Search

Background: Previous studies in the pre-biological era showed an association of wrist inflammation in juvenile idiopathic arthritis (JIA) with progressive disease course, polyarticular involvement and failure of methotrexate treatment., Aim: To describe features of JIA, associated with wrist arthritis., Methods: Data from about 753 JIA patients were included in this retrospective cohort study. The clinical and laboratory features of patients with and without wrist involvement were analyzed., Results: Wrist involvement was found in oligoarthritis (5.8%), RF(-)/RF(+) polyarthritis (44.9%/15.0%), enthesitis-related arthritis (17.7%), and systemic (58.6%) JIA categories. Unilateral wrist involvement was typical for oligoarthritis patients, bilateral involvement was either equal to that of unilateral involvement or was more frequent in other categories. Wrist arthritis was found to be associated with female sex, a low incidence of uveitis, and more indications of systemic inflammation, including elevated levels of C-reactive protein, erythrocyte sedimentation rate, and platelets, as well as involvement of the cervical spine, temporomandibular, shoulder, elbow, metacarpophalangeal, proximal interphalangeal, distal interphalangeal, hip, ankle, and tarsus arthritis. The number of patients with hip osteoarthritis and hip replacement was also higher. Wrist arthritis was associated with a lower probability of achieving remission [hazard ratio (HR) = 1.3 (95%CI: 1.0-1.7), P = 0.055], and a higher probability of being treated with biologics [HR = 1.7 (95%CI: 1.3-2.10, P = 0.00009)]., Conclusion: Wrist arthritis in JIA patients is a marker of a severe disease course, characterized by more intensive inflammation, unfavorable outcomes, and. requiring more intensive treatment with early administration of biologics. Close monitoring of wrist inflammation with ultrasound and MR assessment with early biological treatment might improve the outcomes., Competing Interests: Conflict-of-interest statement: The authors declare no conflicts of interest., (©The Author(s) 2024. Published by Baishideng Publishing Group Inc. All rights reserved.)

Background: Systemic lupus erythematosus (SLE) is the most frequent and serious systemic connective tissue disease. Nowadays there is no clear guidance on its treatment in childhood. There are a lot of negative effects of standard-of-care treatment (SOCT), including steroid toxicity. Rituximab (RTX) is the biological B-lymphocyte-depleting agent suggested as a basic therapy in pediatric SLE., Aim: To compare the benefits of RTX above SOCT., Methods: The data from case histories of 79 children from the Saint-Petersburg State Pediatric Medical University from 2012 to 2022 years, were analyzed. The diagnosis of SLE was established with SLICC criteria. We compared the outcomes of treatment of SLE in children treated with and without RTX. Laboratory data, doses of glucocorticosteroids, disease activity measured with SELENA-SLEDAI, and organ damage were assessed at the time of initiation of therapy and one year later., Results: Patients, treated with RTX initially had a higher degree of disease activity with prevalence of central nervous system and kidney involvement, compared to patients with SOCT. One year later the disease characteristics became similar between groups with a more marked reduction of disease activity (SELENA-SLEDAI activity index) in the children who received RTX [-19 points (17; 23) since baseline] compared to children with SOCT [-10 (5; 15.5) points since baseline, P = 0.001], the number of patients with active lupus nephritis, and daily proteinuria. During RTX therapy, infectious diseases had three patients; one patient developed a bi-cytopenia., Conclusion: RTX can be considered as the option in the treatment of severe forms of SLE, due to its ability to arrest disease activity compared to SOCT., Competing Interests: Conflict-of-interest statement: All the authors declare that they have no conflict of interest., (©The Author(s) 2022. Published by Baishideng Publishing Group Inc. All rights reserved.)

Background: Interferon type I (IFN-I) signaling system hyperactivation plays an important role in the pathogenesis of juvenile dermatomyositis (JDM)., Aim of the Study: To analyze IFN-I score with disease activity in patients with JDM., Materials and Methods: Clinical manifestations laboratory data, and treatment options were analyzed in 15 children with JDM. Disease activity was assessed by CMAS (childhood myositis assessment tool) and CAT (cutaneous assessment tool) scores. IFN I-score was assessed by RT-PCR quantitation of 5 IFN I-regulated transcripts (IFI44L, IFI44, IFIT3, LY6E, MXA1)., Results: All patients had skin and muscle involvement, some had a fever ( n = 8), swallowing disorders ( n = 4), arthritis ( n = 5), calcinosis ( n = 3), lipodystrophy ( n = 2), and interstitial lung disease ( n = 5). Twelve patients had elevated IFN I-score and it was correlated with skin disease activity. Ten patients had clinically active disease and the level of IFN I-score and its components were higher than in patients with inactive disease (8.8 vs. 4.2, p = 0.011). IFN I-score was evaluated in nine patients during follow-up. The simultaneous reduction of IFN I-score and its components, CMAS and CAT scores was observed., Conclusion: Skin involvement in refractory JDM is a challenging problem requiring the use of additional medications. Serum IFN I-score might be suggested as the promising biomarker of skin disease activity in JDM patients. Further investigations on patients with JDM and recurrent disease activity are needed, especially concerning biomarkers that determine the response to JAK inhibitors and treatment options for patients who don't respond to them., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Raupov, Suspitsin, Preobrazhenskaya and Kostik.)

