Search

As a promising direct measurement method of atmospheric hydroperoxyl radicals (HO 2 ), bromide chemical ionization mass spectrometry (Br-CIMS) has been first demonstrated by Sanchez et al. ( Atmos. Meas. Tech. 2016, 9 , 3851-3861). However, field application of this method is currently still sparse, and there is still a gap between measured HO 2 concentrations and calculated ones derived from the atmospheric equilibrium between HO 2 and peroxynitric acid (HO 2 NO 2 ). In this work, we constructed an improved Br-CIMS with optimizations of custom-built front-end devices, chamber pressures, and instrumental voltages to achieve a 3σ detection limit of 0.5 ppt at an integration time of 60 s and a sensitivity of 1-3 cps ppt -1 under a total reagent ion signal of 0.2 MHz for HO 2 detection. HO 2 NO 2 , a product from atmospheric reactions between HO 2 and NO 2 , can also be detected by Br-CIMS, whose interference on the HO 2 measurement was found but nearly eliminated by regulating key CIMS voltages to minimize the decomposition of (BrHO 2 NO 2 ) - ions in the MS. In addition, a 2 week field campaign was carried out in urban Shanghai, demonstrating that the interference of HO 2 from ambient HO 2 NO 2 was less than 10% of the true HO 2 signal under our optimized CIMS voltage setting. Our study suggests that Br-CIMS is a reliable technique for atmospheric HO 2 measurements.

Background: Methadone maintenance treatment (MMT) is effective for managing opioid use disorder, but adverse effects mean that optimal therapy occurs with the lowest dose that controls opioid craving., Objective: To assess the efficacy of acupuncture versus sham acupuncture on methadone dose reduction., Design: Multicenter, 2-group, randomized, sham-controlled trial. (Chinese Clinical Trial Registry: ChiCTR2200058123)., Setting: 6 MMT clinics in China., Participants: Adults aged 65 years or younger with opioid use disorder who attended clinic daily and had been using MMT for at least 6 weeks., Intervention: Acupuncture or sham acupuncture 3 times a week for 8 weeks., Measurements: The 2 primary outcomes were the proportion of participants who achieved a reduction in methadone dose of 20% or more compared with baseline and opioid craving, which was measured by the change from baseline on a 100-mm visual analogue scale (VAS)., Results: Of 118 eligible participants, 60 were randomly assigned to acupuncture and 58 were randomly assigned to sham acupuncture (2 did not receive acupuncture). At week 8, more patients reduced their methadone dose 20% or more with acupuncture than with sham acupuncture (37 [62%] vs. 16 [29%]; risk difference, 32% [97.5% CI, 13% to 52%]; P  < 0.001). In addition, acupuncture was more effective in decreasing opioid craving than sham acupuncture with a mean difference of -11.7 mm VAS (CI, -18.7 to -4.8 mm; P  < 0.001). No serious adverse events occurred. There were no notable differences between study groups when participants were asked which type of acupuncture they received., Limitation: Fixed acupuncture protocol limited personalization and only 12 weeks of follow-up after stopping acupuncture., Conclusion: Eight weeks of acupuncture were superior to sham acupuncture in reducing methadone dose and decreasing opioid craving., Primary Funding Source: National Natural Science Foundation of China., Competing Interests: Disclosures: Disclosures can be viewed at www.acponline.org/authors/icmje/ConflictOfInterestForms.do?msNum=M23-2721.

