chlorotic, interveinal lesions that coalesced. Later, irregular brown to black necrotic blotches partially covered the leaves. Flower break was also observed. Diseased plants were collected in late April 2012 from one of the surveyed greenhouses, where >90% of Medeo (white-flowered) and 35 to 40% of Pink Fountain (pink) plants were symptomatic. Total RNA was extracted from three pooled samples of ~10 plants each and analyzed for Freesia sneak virus (3) (FreSV, Ophiovirus, Ophioviridae) infection by RT-PCR. A generic Ophiovirus RT-PCR (4) yielded the diagnostic 136-bp product, while primers FOV1 (TGCTCGAATAGCCGGAACTGAA) and FOV2 (TGCTTCCAGGTGTAAGATGGCA), designed from the Italian FreSV coat protein gene (RNA3; GenBank DQ885455), specifically amplified a 466 bp fragment. This FreSV-specific fragment was amplified from all samples, pooled, purified, and subjected to direct sequencing using the same primers. The deduced amino acid sequence had 99.8% identity to that of DQ885455, confirming FreSV infection in the symptomatic Bulgarian freesias. FreSV RNA3 (about 1.5 kbp) was also detected by northern blotting using a specific Digoxigenin-DNA probe (PCR-DIG Probe Synthesis Kit, Roche) amplified with primers FOV1/2. Due to severe symptoms present on freesias, a mixed infection was suspected. Several other viruses have been reported to infect cultivated freesia (1), so diagnostic primers for Cucumber mosaic virus (CMV, Cucumovirus, Bromoviridae), Tobacco rattle virus (TRV, Tobravirus, Virgaviridae), and Potyvirus genus (4) were used in RT-PCR assays with random-primed cDNA from infected freesias as the template. No CMV or TRV PCR products were detected; a generic potyvirus PCR product was identified as Freesia mosaic virus (FreMV, Potyvirus, Potyviridae) by sequencing of five independent clones. Severe leaf necrosis syndrome was described in freesia in The Netherlands before 1970, as well as in England and Germany; FreSV is a putative agent of freesia leaf necrosis, being reported in strong association with the disease in Italy, The Netherlands, the United States, and New Zealand, and also infects Lachenalia hyb. (Hyacinthaceae) (2,3,4). However, additional unidentified synergistic viral agents cannot be ruled out and must be identified to aid control of soilborne severe leaf necrosis syndrome. The vector of FreSV, Olpidium brassicae, may persist in soil for years (3). To our knowledge, this is the first report of FreSV on F. refracta in Bulgaria; identifying the disease and vector may allow growers to implement preventive control measures to reduce economic damage. References: (1) A. A. Brunt. In: Virus and Virus-Like Diseases of Flower Crops, pp. 274-280, Wiley, 1995. (2) M. N. Pearson et al. Austr. Plant Path. 38:305, 2009. (3) A. M. Vaira and R. G Milne. In: Encyclopedia of Virology, III ed., vol. 3, pp. 447-454, Elsevier, 2008. (4) A. M. Vaira et al. Plant Dis. 93:965, 2009.

Tomato line 30.4 was obtained engineering the nucleocapsid (N) gene of tomato spotted wilt virus into plant genome, and immunity to tomato spotted wilt virus infection of its self-pollinated homozygous progeny was observed. Despite the presence of a high amount of transgenic transcripts, transgenic proteins have not been detected, suggesting a mechanism of resistance mediated by RNA. In the present study, we identify post-transcriptional gene silencing as the main mechanism of resistance, which is able to spread systemically through grafting, and show that the line 30.4 resistant plants produce both 24 and 21-22 nt N-gene specific siRNA classes. The transgenic locus in chromosome 4 shows complex multiple insertions of four T-DNA copies in various orientations, all with 3' end deletions in the terminator and part of the N gene. However, for three of them, polyadenylated transcripts are produced, due to flanking tomato genome sequences acting as alternative terminators. Interestingly, starting at the fifth generation after the transformation event, some individual plants show a tomato spotted wilt virus-susceptible phenotype. The change is associated with the disappearance of transgene-specific transcripts and siRNAs, and with hyper-methylation of the transgene, which proceeds gradually through the generations. Once it reaches a critical threshold, the shift from post-transcriptional gene silencing to transcriptional silencing of the transgene eliminates the previously well established virus resistance., (© 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.)

The genome of Lolium latent virus (LoLV; genus Lolavirus, family Alphaflexiviridae) is encapsidated by two carboxy-coterminal coat protein (CP) variants (about 28 and 33 kDa), in equimolar proportions. The CP ORF contains two 5'-proximal AUGs encoding Met 1 and Met 49, respectively promoting translation of the 33 and 28 kDa CP variants. The 33 kDa CP N-terminal domain includes a 42 aa sequence encoding a putative chloroplast transit peptide, leading to protein cleavage and alternative derivation of the approximately 28 kDa CP. Mutational analysis of the two in-frame start codons and of the putative proteolytic-cleavage site showed that the N-terminal sequence is crucial for efficient cell-to-cell movement, functional systemic movement, homologous CP interactions and particle formation, but is not required for virus replication. Blocking production of the 28 kDa CP by internal initiation shows no major outcome, whereas additional mutation to prevent proteolytic cleavage at the chloroplast membrane has a dramatic effect on virus infection.