Introduction: The blockade of interleukine-1 (anakinra and canakinumab) is a well-known highly effective tool for monogenic autoinflammatory diseases (AIDs), such as familial Mediterranean fever, tumor necrosis factor receptor-associated periodic syndrome, hyperimmunoglobulinaemia D syndrome, and cryopyrin-associated periodic syndrome, but this treatment has not been assessed for patients with undifferentiated AIDs (uAIDs). Our study aimed to assess the safety and efficacy of canakinumab for patients with uAIDs., Methods: Information on 32 patients with uAIDs was retrospectively collected and analyzed. Next-generation sequencing and Federici criteria were used for the exclusion of the known monogenic AID., Results: The median age of the first episode was 2.5 years (IQR: 1.3; 5.5), that of the disease diagnosis was 5.7 years (IQR: 2.5;12.7), and that of diagnostic delay was 1.1 years (IQR: 0.4; 6.1). Patients had variations in the following genes: IL10, NLRP12, STAT2, C8B, LPIN2, NLRC4, PSMB8, PRF1, CARD14, IFIH1, LYST, NFAT5, PLCG2, COPA, IL23R, STXBP2, IL36RN, JAK1, DDX58, LACC1, LRBA, TNFRSF11A, PTHR1, STAT4, TNFRSF1B, TNFAIP3, TREX1 , and SLC7A7 . The main clinical features were fever (100%), rash (91%; maculopapular predominantly), joint involvement (72%), splenomegaly (66%), hepatomegaly (59%), lymphadenopathy (50%), myalgia (28%), heart involvement (31%), intestinal involvement (19%); eye involvement (9%), pleuritis (16%), ascites (6%), deafness, hydrocephalia (3%), and failure to thrive (25%). Initial treatment before canakinumab consisted of non-biologic therapies: non-steroidal anti-inflammatory drugs (NSAID) (91%), corticosteroids (88%), methotrexate (38%), intravenous immunoglobulin (IVIG) (34%), cyclosporine A (25%), colchicine (6%) cyclophosphamide (6%), sulfasalazine (3%), mycophenolate mofetil (3%), hydroxychloroquine (3%), and biologic drugs: tocilizumab (62%), sarilumab, etanercept, adalimumab, rituximab, and infliximab (all 3%). Canakinumab induced complete remission in 27 patients (84%) and partial remission in one patient (3%). Two patients (6%) were primary non-responders, and two patients (6%) further developed secondary inefficacy. All patients with partial efficacy or inefficacy were switched to tocilizumab ( n = 4) and sarilumab ( n = 1). The total duration of canakinumab treatment was 3.6 (0.1; 8.7) years. During the study, there were no reported Serious Adverse Events (SAEs). The patients experienced non-frequent mild respiratory infections at a rate that is similar as before canakinumab is administered. Additionally, one patient developed leucopenia, but it was not necessary to stop canakinumab for this patient., Conclusion: The treatment of patients with uAIDs using canakinumab was safe and effective. Further randomized clinical trials are required to confirm the efficacy and safety., Competing Interests: EA received research grants from Roche, Pfizer, Centocor, Eli Lilly, AbbVie, Bristol-Myers Squibb, MSD, Sanofi, Amgen, and Novartis, speaker at the Roche, AbbVie, Bristol-Myers, Squibb, MSD, Novartis, and Pfizer bureau. TD received research grants from Roche, Pfizer, Centocor, Eli Lilly, AbbVie, Bristol-Myers Squibb, MSD, Amgen, and Novartis, speaker at the Roche, AbbVie, Bristol-Myers, Squibb, MSD, Novartis, and Pfizer bureau. KI received research grants from Roche, Novartis, and Sanofi. OL received research grants from Pfizer and Eli Lilly. EK speaker at the Novartis bureau. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Alexeeva, Shingarova, Dvoryakovskaya, Lomakina, Fetisova, Isaeva, Chomakhidze, Chibisova, Krekhova, Kozodaeva, Savostyanov, Pushkov, Zhanin, Demyanov, Suspitsin, Belozerov and Kostik.)