Introduction: The cognitive impairment patterns and the association with Alzheimer's disease (AD) in mental disorders remain poorly understood., Methods: We analyzed data from 486,297 UK Biobank participants, categorizing them by mental disorder history to identify the risk of AD and the cognitive impairment characteristics. Causation was further assessed using Mendelian randomization (MR)., Results: AD risk was higher in individuals with bipolar disorder (BD; hazard ratio [HR] = 2.37, P < 0.01) and major depressive disorder (MDD; HR = 1.63, P < 0.001). MR confirmed a causal link between BD and AD (OR IVW  = 1.098), as well as obsessive-compulsive disorder (OCD) and AD (OR IVW  = 1.050). Cognitive impairments varied, with BD and schizophrenia showing widespread deficits, and OCD affecting complex task performance., Discussion: Observational study and MR provide consistent evidence that mental disorders are independent risk factors for AD. Mental disorders exhibit distinct cognitive impairment prior to dementia, indicating the potential different mechanisms in AD pathogenesis. Early detection of these impairments in mental disorders is crucial for AD prevention., Highlights: This is the most comprehensive study that investigates the risk and causal relationships between a history of mental disorders and the development of Alzheimer's disease (AD), alongside exploring the cognitive impairment characteristics associated with different mental disorders. Individuals with bipolar disorder (BD) exhibited the highest risk of developing AD (hazard ratio [HR] = 2.37, P < 0.01), followed by those with major depressive disorder (MDD; HR = 1.63, P < 0.001). Individuals with schizophrenia (SCZ) showed a borderline higher risk of AD (HR = 2.36, P = 0.056). Two-sample Mendelian randomization (MR) confirmed a causal association between BD and AD (OR IVW  = 1.098, P < 0.05), as well as AD family history (proxy-AD, OR IVW  = 1.098, P < 0.001), and kept significant after false discovery rate correction. MR also identified a nominal significant causal relationship between the obsessive-compulsive disorder (OCD) spectrum and AD (OR IVW  = 1.050, P < 0.05). Individuals with SCZ, BD, and MDD exhibited impairments in multiple cognitive domains with distinct patterns, whereas those with OCD showed only slight declines in complex tasks., (© 2024 The Author(s). Alzheimer's & Dementia published by Wiley Periodicals LLC on behalf of Alzheimer's Association.)

Objectives: The aim of this study was to develop an assessment tool for automatic detection of dental caries in periapical radiographs using convolutional neural network (CNN) architecture., Methods: A novel diagnostic model named ResNet + SAM was established using numerous periapical radiographs (4278 images) annotated by medical experts to automatically detect dental caries. The performance of the model was compared to the traditional CNNs (VGG19, ResNet-50), and the dentists. The Gradient-weighted Class Activation Mapping (Grad-CAM) technique shows the region of interest in the image for the CNNs., Results: ResNet + SAM demonstrated significantly improved performance compared to the modified ResNet-50 model, with an average F1 score of 0.886 (95% CI 0.855-0.918), accuracy of 0.885 (95% CI 0.862-0.901) and AUC of 0.954 (95% CI 0.924-0.980). The comparison between the performance of the model and the dentists revealed that the model achieved higher accuracy than that of the junior dentists. With the assist of the tool, the dentists achieved superior metrics with a mean F1 score of 0.827 and the interobserver agreement for dental caries is enhanced from 0.592/0.610 to 0.706/0.723., Conclusions: According to the results obtained from the experiments, the automatic assessment tool using the ResNet + SAM model shows remarkable performance and has excellent possibilities in identifying dental caries. The use of the assessment tool in clinical practice can be of great benefit as a clinical decision-making support in dentistry and reduce the workload of dentists., (© 2024. The Author(s) under exclusive licence to Japanese Society for Oral and Maxillofacial Radiology.)

Background: Cognitive impairment is a recognized fundamental deficit in individuals diagnosed with schizophrenia (SZ), bipolar II disorder (BD II), and major depressive disorder (MDD), among other psychiatric disorders. However, limited research has compared cognitive function among first-episode drug-naïve individuals with SZ, BD II, or MDD., Methods: This study aimed to address this gap by assessing the cognitive performance of 235 participants (40 healthy controls, 58 SZ patients, 72 BD II patients, and 65 MDD patients) using the Repeatable Battery for the Assessment of Neuropsychological Status (RBANS) before and after 12 weeks of treatment in SZ, BD II, and MDD patients. To clarify, the healthy controls only underwent RBANS testing at baseline, whereas the patient groups were assessed before and after treatment. The severity of symptoms in SZ patients was measured using the Positive and Negative Syndrome Scale (PANSS), and depression in BD II and MDD patients was assessed using the Hamilton Depression Scale-24 items (HAMD-24 items)., Results: Two hundred participants completed the 12-week treatment period, with 35 participants dropping out due to various reasons. This group included 49 SZ patients, 58 BD II patients, and 53 MDD patients. Among SZ patients, significant improvements in immediate and delayed memory were observed after 12 weeks of treatment compared to their initial scores. Similarly, BD II patients showed significant improvement in immediate and delayed memory following treatment. However, there were no significant differences in RBANS scores for MDD patients after 12 weeks of treatment., Conclusions: In conclusion, the findings of this study suggest that individuals with BD II and SZ may share similar deficits in cognitive domains. It is important to note that standardized clinical treatment may have varying degrees of effectiveness in improving cognitive function in patients with BD II and SZ, which could potentially alleviate cognitive dysfunction., (© 2024. The Author(s).)