Cell-to-cell movement of potexviruses requires coordinated action of the coat protein and triple gene block (TGB) proteins. The structural properties of Alternanthera mosaic virus (AltMV) TGB3 were examined by methods differentiating between signal peptides and transmembrane domains, and its subcellular localization was studied by Agrobacterium-mediated transient expression and confocal microscopy. Unlike potato virus X (PVX) TGB3, AltMV TGB3 was not associated with the endoplasmic reticulum, and accumulated preferentially in mesophyll cells. Deletion and site-specific mutagenesis revealed an internal signal VL(17,18) of TGB3 essential for chloroplast localization, and either deletion of the TGB3 start codon or alteration of the chloroplast-localization signal limited cell-to-cell movement to the epidermis, yielding a virus that was unable to move into the mesophyll layer. Overexpression of AltMV TGB3 from either AltMV or PVX infectious clones resulted in veinal necrosis and vesiculation at the chloroplast membrane, a cytopathology not observed in wild-type infections. The distinctive mesophyll and chloroplast localization of AltMV TGB3 highlights the critical role played by mesophyll targeting in virus long-distance movement within plants.

We have developed plant virus-based vectors for virus-induced gene silencing (VIGS) and protein expression, based on Alternanthera mosaic virus (AltMV), for infection of a wide range of host plants including Nicotiana benthamiana and Arabidopsis thaliana by either mechanical inoculation of in vitro transcripts or via agroinfiltration. In vivo transcripts produced by co-agroinfiltration of bacteriophage T7 RNA polymerase resulted in T7-driven AltMV infection from a binary vector in the absence of the Cauliflower mosaic virus 35S promoter. An artificial bipartite viral vector delivery system was created by separating the AltMV RNA-dependent RNA polymerase and Triple Gene Block (TGB)123-Coat protein (CP) coding regions into two constructs each bearing the AltMV 5' and 3' non-coding regions, which recombined in planta to generate a full-length AltMV genome. Substitution of TGB1 L(88)P, and equivalent changes in other potexvirus TGB1 proteins, affected RNA silencing suppression efficacy and suitability of the vectors from protein expression to VIGS., (Published by Elsevier Inc.)

Four biologically active cDNA clones were derived from the Alternanthera mosaic virus (AltMV; genus Potexvirus) isolate, AltMV-SP, which differ in symptoms in infected Nicotiana benthamiana plants. Two clones induced necrosis and plant death; a mixture of all four clones induced milder symptoms than AltMV-SP. Replication of all clones was enhanced by a minimum of fourfold at 15 degrees C. A mixture of clones 4-7 (severe) and 3-1 (mild) was indistinguishable from AltMV-SP, but the ratio of 4-7 to 3-1 differed at 25 and 15 degrees C. RNA copy numbers of mixed infections were always below those of 4-7 alone. Determinants of symptom severity were identified in both Pol and TGB1; the mildest (4-1) and most severe (3-7) clones differed at three residues in the 'core' Pol domain [R(1110)P, K(1121)R, R(1255)K] and one [S(1535)P] in the C-terminal Pol domain of RNA-dependent RNA polymerase, and one in TGB1 [P(88)L]. Pol [P(1110),R(1121),K(1255)]+TGB1(L(88))] always induced systemic necrosis at 15 degrees C. Gene exchanges of Pol and TGB1 each affected replication and symptom expression, with TGB1(P(88)) significantly reducing silencing suppression. The difference in silencing suppression between TGB1(P(88)) and TGB1(L(88)) was confirmed by an agroinfiltration assay. Further, co-expression of TGB1(P(88)) and TGB1(L(88)) resulted in interference in the suppression of silencing by TGB1(L(88)). Yeast two-hybrid analysis confirmed that TGB1(P(88)) and TGB1(L(88)) interact. These results identify a TGB1 residue that significantly affects replication and silencing suppression, but maintains full movement functions.