Objectives: Juvenile systemic sclerosis is a rare childhood disease. Three disease activity indices have been published for adult patients with systemic sclerosis: the European Scleroderma Study Group Index, a modified version of the European Scleroderma Study Group Index and the revised European Scleroderma Trials and Research index. The objective of this study was to determine the feasibility and performance of the three disease activity indices in a prospectively followed cohort of patients with juvenile systemic sclerosis., Methods: The analysis cohort was selected from the prospective international inception cohort enrolling juvenile systemic sclerosis patients. The correlation of the disease activity indices with the physicians' and the patients' global assessment of disease activity was determined. The disease activity indices were compared between patients with active and inactive disease. Sensitivity to change between 6- and 12-month follow-up was investigated by mixed models., Results: Eighty percent of the 70 patients had a diffuse cutaneous subtype. The revised European Scleroderma Trials and Research index was highly correlated with the physician-reported global disease activity/parents-reported global disease activity (r = 0.74/0.64), followed by the European Scleroderma Study Group activity index (r = 0.61/0.55) and the modified version of the European Scleroderma Study Group activity index (r = 0.51/0.43). The disease activity indices significantly differed between active and inactive patients. The disease activity indices showed sensitivity to change between 6- and 12-month follow-up among patients who improved or worsened according to the physician-reported global disease activity and the parents-reported global disease activity., Conclusion: Overall, no disease activity score is superior to the other, and all three scores have limitations in the application in juvenile systemic sclerosis patients. Furthermore, research on the concept of disease activity and suitable scores to measure disease activity in patients with juvenile systemic sclerosis is necessary in future., Competing Interests: The author(s) declared the following potential conflicts of interest with respect to the research, authorship and/or publication of this article: the editor/editorial board member of Journal of Scleroderma and Related Disorders is an author of this paper; therefore, the peer-review process was managed by alternative members of the board, and the submitting editor/board member had no involvement in the decision-making process., (© The Author(s) 2023.)

Background: The IFIH1 gene codes the MDA5 protein and the DDX58 gene codes the RIG-I receptor. Both proteins are parts of the interferon (IFN) I signaling pathway and are responsible for antiviral defense and innate immune response. IFIH1 and DDX58 polymorphisms are associated with a spectrum of autoimmune diseases. Rare gain-of-function IFIH1 mutations have been found in Singleton-Merten and Aicardi-Goutières syndrome, while DDX58 mutation can cause atypical Singleton-Merten syndrome., Aim: To characterize children with pediatric rheumatic diseases (PRD) carrying DDX58 or IFIH1 variants., Methods: Clinical exome sequencing was performed on 92 children with different PRD. IFIH1 and DDX58 variants have been detected in 14 children. IFN-I score has been analyzed and the clinical characteristics of patients have been studied., Results: A total of seven patients with systemic lupus erythematosus (SLE) ( n = 2), myelodysplastic syndrome with SLE features at the onset of the disease ( n = 1), mixed connective tissue disease (MCTD) ( n = 1), undifferentiated systemic autoinflammatory disease (uSAID) ( n = 3) have 5 different variants of the DDX58 gene. A common non-pathogenic variant p.D580E has been found in five children. A rare variant of uncertain significance (VUS) p.N354S was found in one patient with uSAID, a rare likely non-pathogenic variant p.E37K in one patient with uSAID, and a rare likely pathogenic variant p.Cys864fs in a patient with SLE. Elevated IFN-I score was detected in 6 of 7 patients with DDX58 variants. Seven patients had six different IFIH1 variants. They were presented with uSAID ( n = 2), juvenile dermatomyositis (JDM) ( n = 1), SLE-like disease ( n = 1), Periodic fever with aphthous stomatitis, pharyngitis, and adenitis syndrome ( n = 1), and systemic onset juvenile idiopathic arthritis ( n = 1). Three patients have VUS p.E627X, one patient has benign variant p.I923V. Rare VUS p.R595H was detected in the JDM patient. Another rare VUS p.L679Ifs*2 and previously not reported variant p.V599Ffs*5 were detected in the patient with uSAID. One patient with uSAID has rare VUS p.T520A. All patients had elevated IFN-I scores., Conclusion: Rare compound-heterozygous IFIH1 variant (p.L679Ifs*2 and p.V599Ffs*5), heterozygous IFIH1 variant (p.T520A) and heterozygous DDX58 variant (p.Cys864fs) are probably disease causative for uSAID and SLE. The majority of patients with different DDX58 and IFI1 variants had hyperactivation of the IFN I signaling pathway., Competing Interests: Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article., (©The Author(s) 2023. Published by Baishideng Publishing Group Inc. All rights reserved.)

Objective: To compare organ involvement and disease severity between male and female patients with juvenile onset systemic sclerosis., Methods: Demographics, organ involvement, laboratory evaluation, patient-reported outcomes and physician assessment variables were compared between male and female juvenile onset systemic sclerosis patients enrolled in the prospective international juvenile systemic sclerosis cohort at their baseline visit and after 12 months., Results: One hundred and seventy-five juvenile onset systemic sclerosis patients were evaluated, 142 females and 33 males. Race, age of onset, disease duration, and disease subtypes (70% diffuse cutaneous) were similar between males and females. Active digital ulceration, very low body mass index, and tendon friction rubs were significantly more frequent in males. Physician global assessment of disease severity and digital ulcer activity was significantly higher in males. Composite pulmonary involvement was also more frequent in males, though not statistically significantly. After 12 months, they are the pattern of differences changed female patients had significantly more frequent pulmonary involvement., Conclusion: In this cohort, juvenile onset systemic sclerosis had a more severe course in males at baseline and but the pattern changed after 12 months. Some differences from adult findings persisted, there is no increased signal of pulmonary arterial hypertension or heart failure in male pediatric patients. While monitoring protocols of organ involvement in juvenile onset systemic sclerosis need to be identical for males and females., Competing Interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article., (© The Author(s) 2022.)