Ficus altissima, also known as lofty fig, is a monoecious plant from the Moraceae family commonly found in southern China. In this study, we isolated and identified one new isoflavone (1), three new hydroxycoumaronochromones (2a, 2b and 3a) and 12 known compounds from the fruits of F. altissima. Their chemical structures were determined using spectroscopic analysis methods. We also tested all the isolated compounds for their anti-proliferative activities against eight human tumour cell lines (A-549, AGS, K562, K562/ADR, HepG2, HeLa, SPC-A-1 and CNE2) using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. Our experiments showed that compound 6 exhibited obvious anti-proliferative activity against the K562 cell line with an IC 50 value of 1.55 μM. Additionally, compounds 8 and 9 showed significant anti-proliferative activities against the AGS and K562 cell lines, respectively. Moreover, compound 6 induced apoptosis in K562 cells through the caspase family signalling pathway., Competing Interests: Declaration of competing interest The authors declare no competing financial interest., (Copyright © 2023. Published by Elsevier B.V.)

The use of natural starch as a replacement for petroleum-based packaging materials is limited due to its poor processability, weak mechanical properties, and strong moisture sensitivity. To address these limitations, this study adopts molecular design of hydroxypropylation and acetylation to sequentially modify natural starch, and material design of introducing acetylated cellulose nanofibers (ACNF) into the starch matrix to reinforce the material. Hydroxypropylation decreased the interaction force between the starch molecular chains, thereby reducing the glass transition temperature. Subsequent acetylation introduced hydrophobic acetyl groups that disrupted intermolecular hydrogen bonds, enhancing the mobility of the starch molecular chain, and endowed the hydroxypropyl starch acetate (HPSA) with excellent thermoplastic processability (melt index of 7.12 g/10 min) without the need for plasticizers and notable water resistance (water absorption rate of 3.0 %). The introduction of ACNF generated a strong interaction between HPSA chains, promoting the derived ACNF-HPSA to exhibit excellent mechanical strength, such as high impact strength of 2.1 kJ/m 2 , tensile strength of 22.89 MPa, elasticity modulus of 813.22 MPa, flexural strength of 24.18 MPa and flexural modulus of 1367.88 MPa. Its overall performance even surpassed that of polypropylene (PP) plastic, making it a potential alternative material for PP-based packaging materials., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