Barley stripe mosaic virus (BSMV) spreads from cell to cell through the coordinated actions of three triple gene block (TGB) proteins (TGB1, TGB2, and TGB3) arranged in overlapping open reading frames (ORFs). Our previous studies (D. M. Lawrence and A. O. Jackson, J. Virol. 75:8712-8723, 2001; D. M. Lawrence and A. O. Jackson, Mol. Plant Pathol. 2:65-75, 2001) have shown that each of these proteins is required for cell-to-cell movement in monocot and dicot hosts. We recently found (H.-S. Lim, J. N. Bragg, U. Ganesan, D. M. Lawrence, J. Yu, M. Isogai, J. Hammond, and A. O. Jackson, J. Virol. 82:4991-5006, 2008) that TGB1 engages in homologous interactions leading to the formation of a ribonucleoprotein complex containing viral genomic and messenger RNAs, and we have also demonstrated that TGB3 functions in heterologous interactions with TGB1 and TGB2. We have now used Agrobacterium tumefaciens-mediated protein expression in Nicotiana benthamiana leaf cells and site-specific mutagenesis to determine how TGB protein interactions influence their subcellular localization and virus spread. Confocal microscopy revealed that the TGB3 protein localizes at the cell wall (CW) in close association with plasmodesmata and that the deletion or mutagenesis of a single amino acid at the immediate C terminus can affect CW targeting. TGB3 also directed the localization of TGB2 from the endoplasmic reticulum to the CW, and this targeting was shown to be dependent on interactions between the TGB2 and TGB3 proteins. The optimal localization of the TGB1 protein at the CW also required TGB2 and TGB3 interactions, but in this context, site-specific TGB1 helicase motif mutants varied in their localization patterns. The results suggest that the ability of TGB1 to engage in homologous binding interactions is not essential for targeting to the CW. However, the relative expression levels of TGB2 and TGB3 influenced the cytosolic and CW distributions of TGB1 and TGB2. Moreover, in both cases, localization at the CW was optimal at the 10:1 TGB2-to-TGB3 ratios occurring in virus infections, and mutations reducing CW localization had corresponding effects on BSMV movement phenotypes. These data support a model whereby TGB protein interactions function in the subcellular targeting of movement protein complexes and the ability of BSMV to move from cell to cell.

In the spring of 2008, freesia, cvs. Honeymoon and Santana, with striking virus-like symptoms similar to freesia leaf necrosis disease were received by the Virginia Tech Plant Disease Clinic from a cut-flower nursery in Gloucester, VA and forwarded for analysis to the USDA-ARS Floral and Nursery Plants Research Unit in Beltsville, MD. Approximately 25% of the plants had coalescing, interveinal, chlorotic, whitish, necrotic or dark brown-to-purple necrotic spots on leaves. Symptomatic plants were scattered within the planting. Fifteen symptomatic plants were collected between March and May of 2008, and nucleic acid extracts were analyzed for ophiovirus infection by reverse transcription (RT)-PCR with ophiovirus-specific degenerate primers (2). The diagnostic 136-bp ophiovirus product from the RdRp gene was amplified from 14 of 15 freesia plants tested. A partially purified virus preparation was analyzed by transmission electron microscopy and potyvirus- and ophiovirus-like particles were detected. The potyviruses, Freesia mosaic virus (FreMV) and Bean yellow mosaic virus (BYMV), each cause mosaic symptoms (3), although BYMV may induce necrosis late in the season. RT-PCR performed on the same nucleic acid samples using potyvirus coat protein (CP)-specific degenerate primers D335 and U335 (1) amplified the diagnostic 335-bp fragment from 2 of 15 plants. Cloned sequence from these plants was identified as FreMV. The ophiovirus CP gene was amplified by RT-PCR and cloned from two symptomatic freesia plants using primers FreSVf-CP-XhoI 5'-GACTCGAGAAATGTCTGGAAAATACTCTGTTC-3' and FreSVf-CP-BamHI 5'-CCAGGATCCTTAGATAGTGAATCCATAAGCTG-3', based on the sequence of Freesia sneak virus (FreSV) isolates from freesia (GenBank No. DQ885455) and lachenalia (4). The approximate 1.3-kb amplicon was cloned and sequences of two cDNA clones were identical (GenBank No. FJ807730). The deduced amino acid sequence showed 99% identity with the Italian FreSV CP sequence (GenBank No. DQ885455), confirming FreSV in the symptomatic freesia plants. To our knowledge, this is the first report of FreSV in Virginia and the United States. Soilborne freesia leaf necrosis disease has been reported in Europe since the 1970s (3); several viral causal agents have been hypothesized but recent findings correlate best with the ophiovirus. In Virginia, the presence of FreSV, but not FreMV, was strongly correlated with the leaf necrosis syndrome. FreSV, likely soilborne through Olpidium brassicae, may pose a new soilborne threat for bulbous ornamentals, since it has been recently detected also in Lachenalia spp. (Hyacinthaceae) from South Africa (4). Although specific testing of O. brassicae was not performed, the disease may potentially persist in the soil for years in O. brassicae resting spores and development of symptoms may be affected by environmental conditions (3). References: (1) S. A. Langeveld et al. J. Gen. Virol. 72:1531, 1991. (2) A. M. Vaira et al. Arch.Virol. 148:1037, 2003. (3) A. M. Vaira et al. Acta Hortic. 722:191, 2006. (4) A. M. Vaira et al. Plant Dis. 91:770, 2007.