Background: Pediatric lupus nephritis (LN) is one of the most serious manifestations of systemic lupus erythematosus (SLE) in children, determining the outcomes of the disease. There are no standardized treatment protocols for pediatric LN, and the role of biologics has not yet been conclusively defined., Objectives: analyze the safety and efficacy of rituximab biosimilar BCD020 in pediatric patients with lupus nephritis., Methods: in a retrospective cohort study, the data from the case histories of 25 patients with LN (10 boys and 15 girls) with an onset age of 13 (9-16) years, who failed conventional non-biologic treatment or developed corticosteroid dependence/toxicity, were included. The diagnosis was made using Systemic Lupus International Collaborating Clinics (SLICC) classification criteria. Rituximab biosimilar BCD020 was prescribed in a dosage of 375 mg/m 2 every week (2-4 infusions) with repeated courses every 6-12 months (2-4 infusions) according to disease activity, B-cell depletion, and IgG levels. The dynamics of clinical and laboratory data, the activity of the disease by SLEDAI, and corticosteroid doses were assessed at the onset and during the rituximab trial., Results: The main patient's characteristics were: Pre-rituximab non-biologic conventional treatment included: cyclophosphamide 15 (60%), MMF 8 (32%), azathioprine 3 (12%), hydroxychloroquine 12 (48%), and pulse therapy of methylprednisolone followed by oral methylprednisolone 25 (100%). The time before rituximab was 7.0 (3.0-24.0) months, and the whole observation period was 7.0 (0; 24) months. The initial pre-rituximab treatment slightly reduced SLEDAI levels and the proportion of patients with LN. A significant reduction of SLEDAI, the anti-dsDNA level, proteinuria, hematuria, C4 complement, ESR, and the median corticosteroid dose by 80% from the initial value, as well as the proportion of patients without corticosteroids, was observed after rituximab administration. Two deaths were observed due to catastrophic SLE with macrophage activation syndrome, accompanied by a severe infection (invasive aspergillosis, n = 2). Three patients developed serious adverse events: pneumonia ( n = 2), transient agranulocytosis ( n = 1) after the third rituximab infusion, and meningitis, caused by Listeria monocytosis, after the first rituximab infusion. Eight patients received antibacterial treatment for different respiratory infections without hospital admissions., Conclusions: Rituximab biosimilar BCD020 showed effectiveness in LN, whereas previous non-biologic treatment was insufficiently effective. Randomized controlled trials are required to evaluate the efficacy and safety of rituximab and evaluate the benefits when compared with conventional SLE treatment.

Background: Patients with immune-mediated diseases, such as juvenile idiopathic arthritis (JIA) and inflammatory bowel disease (IBD) are at increased risk of developing infections, due to disease-related immune dysfunction and applying of immunosuppressive drugs., Aim: To evaluate vaccine coverage in patients with IBD and JIA, and compare it with healthy children., Methods: In the cross-sectional study we included the data from a questionnaire survey of 190 Legal representatives of children with JIA ( n = 81), IBD ( n = 51), and healthy children (HC, n = 58). An electronic online questionnaire was created for the survey., Results: There were female predominance in JIA patients and younger onset age. Parents of JIA had higher education levels. Employment level and family status were similar in the three studied groups. Patients with JIA and IBD had lower vaccine coverage, without parental rejection of vaccinations in IBD, compare to JIA and healthy controls. The main reason for incomplete vaccination was medical conditions in IBD and JIA. IBD patients had a lower rate of normal vaccine-associated reactions compared to JIA and HC. The encouraging role of physicians for vaccinations was the lowest in JIA patients. IBD patients had more possibilities to check antibodies before immune-suppressive therapy and had more supplementary vaccinations compared to JIA and HC., Conclusion: JIA and IBD patients had lower vaccine coverage compared to HC. Physicians' encouragement of vaccination and the impossibility of discus about future vaccinations and their outcomes seemed the main factors for patients with immune-mediated diseases, influencing vaccine coverage. Further investigations are required to understand the reasons for incomplete vaccinations and improve vaccine coverage in both groups, especially in rheumatic disease patients. The approaches that stimulate vaccination in healthy children are not always optimal in children with immune-mediated diseases. It is necessary to provide personalized vaccine-encouraging strategies for parents of chronically ill children with the following validation of these technics., Competing Interests: Conflict-of-interest statement: All authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (©The Author(s) 2023. Published by Baishideng Publishing Group Inc. All rights reserved.)