The sensitivity of grassland above- (AGB, gC m -2 ) and below-ground biomass (BGB, gC m -2 ) to climate has been shown to be significant on the Tibetan Plateau, however, the spatial patterns and sensitivity of biomass with altitudinal change needs to be quantitated. In this study, large data sets of AGB and BGB during the peak growth season, and the corresponding geographical and climate conditions in the grasslands of the Tibetan Plateau between 2001 and 2020 were analyzed, and modelled using a Cubist regression trees algorithm. The mean values for AGB and BGB were 61.3 and 1304.3 gC m -2 , respectively, for the whole region over the two decades. There was a significant change in spatial AGB of 64.8 % on the Plateau (P < 0.05, with areas where AGB increased being twice as large as areas where AGB decreased), while BGB did not change significantly in majority the of the region (≥ 90.1 %, P > 0.05). In general, the areas where AGB showed positive partial correlations with precipitation were larger than the areas where AGB had positive correlations with temperature (P < 0.05). However, these trends varied depending on the climatic conditions: in the wetter regions, temperature had a greater effect on the size of the areas with positive AGB responses than precipitation (P < 0.05), while precipitation had a greater effect on the size of areas with positive BGB changes than temperature (P < 0.05). In the drier areas, however, precipitation affected the AGB response significantly compared to temperature (P < 0.05), while temperature influenced the BGB response greater than precipitation (P < 0.05). The response and sensitivity of grassland biomass to temperature and precipitation varied according to the altitude of the Plateau: the response and sensitivity were stronger and more sensitive at medium altitudes, and weak at the higher or lower altitudes. Likely, this phenomenon was resulted from the natural selection of plants to maintain the efficient use of resources during un-favourable and stressed conditions for maximum plant development and growth. These findings will help assess the ecological consequences of global climate change for the grasslands of the Tibetan Plateau, particularly in those regions with highly variable altitudes., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Under a global carbon-neutralizing environment, renewable wood is a viable alternative to non-renewable resources due to its abundance and high specific strength. However, fast-growing wood is hard to be applied extensively due to low mechanical strength and poor dimensional stability and durability. In this study, epoxy-acrylic resin-modified wood was prepared by forming a functional monomer system with three monomers [glycidyl methacrylate (GMA), maleic anhydride (MAN), and polyethylene glycol-200-dimethylacrylic acid (PEGDMA)] and filling into the wood cell cavity. The results showed that in the case of an optimal monomer system of nGMA:nPEGDMA = 20:1 and an optimal MAN dosage of 6%, the conversion rate of monomers reached 98.01%, the cell cavity was evenly filled by the polymer, with the cell wall chemically bonded. Thus, a bonding strength of as high as 1.13 MPa, a bending strength of 112.6 MPa and an impact toughness of 74.85 KJ/m 2 were applied to the modified wood, which presented excellent dimensional stability (720 h water absorption: 26%, and volume expansion ratio: 5.04%) and rot resistance (loss rates from white rot and brown rot: 3.05% and 0.67%). Additionally, polymer-modified wood also exhibited excellent wear resistance and heat stability. This study reports a novel approach for building new environmentally friendly wood with high strength and toughness and good structural stability and durability.

Several previous studies have found the deleterious effects of cadmium exposure on bone. However, studies on the effects of cadmium exposure on bone mineral density (BMD) in gender- and race-specific groups are still lacking. The aim of this study was to investigate the relationship between cadmium exposure and BMD in adults and the gender and racial differences therein. Weighted multivariate regression, generalized weighted model, and smoothed curve fitting were used to explore the relationship between lumbar BMD with blood cadmium (B-Cd) and urine cadmium (U-Cd) based on data from the National Health and Nutrition Examination Survey (NHANES). In addition, subgroup analyses were further used to investigate the differential associations across gender and race. Of the 4335 adult participants. After adjusting for primary demographic variables, B-Cd [- 0.018 (- 0.028, - 0.008)] and U-Cd [- 0.010 (- 0.020, - 0.001)] were shown to be negatively related to lumbar BMD. In the fully adjusted model, the negative association between B-Cd and lumbar BMD was maintained [- 0.010 (- 0.018, - 0.002)]. In the subgroup analysis stratified by gender and race, this relationship was retained in females and non-Hispanic blacks. Furthermore, these negative associations were most pronounced among non-Hispanic black women [B-Cd and lumbar BMD, - 0.046 (- 0.076, - 0.017); U-Cd and lumbar BMD, -0.034 (- 0.063, - 0.006)]. Our findings suggest that there are significant sex and race differences in the negative association between cadmium exposure and BMD. This negative association was most prominent in non-Hispanic black females., (© 2022. The Author(s), under exclusive licence to Springer Science+Business Media, LLC, part of Springer Nature.)

Schizophrenia is a disabling major mental disorder, which includes critical deficits in cognitive function, for which no effective intervention currently exists. The aim of our double-blind, randomized, sham-controlled trial was to evaluate the effects of high-definition transcranial direct current stimulation (HD-tDCS) on the cognitive deficits in schizophrenia. This study sample consisted of 56 individuals with chronic schizophrenia, randomly allocated to either the active stimulation or sham group. The treatment consisted of ten consecutive days of HD-tDCS, 20 min/day, applied over the left dorsolateral prefrontal lobe. Changes in clinical outcomes, cognitive assessments, and diffusion tensor imaging were evaluated pre- to post-intervention. Matched-healthy controls (HCs) were included to identify white matter changes in patients with schizophrenia before treatment. Compared to HCs, schizophrenia was associated with reduced integrity of the white matter tracts of the corpus callosum and corona radiata. HD-tDCS enhanced integrity in the corpus callosum and anterior and superior corona radiata, which was associated with the change in cognitive performance. HD-tDCS offers a potential approach to improve cognition deficits in schizophrenia through a modulatory effect on white matter tracts. Given the lack of approved treatments for cognitive deficits, these findings are clinically relevant., Competing Interests: Declaration of Competing Interest The authors declare no conflicts of interest., (Copyright © 2023. Published by Elsevier B.V.)