Lolium latent virus (LoLV) was recently detected in the USA for the first time in ryegrass hybrids (Lolium perenne x Lolium multiflorum). The genome of one USA isolate, LoLV-US1, has now been fully sequenced. The positive strand genomic RNA is 7674 nucleotides (nt) long and is organized in five open reading frames (ORFs) encoding the replication-associated protein, the movement-associated triple gene block proteins and the coat protein (CP). The genome organization is similar to that of viruses in the genera Potexvirus and Foveavirus; however, analysis of the complete LoLV genomic sequence, phylogenetic analyses of the deduced amino acid (aa) sequences of the polymerase and the CP, presence of a putative ORF 6, and the in vivo detection of two CPs in equimolar amounts, highlight features peculiar to LoLV. These characteristics indicate that LoLV forms a monotypic group separate from existing genera and unassigned species within the family Flexiviridae, for which we propose the genus name Lolavirus. One-step RT-PCR was developed for quick and reliable LoLV detection.

Lachenalia (Lachenalia species, family Hyacinthaceae) is a bulbous ornamental plant endemic to southern Africa. In 1998, several lachenalia lines from ARC-Roodeplaat showing virus-like symptoms, and presumed to be infected with Ornithogalum mosaic virus (OrMV), were sent from South Africa under an APHIS permit for examination in Beltsville, MD. In addition to potyvirus-like particles, fine filamentous particles consistent with those of ophioviruses were observed with electron microscopy in some of the plant samples. Ophiovirus virions are filamentous nucleocapsids approximately 3 nm in diameter forming circularized structures of different lengths and are not easily detectable with electron microscopy. A reverse transcription (RT)-PCR assay using genus-specific degenerate primers that yield a 136-bp fragment from the RdRp gene is currently the best tool for detecting ophioviruses (3). Complementary DNA was produced from lachenalia total RNA extracts using either random hexamers or ophiovirus-specific primer OP1 (3). The ophiovirus diagnostic 136-bp fragment was amplified by PCR from plants of five lines (B12, L. unicolor × L. namaquensis, released in South Africa as cv. Rodelein; B24, L. aloides × L. rubida, cv. Robekkie; B48, a complex hybrid of L. aloides, L. rubida, L. orchioides, and L. bulbifera, cv. Leipoldt; B51, a complex hybrid of L. aloides, L. bulbifera, and L. orchioides, cv. Winsome; and B52, an intraspecies cross of L. aloides, cv. Fransie) of the six lines examined. Electron microscopy revealed ophiovirus particles in three of these five lines. The PCR products from three lachenalia lines were sequenced and found to be identical; the deduced 45 amino acid sequence showed 100% identity with the corresponding sequence obtained from Freesia sneak virus (FreSV), a tentative ophiovirus species referred to in the 8th ICTV report as Freesia ophiovirus (4) (for which the name Freesia sneak virus is now proposed). Currently, available sequence information shows only approximately 50 to 70% similarity between ophiovirus species and almost 100% identity between isolates, suggesting that the lachenalia ophiovirus is an isolate of FreSV. Symptoms associated with ophiovirus-infected lachenalias include fine chlorotic streaking and occasional gray flecking; more prominent chlorotic streaking, necrosis, and/or leaf deformation were observed in plants also infected with OrMV, similar potyviruses, and possibly other viruses. No ophiovirus was detected in five lines of Lachenalia hybrids obtained from U.S. commercial sources showing potyvirus-associated foliar chlorotic streaking, including cv. Fransie. Potyviruses were detected by RT-PCR (1) or ELISA with potyvirus-specific monoclonal antibodies (2) in plants from the United States and South Africa. It is of interest that the known hosts of FreSV, freesia and lachenalia, are both ornamental monocot genera of South African origin. References: (1) J. Chen et al. Arch. Virol. 146:757, 2001. (2) R. L. Jordan and J. Hammond. J. Gen. Virol. 72:25, 1991. (3) A. M. Vaira et al. Arch. Virol. 148:1037, 2003. (4) A. M. Vaira et al. Pages 673-679 in: Virus Taxonomy: 8th Report of the ICTV, 2005.

ABSTRACT Tomato hybrids obtained from homozygous progeny of line 30-4, engineered for Tomato spotted wilt virus (TSWV) resistance, were tested under field conditions in two locations with their corresponding nontransgenic hybrids. No transgenic hybrid became infected, but 33 to 50% of plants of each nontransgenic hybrid became infected with a severe reduction of marketable fruit production. The transgenic hybrids conformed to the standard agronomic characteristics of the corresponding nontransgenic ones. Fruit were collected from the nontransgenic plots included in the experimental field and from border rows, and seed were used to estimate the flow of the transgene via pollen. No transgene flow was detected in the protected crops; however, in the open field experiment, 0.32% of tomato seedlings were found to contain the genetic modification. Immunity to TSWV infection in 30-4 hybrids was confirmed in laboratory conditions using mechanical inoculation and grafting. Thrips inoculation in leaf discs of line 30-4 demonstrated that TSWV replication was inhibited at the primary infection site but not in leaf discs of a commercial hybrid containing the naturally occurring resistance gene Sw-5. Due to the high economic value of tomato crops worldwide and the importance of TSWV, the engineered resistance described here is of practical value for breeding into cultivars of commercial interest, because it could be combined with naturally occurring resistance, thus greatly reducing the ability of the virus to develop resistance-breaking strains.