Objective: To evaluate the baseline clinical characteristics of juvenile systemic sclerosis (SSc) patients in the international juvenile SSc inception cohort, and to compare these characteristics between the classically defined juvenile diffuse cutaneous SSc (dcSSc) and limited cutaneous SSc (lcSSc) subtypes and among those with overlap features., Methods: A cross-sectional study was performed using baseline visit data. Information on demographic characteristics, organ system evaluation, treatment, and patient- and physician-reported outcomes was extracted and summary statistics applied. Comparisons between juvenile dcSSc and lcSSc subtypes and patients with and without overlap features were performed using chi-square and Mann-Whitney U tests., Results: At data extraction, 150 juvenile SSc patients were enrolled across 42 centers; 83% were White, 80% were female, juvenile dcSSc predominated (72%), and 17% of the cohort had overlap features. Significant differences were found between juvenile dcSSc and juvenile lcSSc regarding modified Rodnan skin thickness score, the presence of Gottron's papules, digital tip ulceration, results of the 6-minute walk test, and composite pulmonary and cardiac involvement. All of these were more frequent in dcSSc except for cardiac involvement. Juvenile dcSSc patients had significantly worse scores for physician-rated disease activity and damage. A significantly higher occurrence of Gottron's papules and musculoskeletal and composite pulmonary involvement, and a significantly lower frequency of Raynaud's phenomenon, were seen in those with overlap features., Conclusion: Results from a large international juvenile SSc cohort demonstrate significant differences between juvenile dcSSc and juvenile lcSSc patients, including more globally severe disease and increased frequency of interstitial lung disease in juvenile dcSSc patients, while those with lcSSc have more frequent cardiac involvement. Those with overlap features had an unexpected higher frequency of interstitial lung disease., (© 2021 American College of Rheumatology.)

Objective: We aimed to evaluate the clinical and laboratory features and MEFV allele distribution in Crimean Tatar familial Mediterranean fever patients and to compare them with Turkish familial Mediterranean fever patients and healthy controls., Materials and Methods: All newly diagnosed familial Mediterranean fever patients with Crimean Tatar nationality (n = 18) in Children's Regional Hospital in Simferopol were enrolled in the study and were compared to 40 familial Mediterranean fever cases followed up at Hacettepe University, Ankara, Turkey. The distribution of MEFV alleles was assessed in the 127 unrelated healthy Crimean Tatar adults aged 20 years or more from different parts of the Crimea peninsula., Results: Age and gender distribution, the frequency of colchicine resistance, and colchicine intolerance were similar between Turkish and Crimean Tatar children with familial Mediterranean fever. The duration of familial Mediterranean fever attack was shorter in Turkish patients than in Crimean Tatar (2.0 vs. 3.0 days, P < .001). Chest pain was more frequent in Turkish familial Mediterranean fever patients, whereas arthralgia, arthritis, and erysipeloid rash were more common in Crimean TatarT. MEFV allele distribution in Crimean Tatar was M694V-81%, M680I and V726A 9.5% both, and 68.6%, 14.3%, and 12.9% in Turkish, consequently. Homozygous carriers were 11%, compound-heterozygous was 6%, and heterozygous was 83%, compared to Turkish being 45%, 30%, and 25%, respectively. The allele distribution in healthy Crimean Tatar and Turkish was 10.2% and M694V was 7.1%, M680I was 1.6%, and V726A was 1.6%., Conclusion: The similar MEFV allele prevalence in both populations suggests the high prevalence of familial Mediterranean fever and the high number of undiagnosed patients in the Crimea peninsula. Younger age at onset, shorter duration of attacks, the prevalence of articular involvement, and erysipeloid rash were distinctive features of familial Mediterranean fever in Crimean Tatar.

Objective: Utilizing data obtained from a prospective, international, juvenile systemic sclerosis (SSc) cohort, the present study was undertaken to determine if pulmonary screening with forced vital capacity (FVC) and diffusing capacity for carbon monoxide (DLco) is sufficient to assess the presence of interstitial lung disease (ILD) in comparison to high-resolution computed tomography (HRCT) in juvenile SSc., Methods: The juvenile SSc cohort database was queried for patients enrolled from January 2008 to January 2020 with recorded pulmonary function tests (PFTs) parameters and HRCT to determine the discriminatory properties of PFT parameters, FVC, and DLco in detecting ILD., Results: Eighty-six juvenile SSc patients had both computed tomography imaging and FVC values for direct comparison. Using findings on HRCT as the standard measure of ILD presence, the sensitivity of FVC in detecting ILD in juvenile SSc was only 40%, the specificity was 77%, and area under the curve (AUC) was 0.58. Fifty-eight juvenile SSc patients had both CT imaging and DLco values for comparison. The sensitivity of DLco in detecting ILD was 76%, the specificity was 70%, and AUC was 0.73., Conclusion: The performance of PFTs in juvenile SSc to detect underlying ILD was quite limited. Specifically, the FVC, which is one of the main clinical parameters in adult SSc to detect and monitor ILD, would miss ~60% of children who had ILD changes on their accompanying HRCT. The DLco was more sensitive in detecting potential abnormalities on HRCT, but with less specificity than the FVC. These results support the use of HRCT in tandem with PFTs for the screening of ILD in juvenile SSc., (© 2020 American College of Rheumatology.)