To understand the influence of doping Sr atoms on the structural, magnetic, and electronic properties of the infinite-layer NdSrNiO 2 , we carried out the screened hybrid density functional study on the Nd 9- n Sr n Ni 9 O 18 ( n = 0-2) unit cells. Geometries, substitution energies, magnetic moments, spin densities, atom- and lm-projected partial density of states (PDOS), spin-polarized band structures, and the average Bader charges were studied. It showed that the total magnetic moments of the Nd 9 Ni 9 O 18 and Nd 8 SrNi 9 O 18 unit cells are 37.4 and 24.9 emu g -1 , respectively. They are decreased to 12.6 and 4.2 emu g -1 for the Nd 7 Sr 2 Ni 9 O 18 -Dia and Nd 7 Sr 2 Ni 9 O 18 -Par unit cells. The spin density distributions demonstrated that magnetic disordering of the Ni atoms results in the magnetism decrease. The spin-polarized band structures indicated that the symmetry of the spin-up and spin-down energy bands around the Fermi levels also influence the total magnetic moments. Atom- and lm -projected PDOS as well as the band structures revealed that Ni(dx2-y2) is the main orbital intersecting the Fermi level. As a whole, electrons of Sr atoms tend to locate locally and hybridize weakly with the O atoms. They primarily help to build the infinite-layer structures, and influence the electronic structure near the Fermi level indirectly.

Agaricus bisporus is one of the most commonly grown edible fungi in the world. In December 2021, brown blotch disease (2% incidence) was observed on the cap of A. bisporus, growing in a mushroom cultivation base in Guangxi, China. Initially, brown blotches (1-1.3 cm) appeared on the cap of A. bisporus, which expanded gradually as the cap grew. After two days, the infection penetrated inner tissues of fruiting bodies, and blotches were dark brown. For the isolation of causative agent(s), internal tissue samples of the infected stipes (5×5×5 mm) were sterilized in 75% ethanol for 30 s, rinsed three times with sterile deionized water (SDW), then, mashed in the sterile 2 ml Eppendorf tubes, 1000 µl SDW was added and the suspension was diluted into seven concentrations (10-1~10-7). Each suspension (120 µl) was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28 °C. Morphological examination of the isolates was referred to Liu et al (2022). The dominant single colonies were whitish-grayish, smooth, convex. The cells were Gram-positive, non-flagellated, nonmotile, no pods or endospores formed, and no fluorescent pigments production on King's B medium (Solarbio). Amplified 16S rRNA (1351 bp; OP740790) of five colonies using universal primers 27f/1492r (Liu et al., 2022), exhibited 99.26% identity with Arthrobacter (Ar.) woluwensis. The partial sequences of the ATP synthase subunit beta gene (atpD) (677 bp; OQ262957), RNA polymerase subunit beta gene (rpoB) (848 bp; OQ262958), preprotein translocase subunit SecY gene (secY) (859 bp; OQ262959) and elongation factor Tu gene (tuf) (831 bp; OQ262960) genes of colonies were amplified using the method of Liu et al (2018), also exhibited more than 99% similarities to Ar. woluwensis. The biochemical tests for isolates (n=3) were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ar. woluwensis (Positive for esculin hydrolysis, urea, gelatinase, catalase, sorbitol, gluconate, salicin and arginine. Negative for citrate, nitrate reduction and rhamnose) (Funke et al., 1996). The isolates were identified as Ar. woluwensis based on morphological characteristics, biochemical tests and phylogenetic analysis. Pathogenicity tests were performed with bacterial suspensions (1 × 109 CFU/ml) after growing for 36 h in LB Broth at 28 °C, 160 rpm. 30 µl bacterial suspension was added to the cap and tissue of young A. bisporus. SDW was added as a negative control. All treatments were incubated at 20 °C and 80-85% humidity. The experiment was repeated three times with five caps and five tissues of young A. bisporus each time. Brown blotches were observed on all the parts of the inoculated caps and tissues after 24 h of inoculation. At 48 h, the inoculated caps turned dark brown while the infected tissues changed from brown to black and expanded to the entire tissue block giving a severely rotten appearance and foul odor. This disease symptoms were similar to those observed in the original samples. There were no lesions in the control group. After the pathogenicity test, the pathogen was re-isolated from the infected caps and tissues based on morphological characteristics, 16S rRNA sequences, and biochemical results, fulfilling Koch's postulates. Arthrobacter spp. are very widely distributed in the environment (Kim et al., 2008). To date, two studies have confirmed Arthrobacter spp. as a pathogen of edible fungi (Bessette, 1984; Wang et al., 2019). However, this is the first report of Ar. woluwensis causing brown blotch disease on A. bisporus. Our finding could contribute to developing phytosanitary and control treatments for this disease.