At present, the so-called "substantial equivalence" is the only widely accepted criterion for deciding whether or not a transgenic food is, from an alimentary point of view, to be considered totally correspondent to the "traditional" one from which it derives. Although never exactly defined, it deals with a comparison between the chemical composition of the two foods. A more in-depth analysis can be performed by one of the most suitable methods that allows for the simultaneous screening of many components without prior identification, the analysis of the proteome. As a model for testing this kind of approach, we compared protein expression of two types of tomato plants, having the same genetic background, except for a virus resistance trait introduced by genetic engineering. When proteins extracted from seedlings of the two types were analyzed by two-dimensional electrophoresis, no significant differences, either qualitative or quantitative, were detected, indicating that in this case the expression of major proteins was unmodified by the genetic manipulation. Fifteen proteins were identified by peptide mass fingerprinting.

A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

Background: When generating transformed plants, a first step in their characterization is to obtain, for each new line, an estimate of how many copies of the transgene have been integrated in the plant genome because this can deeply influence the level of transgene expression and the ease of stabilizing expression in following generations. This task is normally achieved by Southern analysis, a procedure that requires relatively large amounts of plant material and is both costly and labour-intensive. Moreover, in the presence of rearranged copies the estimates are not correct. New approaches to the problem could be of great help for plant biotechnologists., Results: By using a quantitative real-time PCR method that requires limited preliminary optimisation steps, we achieved statistically significant estimates of 1, 2 and 3 copies of a transgene in the primary transformants. Furthermore, by estimating the copy number of both the gene of interest and the selectable marker gene, we show that rearrangements of the T-DNA are not the exception, and probably happen more often than usually recognised., Conclusions: We have developed a rapid and reliable method to estimate the number of integrated copies following genetic transformation. Unlike other similar procedures, this method is not dependent on identical amplification efficiency between the PCR systems used and does not need preliminary information on a calibrator. Its flexibility makes it appropriate in those situations where an accurate optimisation of all reaction components is impossible or impractical. Finally, the quality of the information produced is higher than what can be obtained by Southern blot analysis.

During the summer and autumn of 2001, symptoms of interveinal yellowing, bronzing, brittleness, and rolling of lower leaves were observed in greenhouse- and field-grown tomato (Lycopersicon esculentum) plants in Castellon Province in eastern Spain. Symptoms resembled those caused by the whitefly-transmitted criniviruses (1,2). Total RNA was extracted from 28 samples of symptomatic leaves collected in three greenhouses and one field and analyzed by reverse transcription-polymerase chain reaction using primers specific for Tomato chlorosis virus (ToCV) (1) and Tomato infectious chlorosis virus (TICV) (2). The 501-bp TICV-specific DNA fragment was amplified in four samples collected during the summer in three greenhouses and one field, and the 439-bp ToCV-specific DNA fragment was amplified in 15 samples collected during the autumn in the same three greenhouses; no mixed infections were found. The DNA fragments amplified from TICV were sequenced and showed 99 to 100% identity with the TICV isolates (GenBank Accession Nos. U67449 and AY048855) from the United States and Italy, respectively, confirming the diagnosis. One sequence was deposited as GenBank Accession No. AF479662. To our knowledge, this is the first report of TICV in Spain and the second in Europe. References: (1) D. Louro et al. Eur. J. Plant Pathol. 106:539, 2000. (2) A. M. Vaira et al. Phytoparasitica. In Press.

During winter 2000-2001, an unusual disease of tomato was observed in some greenhouses in Sardinia, Sicily, and Apulia, in southern Italy. Plants were chlorotic and reduced in size, expanded leaves showed interveinal yellowing, and older leaves developed interveinal reddish-bronze necrosis and downward rolling. The symptoms resembled those recently reported from Portugal (1) as induced by Tomato chlorosis virus (ToCV) (family Closteroviridae, genus Crinivirus), a whitefly-transmitted virus new to Europe. Symptomatic leaf tissues were extracted and analyzed by reverse transcription-polymerase chain reaction as described by Louro et al.(1). The 439-bp ToCV-specific DNA fragment was amplified in samples collected from 6 of 14 greenhouses in Sardinia, 2 of 5 greenhouses in Sicily, and 1 of 1 greenhouse in Apulia. The sequence of the fragment obtained from a Sicilian isolate (GenBank Accession No. AY048854) showed more than 99% identity to ToCV isolates (Accession Nos. AF024630 and AF234029) from the United States and Portugal, respectively. Infestations of Trialeurodes vaporariorum and Bemisia tabaci have been reported in autumn. To our knowledge, this is the first report of ToCV in Italy. Although we found the virus in three regions of the country, its distribution is likely to be wider, since the symptoms can be mistaken for those of a physiological disorder or of Tomato infectious chlorosis virus, another crinivirus infecting tomato. Reference: (1) Louro et al. Eur. J. Plant Pathol. 106:589, 2000.