Context: Glucocorticoids (GCs) prescribed for chronic pediatric illnesses are associated with osteoporotic fractures., Objective: This study aims to determine the efficacy and safety of intravenous (IV) zoledronic acid (ZA) compared with placebo to treat pediatric GC-induced osteoporosis (GIO)., Methods: Children aged 5 to 17 years with GIO were enrolled in this multinational, randomized, double-blind, placebo-controlled phase 3 trial (ClinicalTrials.gov NCT00799266). Eligible children were randomly assigned 1:1 to 6 monthly IV ZA 0.05 mg/kg or IV placebo. The primary end point was the change in lumbar spine bone mineral density z score (LSBMDZ) from baseline to month 12. Incident fractures and safety were assessed., Results: Thirty-four children were enrolled (mean age 12.6 ± 3.4 years [18 on ZA, 16 on placebo]), all with low-trauma vertebral fractures (VFs). LSBMDZ increased from -2.13 ± 0.79 to -1.49 ± 1.05 on ZA, compared with -2.38 ± 0.90 to -2.27 ± 1.03 on placebo (least squares means difference 0.41 [95% CI, 0.02-0.81; P = .04]); when corrected for height z score, the least squares means difference in LBMDZ was 0.75 [95% CI, 0.27-1.22; P = .004]. Two children on placebo had new low-trauma VF vs none on ZA. Adverse events (AEs) were reported in 15 of 18 children (83%) on ZA, and in 12 of 16 (75%) on placebo, most frequently within 10 days after the first infusion. There were no deaths or treatment discontinuations due to treatment-emergent AEs., Conclusion: LSBMDZ increased significantly on ZA compared with placebo over 1 year in children with GIO. Most AEs occurred after the first infusion., (© The Author(s) 2021. Published by Oxford University Press on behalf of the Endocrine Society.)

Objective: To describe the clinical characteristics, treatment, and outcomes of a multinational cohort of patients with macrophage activation syndrome (MAS) and thrombotic microangiopathy (TMA)., Study Design: International pediatric rheumatologists were asked to collect retrospectively the data of patients with the co-occurrence of MAS and TMA. Clinical and laboratory features of patients with systemic juvenile idiopathic arthritis (sJIA)-associated MAS and TMA were compared with those of an historical cohort of patients with sJIA and MAS., Results: Twenty-three patients with MAS and TMA were enrolled: 17 had sJIA, 2 systemic lupus erythematosus, 1 juvenile dermatomyositis, 1 mixed connective tissue disease, and 2 undifferentiated connective tissue disease. Compared with the historical cohort of MAS, patients with sJIA with coexistent MAS and TMA had higher frequencies of renal failure and neurologic involvement, hemorrhage, jaundice, and respiratory symptoms, as well as more severe anemia and thrombocytopenia, higher levels of alanine aminotransferase, lactate dehydrogenase, bilirubin and D-dimer, and lower levels of albumin and fibrinogen. They also required admission to the intensive care unit more frequently. Among patients tested, complement abnormalities and reduced ADAMTS13 activity were observed in 64.3% and 44.4% of cases, respectively. All patients received glucocorticoids. Treatment for TMA included plasma-exchange, eculizumab, and rituximab., Conclusions: The possible coexistence of MAS and TMA in rheumatic diseases may be underrecognized. This association should be considered in patients with MAS who develop disproportionate anemia, thrombocytopenia, and lactate dehydrogenase increase, or have multiorgan failure., (Copyright © 2021 Elsevier Inc. All rights reserved.)

Objective: To develop a composite disease activity score for systemic JIA (sJIA) and to provide preliminary evidence of its validity., Methods: The systemic Juvenile Arthritis Disease Activity Score (sJADAS) was constructed by adding to the four items of the original JADAS a fifth item that aimed to quantify the activity of systemic features. Validation analyses were conducted on patients with definite or probable/possible sJIA enrolled at first visit or at the time of a flare, who had active systemic manifestations, which should include fever. Patients were reassessed 2 weeks to 3 months after baseline. Three versions were examined, including ESR, CRP or no acute-phase reactant., Results: A total of 163 patients were included at 30 centres in 10 countries. The sJADAS was found to be feasible and to possess face and content validity, good construct validity, satisfactory internal consistency (Cronbach's alpha 0.64-0.65), fair ability to discriminate between patients with different disease activity states and between those whose parents were satisfied or not satisfied with illness outcome (P < 0.0001 for both), and strong responsiveness to change over time (standardized response mean 2.04-2.58). Overall, these properties were found to be better than those of the original JADAS and of DAS for RA and of Puchot score for adult-onset Still's disease., Conclusion: The sJADAS showed good measurement properties and is therefore a valid instrument for the assessment of disease activity in children with sJIA. The performance of the new tool should be further examined in other patient cohorts that are evaluated prospectively., (© The Author(s) 2020. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For permissions, please email: journals.permissions@oup.com.)