Nitrogen pollution is one of the main reasons for water eutrophication. The difficulty of nitrogen removal in low-carbon wastewater poses a huge potential threat to the ecological environment and human health. As a clean biological nitrogen removal process, solid-phase denitrification (SPD) was proposed for long-term operation of low-carbon wastewater. In this paper, the progress, hotspots, and challenges of the SPD process based on different solid carbon sources (SCSs) are reviewed. Compared with synthetic SCS and natural SCS, blended SCSs have more application potential and have achieved pilot-scale application. Differences in SCSs will lead to changes in the enrichment of hydrolytic microorganisms and hydrolytic genes, which indirectly affect denitrification performance. Moreover, the denitrification performance of the SPD process is also affected by the physical and chemical properties of SCSs, pH of wastewater, hydraulic retention time, filling ratio, and temperature. In addition, the strengthening of the SPD process is an inevitable trend. The strengthening measures including SCSs modification and coupled electrochemical technology are regarded as the current research hotspots. It is worth noting that the outbreak of the COVID-19 epidemic has led to the increase of disinfection by-products and antibiotics in wastewater, which makes the SPD process face challenges. Finally, this review proposes prospects to provide a theoretical basis for promoting the efficient application of the SPD process and coping with the challenge of the COVID-19 epidemic., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 Elsevier B.V. All rights reserved.)

Introduction: The aim of the study was to investigate the clinical characteristics and treatment outcomes of the pseudophakic eyes with malignant glaucoma (MG)., Methods: This retrospective case-control study enrolled 53 eyes of 47 patients with primary angle-closure glaucoma having cataract surgery history, including 19 patients (25 eyes) diagnosed with MG and 28 patients (28 eyes) without MG as the match. Among patients diagnosed with MG, 14 patients (18 eyes) underwent zonulo-hyaloido-vitrectomy (ZHV) and the other 5 patients (7 eyes) received conservative treatments. The visual acuity, refraction status, intraocular pressure (IOP), extent of peripheral anterior synechia, classes of anti-glaucoma medications, and ultrasound biomicroscopy (UBM) examination were recorded before cataract surgery, at the diagnosis of MG, and 3 months after ZHV or atropine application, respectively., Results: In the pseudophakic eyes with MG, the IOP cannot be well controlled compared to the matched eyes (27.24 ± 8.72 mm Hg vs. 14.30 ± 2.63 mm Hg, p &lt; 0.001). In addition, there was a difference in the average spherical equivalent refractive error between 2 groups of patients (-2.23 ± 0.84 D in MG vs. -0.12 ± 0.64 D in the matched eyes, p &lt; 0.001). By UBM analysis, the anterior chamber depth (ACD) was shallower in MG than that in the matched eyes (2.34 ± 0.20 mm vs. 3.47 ± 0.29 mm, p &lt; 0.001). The difference between the anterior vault distance of the pseudophakic eyes with MG and that of the matched eyes was also significant (p &lt; 0.001). After treated with ZHV, the IOP was greatly decreased from 27.84 ± 10.14 mm Hg to 15.85 ± 4.41 mm Hg (p &lt; 0.001). The refractive error also changed from -2.11 ± 0.91 D to +0.42 ± 0.99 D (p &lt; 0.001). At the same time, the central ACD was significantly deepened from 2.30 ± 0.39 mm to 3.30 ± 0.31 mm (p &lt; 0.001)., Conclusion: Uncontrolled IOP and shallow anterior chamber both centrally and peripherally are the primary clinical characteristics for the pseudophakic eyes with MG. An unexpected refractive error or myopic shift for the eyes with PACG after cataract surgery can be an important hint for diagnosis of MG. The typical UBM image is an anterior displacement of the lens-iris diaphragm and a bow-shaped change of the intraocular lens. It is an effective way to treat pseudophakic MG with the ZHV through a peripheral iridectomy., (© 2023 The Author(s). Published by S. Karger AG, Basel.)