During autumn 1998, chlorotic mottling, yellowing, and stunting symptoms were observed on cucumber (Cucumis sativus L.) plants in an experimental plot, in Algarve, southern Portugal. The first symptoms appeared 3 weeks after planting, associated with a heavy infestation of Bemisia tabaci (Gennadius). Plants affected early produced few and small fruits. Analysis of double-stranded RNA (dsRNA) extracted from symptomatic cucumber leaves revealed the presence of two dsRNAs of about 8 and 9 kbp, not present in healthy cucumber plants. Reverse-transcription polymerase chain reaction (RT-PCR) using dsRNA or total RNA extracts as template and the oligonucleotide primers 410L and 410U (1), specifically amplified a fragment of expected size of the HSP70-homolog gene of Cucurbit yellow stunting disorder virus (CYSDV). The RT-PCR-amplified fragment was sequenced (Acc. No. AF287474) and showed 99% sequence identities with the corresponding sequences (GenBank accessions AJ223619 and U67170) from two CYSDV isolates belonging to group I (2), confirming CYSDV detection. CYSDV was also detected in samples of cucumber, melon (Cucumis melo L.) and watermelon (Citrullus lanatus [Thunb.] Matsun.) collected during the summer of 1999 in commercial greenhouses. CYSDV is an emerging and important virus of cucurbits in the Middle East and Mediterranean Europe (2). This is the first report of CYSDV infecting cucurbit crops in Portugal. References: (1) A. Célix et al. Phytopathology 86:1370, 1996. (2) L. Rubio et al. Phytopathology 89:707, 1999.

The nucleocapsid protein (N) gene of tomato spotted wilt virus (TSWV) was inserted into Osteospermum ecklonis via Agrobacterium tumefaciens leaf strips co-cultivation. Sixteen primary transformant clones of two O. ecklonis genotypes were analysed. Southern blots of restricted genomic DNA demonstrated integration of the transgene and indicated the number of integrated copies. Expression of the transgene was estimated by DAS-ELISA and Western and Northern blotting. Plants were challenged with TSWV inoculation, either mechanically or by the thrips Frankliniella occidentalis; they were then monitored for symptom appearance and tested by TAS-ELISA for infection. Inoculation of the transgenic clones via the natural TSWV vector was more efficient and led to the identification of 1 clone, characterised by multiple transgene integration and no transgene expression, with improved resistance to TSWV.

Sequence alignments of tospovirus species of serogroup I to IV revealed a stretch of 24 amino acids at the C terminus of the non-structural protein NSs with a highly conserved sequence. Based on this sequence the 24 amino acids peptide YFLSKTLEVLPKNLQTMSYLDSIQC was synthesized and used to raise antisera in two rabbits. The specificity of the antisera against NSs from infected plants was confirmed with Western blots and by immunogold labelling and electron microscopy. These antisera detected tospovirus isolates of serogroup I to III in antigen-coated plate ELISA and Western blots but failed to detect isolates of serogroup IV. Epitope scanning using overlapping octopeptides composing the peptide suggested that the antisera contained antibodies against two different epitopes. Strongly reacting peptides were found at the C-terminus of the original peptide sequence when probing with one of the antisera. In this part the sequence was homologous to serogroup I, II and III, with all deviations from serogroup IV located here. Additional octopeptides, based on this region, synthesized with sequence modifications back to the serogroup IV sequence in all possible combinations, had low reactivity. However two of the modified peptides with partly restored serogroup IV sequences revealed promising reactivity and could be suitable to raise an antiserum with broader reactivity, including serogroup IV.