Introduction: Juvenile systemic sclerosis is an orphan disease. Currently, the majority of juvenile systemic sclerosis cohort studies are retrospective in design without standardized assessment. This study was conducted prospectively to investigate the difference in manifestations of limited cutaneous juvenile systemic sclerosis and diffuse cutaneous juvenile systemic sclerosis subtypes. An additional aim was to compare these data to other juvenile systemic sclerosis cohorts and a large adult systemic sclerosis cohort., Methods: Patients fulfilling the Paediatric Rheumatology European Society juvenile systemic sclerosis classification criteria were included. Clinical characteristics and patient-related outcomes were assessed., Results: In all, 88 patients with a mean disease duration of 3.5 years were enrolled, 72.5% with diffuse cutaneous juvenile systemic sclerosis with a mean modified Rodnan Skin score of 18 and 27.5% with limited cutaneous juvenile systemic sclerosis with mean modified Rodnan Skin score of 9. The mean age at the onset of Raynaud's and first non-Raynaud's symptoms was similar in both groups, approximately 9 and 10.5 years. Active digital tip ulcerations were present in 29% diffuse cutaneous juvenile systemic sclerosis and none in the limited cutaneous juvenile systemic sclerosis subjects (p = 0.005). Of those with cardiopulmonary testing, 3% of diffuse cutaneous juvenile systemic sclerosis and 23% of limited cutaneous juvenile systemic sclerosis group had cardiac involvement (p = 0.015), and 41% diffuse cutaneous juvenile systemic sclerosis and 22% of the limited cutaneous juvenile systemic sclerosis group had pulmonary involvement (p = 0.009). Physician global disease damage assessment was higher in the diffuse cutaneous juvenile systemic sclerosis group compared to the limited cutaneous juvenile systemic sclerosis group: 35 and 15 (p = 0.021)., Discussion: The majority of this international juvenile systemic sclerosis cohort had diffuse cutaneous juvenile systemic sclerosis (72.5%) with more frequent vascular and pulmonary involvement compared to the limited cutaneous group, who had increased cardiac involvement. Our cohort reflects prior findings of published juvenile systemic sclerosis cohorts and emphasizes a difference in the presentation compared to adult-onset systemic sclerosis., Competing Interests: Declaration of conflicting interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship and/or publication of this article., (© The Author(s) 2018.)

Objective: To assess performance of the 2016 macrophage activation syndrome (MAS) classification criteria for patients with systemic juvenile idiopathic arthritis (JIA) who develop MAS while treated with biologic medications., Methods: A systematic literature review was performed to identify patients with MAS while being treated with interleukin (IL)-1 and IL-6 blocking agents. Clinical and laboratory information was compared to a large previously compiled historical cohort., Results: Eighteen publications were identified, and after removing duplicates, 35 patients treated with canakinumab and 49 patients with tocilizumab were available for analysis; 5 anakinra-treated patients were excluded due to limited numbers. MAS classification criteria were less likely to classify tocilizumab-treated patients as having MAS compared to the historical cohort or canakinumab-treated patients (56.7%, 78.5%, and 84%, respectively; P < 0.01). Patients who developed MAS while treated with canakinumab trended towards lower ferritin at MAS onset than the historical cohort (4,050 versus 5,353 ng/ml; P = 0.18) but had no differences in other cardinal clinical or laboratory features. In comparison, patients who developed MAS while treated with tocilizumab were less likely febrile and had notably lower ferritin levels (1,152 versus 5,353 ng/ml; P < 0.001). Other features of MAS were more pronounced in patients treated with tocilizumab, including lower platelet counts, lower fibrinogen, and higher aspartate aminotransferase levels. Mortality rates for patients with MAS treated with tocilizumab or canakinumab were not significantly different from the historical cohort., Conclusion: These findings show substantial alterations in MAS features that may limit utility of defined criteria for diagnosis of systemic JIA patients treated with biologic agents., (© 2017, American College of Rheumatology.)

Background/purpose: The CCR5 protein is a chemokine receptor, and is known to be expressed on T cells, macrophages, dendritic and microglia cells. It is believed that different prevalence of HLA and CCR5- delta32-a 32 base pair deletion in the coding region-in various ethnic groups is associated with the severity and prevalence of chemokine-mediated autoimmune diseases, systemic-onset Juvenile Idiopathic Arthritis (soJIA) being among them (Del Rincon et al., 2003). Since the end of the last century the protective role of the CCR5-delta32 mutation against JIA is discussed (Hinks et al., 2010), though it seems the role of this mutation is less simple than was hitherto thought. The purposes of the study was to compare the prevalence of the CCR5-delta32 mutation in children with and without soJIA, to assess the association of this mutation with the severity of the disease and thus to evaluate its protective role., Methods: 234 children (193 of European origin, 25-Hispanic or Latino, 14-Afro-Americans, 3-of Asian origin) with soJIA living in the USA and in the Northwestern part of Russia were enrolled in the study. Genomic DNA was isolated from blood samples using QIAamp Mini Kit and amplified by PCR. The following oligonucleotide primers were used to detect CCR5 d32: CCR5- Δ32-F: 5'CTTCATTACACCTGCAGTC3', CCR5-Δ32-R: 5'TGAAGATAAGCCTCACAGCC3' by following condition: 95°-5'×1; 95°-15″→55°-15″→72°-60″×40; 72°-10'×3→4°-∞; the resulting PCR products were separated on 2% agarose gel by electrophoresis and visualized by Gel Doc XR Plus., Results: Mutation was revealed only in children of European origin. Though the prevalence of the heterozygous CCR5-delta32 mutation being 16% and 21% in the USA and in Russia correspondingly didn't excel from its prevalence in populations in total (10-18% for Northwestern Russia, Kofiady, 2008; 11,8%- for white American group, Downer et al, 2002), some laboratory and clinical signs of soJIA proved to be related to the mutation (see ). Heterozygous CCR5-delta32 genotype was associated with milder so-JIA course and predominance of the articular features over systemic. [Table: see text], Conclusion: The results of the study may be considered rather not supporting the idea of the protective role of the CCR5-delta32 mutation against soJIA, though the revealed associations-most of them related to the signs of the Macrophage Associated Syndrome-can be the basis for a more sophisticated research., (Copyright © 2014 by the American College of Rheumatology.)

Objective: To evaluate whether early treatment with methotrexate (MTX) prevents the onset of uveitis in children with juvenile idiopathic arthritis., Study Design: The clinical charts of all consecutive patients seen between January 2002 and February 2011 who had a disease duration <1 year at first visit and had received a stable management for at least 2 years with or without MTX were reviewed. Patients who were given systemic medications other than MTX (except nonsteroidal anti-inflammatory drugs) were excluded. Patients with systemic arthritis, rheumatoid factor-positive arthritis, or enthesitis-related arthritis were also excluded. In each patient, the 2-year follow-up period after first visit was examined to establish whether uveitis had occurred., Results: A total of 254 patients with a median disease duration of 0.3 year were included. Eighty-six patients (33.9%) were treated with MTX, whereas 168 patients (66.1%) did not receive MTX. During the 2-year follow-up, 211 patients (83.1%) did not develop uveitis, whereas 43 patients (16.9%) had uveitis a median of 1.0 year after the first visit. The frequency of uveitis was lower in MTX-treated than in MTX-untreated patients (10.5% vs 20.2%, respectively, P = .049). Survival analysis confirmed that patients treated with MTX had a lower probability of developing uveitis., Conclusion: Early MTX therapy may prevent the onset of uveitis in children with juvenile idiopathic arthritis. Because our study may be affected by confounding by indication, the potential of MTX to reduce the incidence of ocular disease should be investigated in a randomized controlled trial., (Copyright © 2013 Mosby, Inc. All rights reserved.)

Objective: To investigate the outcome and predicting factors of multiple intraarticular corticosteroid (IAC) injections in children with juvenile idiopathic arthritis (JIA)., Methods: The clinical charts of patients who received their first IAC injection in ≥3 joints between January 2002 and December 2011 were reviewed. The corticosteroid used was triamcinolone hexacetonide for large joints and methylprednisolone acetate for small or difficult to access joints. In each patient, the followup period after IAC injection was censored in case of synovitis flare or at the last visit with continued remission. Predictors included sex, age at disease onset, JIA category, antinuclear antibody (ANA) status, age and disease duration, disease course, general anesthesia, number and type of injected joints, acute-phase reactants, and concomitant systemic medications., Results: A total of 220 patients who had 1,096 joints injected were included. Following IAC therapy, 66.4% of patients had synovitis flare after a median of 0.5 years, whereas 33.6% of patients had sustained remission after a median of 0.9 years. The cumulative probability of survival without synovitis flare was 50.0%, 31.5%, and 19.5% at 1, 2, and 3 years, respectively. On Cox regression analysis, positive C-reactive protein value, negative ANA, lack of concomitant methotrexate administration, and a polyarticular (versus an oligoarticular) disease course were the strongest predictors for synovitis flare., Conclusion: Multiple IAC injection therapy induced sustained remission of joint synovitis in a substantial proportion of patients. A controlled trial comparing multiple IAC injection therapy and methotrexate versus methotrexate and a tumor necrosis factor antagonist is worthy of consideration., (Copyright © 2013 by the American College of Rheumatology.)