Ranunculus white mottle virus (RWMV) (1), genus Ophiovirus, has been reported in crops of several cultivars of commercial ranunculus (Ranunculus asiaticus hybrids) during the 1990s in Liguria in Northwest Italy. Symptoms associated with RWMV in ranunculus are not clear-cut owing to the presence of mixed viral infections. During autumn 1999, a severe disease in commercial crops of anemone (Anemone coronaria) was noted in the same area. Plants appeared stunted with young leaves showing curling, deformation, and necrotic spotting. Disease incidence in some fields reached 40 to 50%. DAS- and TAS-enzyme-linked immunosorbent assays (ELISAs) for presence of RWMV and for the viruses most frequently infecting anemone in Italy were run on 24 field samples. Seven proved to be infected by RWMV in mixed infection with Cucumber mosaic virus subgroup II or with Tobacco necrosis virus. Ophiovirus-like particles were detected by negative staining and electron microscopy from sap extracts of field plants that were RWMV-positive by ELISA. Sap from these plants was also mechanically inoculated to indicator plants. Total RNAs were extracted from RWMV-infected field samples and from inoculated Nicotiana benthamiana and N. clevelandii and used in molecular tests. A DIG-DNA probe targeting the 1.8-kb RNA2 of RWMV was used in Northern blots and dot blots of total RNAs, confirming the infection in field samples and multiplication of the virus in test plants, unfortunately still in mixed infection. At present, it is difficult to evaluate RWMV symptomatology in anemone, but the presence of this virus in mixed infection seems to produce serious effects. This is the first report of RWMV in anemone. Reference: (1) A. M. Vaira et al. Arch. Virol. 142:2131, 1997.

Big-vein is a widespread and damaging disease of lettuce, transmitted through soil by the chytrid fungus Olpidium brassicae, and generally supposed to be caused by Lettuce big-vein virus (LBVV; genus Varicosavirus). This virus is reported to have rigid rod-shaped particles, a divided double-stranded RNA genome, and one capsid protein of 48 kD, but has not been isolated or rigorously shown to cause the disease. We provide evidence that a totally different virus, here named Mirafiori lettuce virus (MiLV), is also very frequently associated with lettuce showing big-vein symptoms. MiLV was mechanically transmissible from lettuce to Chenopodium quinoa and to several other herbaceous test plants. The virus was partially purified, and an antiserum prepared, which did not react with LBVV particles in decoration tests. As reported for LBVV, MiLV was labile, soil-transmitted and had a single capsid protein of 48 kD, but the particles morphologically resembled those of ophioviruses, and like these, MiLV had a genome of three RNA segments approximately 8.5, 1.9 and 1.7 kb in size. MiLV preparations reacted strongly in Western blots and in ISEM with antiserum to Tulip mild mottle mosaic virus, an ophiovirus from Japan also apparently Olpidium-transmitted. They reacted weakly but clearly in Western blots with antiserum to Ranunculus white mottle virus, another ophiovirus. When lettuce seedlings were mechanically inoculated with crude or partially purified extracts from MiLV-infected test plants, many became systemically infected with MiLV and some developed big-vein symptoms. Such plants did not react in ELISA using an LBVV antiserum or an antiserum to tobacco stunt virus, and varicosavirus-like particles were never seen in them in the EM after negative staining. We conclude that MiLV is a hitherto undescribed virus assignable to the genus Ophiovirus. The cause or causes of lettuce big-vein disease and the properties of LBVV may need to be re-evaluated in light of our results.

A functional capsid protein (CP) is essential for host plant infection and insect transmission in monopartite geminiviruses. We studied two defective genomic DNAs of tomato yellow leaf curl virus (TYLCV), Sic and SicRcv. Sic, cloned from a field-infected tomato, was not infectious, whereas SicRcv, which spontaneously originated from Sic, was infectious but not whitefly transmissible. A single amino acid change in the CP was found to be responsible for restoring infectivity. When the amino acid sequences of the CPs of Sic and SicRcv were compared with that of a closely related wild-type virus (TYLCV-Sar), differences were found in the following positions: 129 (P in Sic and SicRcv, Q in Sar), 134 (Q in Sic and Sar, H in SicRcv) and 152 (E in Sic and SicRcv, D in Sar). We constructed TYLCV-Sar variants containing the eight possible amino acid combinations in those three positions and tested them for infectivity and transmissibility. QQD, QQE, QHD, and QHE had a wild-type phenotype, whereas PHD and PHE were infectious but nontransmissible. PQD and PQE mutants were not infectious; however, they replicated and accumulated CP, but not virions, in Nicotiana benthamiana leaf discs. The Q129P replacement is a nonconservative change, which may drastically alter the secondary structure of the CP and affect its ability to form the capsid. The additional Q134H change, however, appeared to compensate for the structural modification. Sequence comparisons among whitefly-transmitted geminiviruses in terms of the CP region studied showed that combinations other than QQD are present in several cases, but never with a P129.

Due to costs in using and disposing of radiochemicals and to health considerations, we have been developing applications which include non-isotopic detection of DNA and proteins using chemiluminescence. Our major interests are in the detection of viral nucleic acids and in the analysis of transgenic plants. Generally, probes were labelled with digoxigenin, either by the random priming method or by PCR, and then detected with CSPD or CDP-Star. We routinely use a tissue blotting protocol for diagnosing TYLCV, a plant virus becoming a post in the Mediterranean region. Test results were comparable with those using the same radiolabelled probe. When total nucleic acids are extracted from the plant samples and used in dot-blot or Southern blot assays, viral DNAs are promptly detected by chemiluminescence. In transgenic plants, chemiluminescence was used to detect the transgene on genomic Southern blots, the transgenic mRNAs on Northern blots, and the transgenic protein on Western blots. In Southern and Northern blots, the quality of the results obtained was usually satisfactory, but not as good as with a radiolabelled probe, the main problem being the signal-to-background ratio. Our goal is now to improve the quality of results in demanding applications such as genomic Southern blots, by reducing the background on membranes.

An undescribed virus, here named ranunculus white mottle virus, was isolated in Italy from cultivated ranunculus showing mottle and distortion of leaves. The virus was mechanically transmissible to several herbaceous hosts. In negative stain, the particles appeared as circularised supercoiled threads 3 nm in diameter of different contour lengths; in some conditions the circles collapsed to form linear pseudobranched structures 9 nm in diameter. Immunolabeling of thin sections showed that viral antigen was widely distributed in the cytoplasm of parenchyma cells. The virus was not serologically related to the morphologically similar tenuiviruses, citrus psorosis-ringspot virus and tulip mild mottle mosaic virus. A major 43 kDa protein was present in purified preparations and in infected plant tissue, as also was a minor 28 kDa protein, serologically related to the major one. Nucleic acids extracted from purified particles consisted of at least three RNAs, of approximately 7.5, 1.8 and 1.5 kb, which appeared partly in single- and partly in double-stranded form. Purified preparations, but not viral RNAs, when mechanically inoculated, were infectious. Host range, tissue tropism, particle morphology and coat protein size place the virus closest to citrus psorosis-ringspot and tulip mild mottle mosaic viruses. These three viruses in turn show similarities with the Tenuiviruses and Bunyaviridae.

A polyclonal rabbit antiserum was obtained to the nucleoprotein of tomato spotted wilt tospovirus expressed as a recombinant fusion protein in E. coli. In indirect plate trapping ELISA, the antiserum gave similar titres against purified TSWV nucleocapsids in native form, the fusion protein and the carrier protein. The crude antiserum was also tested by Western blotting, indirect plate trapping ELISA and immunogold electron microscopy of thin sections: purified immunoglobulins were tested by DAS-ELISA. In all cases, with both glasshouse and field material, the antibodies had good detectability and specificity. By ELISA and Western blots against other tospoviruses, impatiens necrotic spot and groundnut bud necrosis viruses did not react but there was a reaction with groundnut ringspot virus, reflecting the nucleoprotein amino acid sequence similarity. These antibodies combine specificity to the target protein and versatility with regard to all the more important serological techniques. There were no undesired reactions resulting from immunization using a complex virus purified from infected host material.

Nicotiana benthamiana was transformed with the nucleoprotein (N) gene of an Italian isolate of tomato spotted wilt virus (TSWV). Forty-five T1 primary transformant lines were analyzed for the expression of N protein and for resistance to TSWV and three other tospoviruses: impatiens necrotic spot virus (INSV), groundnut bud necrosis virus (GBNV), and groundnut ringspot virus (GRSV). Thirteen of these lines were further characterized. Resistance to all TSWV isolates tested was found in two lines. The expression of the transgene (N mRNA) was lower in these resistant lines than in any of the susceptible lines, and the transgene N protein was either absent or present below detectable levels. These lines were susceptible to the other tospoviruses tested, but they developed symptoms milder than controls when inoculated with GRSV. Some of the lines producing high levels of N protein showed delays (of 2-3 weeks) in symptom expression with at least one of the TSWV isolates tested and symptom delay or attenuation with INSV or GRSV (or both). From our results it appears that high expression of TSWV N protein retards, in some cases, disease development by TSWV and INSV. In contrast, the lack of detectable expression of the transgenic N protein, accompanied by limited production of N transcripts, conferred TSWV-specific resistance.

The effect of recombinant human tumor necrosis factor alpha (TNF-alpha) on normal and chronic myeloid leukemia granulocyte-macrophage progenitors (CFU-GM) growing in semisolid agar cultures in the presence of recombinant granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor was studied. Granulocyte-macrophage colony-stimulating factor-dependent growth of normal and chronic myeloid leukemia bone marrow CFU-GM was greatly enhanced by TNF-alpha at doses of 0.1 to 100 units/ml. Growth enhancement included neutrophil, eosinophil, and monocyte-macrophage colonies and clusters at 7 and 14 days of culture. Since similar results were achieved with highly enriched progenitor cell populations, devoid of accessory cells, an indirect effect on CFU-GM growth through the release by accessory cells of other cytokines upon TNF-alpha stimulation was thus ruled out. By contrast, the same doses of TNF-alpha inhibited the growth of normal CFU-GM in granulocyte colony-stimulating factor-dependent cultures. Taken together, our findings indicate that the final effect of TNF-alpha on normal bone marrow granulocyte-macrophage progenitor growth is dependent on the specific growth factor interacting with it, and that both normal and chronic myeloid leukemia CFU-GM are equally responsive to the combined effects of TNF-alpha and a given colony-stimulating factor.