Wood is a viable alternative to traditional steel, cement, and concrete as a structural material for building applications, utilizing renewable resources and addressing the challenges of high energy consumption and environmental pollution in the construction industry. However, the vast supply of fast-growing poplar wood has bottlenecks in terms of low strength and dimensional stability, making it difficult to use as a structural material. An environmentally friendly acrylic resin system was designed and cured in this study to fill the poplar cell cavities, resulting in a new type of poplar laminated veneer lumber with improved mechanical strength and dimensional stability. The optimized acrylic resin system had a solid content of 25% and a curing agent content of 10% of the resin solid content. The cured filled poplar veneer gained 81.36% of its weight and had a density of 0.69 g/cm 3 . The static flexural strength and modulus of elasticity of the further prepared laminated veneer lumber were 123.12 MPa and 12,944.76 MPa, respectively, exceeding the highest flexural strength required for wood structural timber for construction (modulus of elasticity 12,500 MPa and static flexural strength 35 MPa). Its tensile strength, impact toughness, hardness, attrition value, water absorption, water absorption thickness expansion, and water absorption width expansion were 58.81%, 19.50%, 419.18%, 76.83%, 44.38%, 13.90%, and 37.60% higher than untreated laminated veneer lumber, demonstrating improved mechanical strength and dimensional stability, significantly. This method provides a novel approach to encouraging the use of low-value-added poplar wood in high-value-added structural building material applications.

A new type of imitation rattan was developed via a two-step method that used modified wheat straw as the raw materials and low-density polyethylene to make up wood plastic composite. Post-modification, a graft condensation reaction was carried out between silane as a coupling agent and wheat straw powder, which improved the thermal stability of the composite. A high level of contact and interaction at the fibre-matrix interface was observed. The optimum formula for the first step was 80% wheat straw powder, 4% silane coupling agent, and 16% calcium carbonate, with a modification temperature of 120 °C sustained for 10 min. For the second step, the mechanical properties had been greatly improved with the addition of modified wheat straw fibre and maleic anhydride grafted polypropylene (MA-g-PP). The use of 10% modified straw fibre and 5% MA-g-PP exhibited the highest tensile strength (8.75 MPa) and highest melt index (2.86 g/10 min). In particular, the MA-g-PP had an extremely advantage to the elastic modulus of wheat straw imitation rattan. The elastic modulus reached the maximum value of 2761.70 MPa at the amount of MA-g-PP added reached 5%. Our present study indicated the innovation of a new type of imitation rattan, which provides a new choice for utilizing wheat straw as industrial raw material, and other agricultural by-products containing liginocellulose could be used in a similar way.

In this work, a toxicity monitoring microbial system (TMMS) with a nitrifying biofilm as a sensing element and cathode oxygen reduction as an electrical signal was successfully constructed for trichloroacetaldehyde (TCAL) detection. The current and nitrification rate showed a linear relationship with TCAL concentration from 0 to 100 μg/L (R 2 current  = 0.9892, R 2 nitrification  = 0.9858), indicating that the target substrate concentration can be directly obtained from an electrical signal without further sample concentration. High-throughput sequencing revealed that the TMMS was composed of autotrophic/heterotrophic nitrifying and denitrifying microorganisms. Further analysis via a symbiotic relationship network demonstrated that unclassified&#95;Comamonadaceae and unclassified&#95;Xanthobacteraceae were the core nodes for maintaining the interaction between autotropic and heterotrophic nitrifying bacteria. Kyoto Encyclopedia of Genes and Genomes analysis showed that the electron transfer process primarily relied on ferredoxin and cytochromes under TCAL stress, and the abundance of functional enzymes involved in the process of nitrification was decreased, resulting in changes in electrical signal output. This work explored a visual signal sensor combined with electrochemistry and autotrophic/heterotrophic nitrification, which provided new insights into recognition and response mechanisms for microbial monitoring of toxic substances., (Copyright © 2022 Elsevier B.V. All rights reserved.)

Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.

Trichloroacetic acid (TCA), a toxic substance produced in the disinfection process of wastewater treatment plants, will accumulate in the receiving water. The detection of TCA in the water can achieve the purpose of early warning. However, currently there are few reports on microbial sensors used for TCA detection, and the characteristics of their microbial communities are still unclear. In this work, a toxicity monitoring microbial system (TMMS) with nitrifying biofilm as a sensing element and cathode oxygen reduction as a current signal was successfully constructed for TCA detection. The current and nitrification rate showed a linear relationship with low TCA concentration from 0 to 50 μg/L (R 2 current  = 0.9892, R 2 nitrification  = 0.9860), and high concentration range from 50 to 5000 μg/L (R 2 current  = 0.9883, R 2 nitrification  = 0.9721). High-throughput sequencing revealed that the TMMS was composed of autotrophic/heterotrophic nitrifying and denitrifying microorganisms. Further analysis via symbiotic relationship network demonstrated that Arenimonas and Hyphomicrobium were the core nodes for maintaining interaction between autotropic and heterotrophic nitrifying bacteria. Kyoto Encyclopedia of Genes and Genomes analysis showed that after adding TCA to TMMS, the carbon metabolism and the abundance of the tricarboxylic acid cycle pathway were reduced, and the activity of microorganisms was inhibited. TCA stress caused a low abundance of nitrifying and denitrifying functional enzymes, resulting in low oxygen consumption in the nitrification process, but more oxygen supply for cathode oxygen reduction. This work explored a novel sensor combined with electrochemistry and autotrophic/heterotrophic nitrification, which provided a new insight into the development of microbial monitoring of toxic substances., (Copyright © 2022 Elsevier Inc. All rights reserved.)

Real-time nitrite control in water is necessary for environmental safety and human health, and has triggered the research and development of novel detection methods. Previous studies have made great progress on enzyme-free and enzyme electrochemical sensors. However, enzyme-free sensors have low selectivity and a complex preparation process, and enzyme sensors have short lifetimes, and these issues need to be addressed. In this work, we proposed for the first time a highly specific and sensitive biofilm sensor based on nitrite-oxidizing bacteria (NOB) for the bio-electrochemical detection of nitrite in water. The mechanism of nitrite detection was attributed to the competition of oxygen between aerobic respiration of the NOB and the cathode oxygen reduction on the carbon felt electrode, resulting in a decrease in current. This decrease in current (ΔI) had a linear relationship with the nitrite concentration in the range of 0.1 to 1 mg L -1 and 1 to 10 mg L -1 , which was corresponding to the sensitivities of 48.62 and 2.24 μA mM -1 cm -2 , respectively. And the limit of detection (LOD) was calculated to be 0.033 mg L -1 (2.39 μM) with a signal-to-noise ratio of 3. Moreover, several common interfering ions had no effect on the nitrite detection owing to the functional microbial species (NOB) and weakly electrochemical behavior of electrode at the low potential of -0.1 V, showing high specificity for nitrite detection of biofilm sensor. Therefore, the actual nitrified wastewater was well detected by the biofilm sensor. In addition, allylthiourea (ATU) took good effect on the resistance of the influence of ammonia oxidizing bacteria (AOB) in the biofilm sensor, maintaining the high selectivity of biofilm sensor in case the biofilm sensor was fouled with AOB. The biofilm sensor in our work showed good selectivity, sensitivity and stability in long-term detection., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 Elsevier B.V. All rights reserved.)

A highly sensitive electrochemical sensor for detecting low concentrations of heavy metals (Cd 2+ , Ni 2+ , Pb 2+ and Cu 2+ ) based on Geobacter-dominated biofilms was developed. The biosensor showed a high sensitivity for the determination of Cd 2+ (109.7 μAμM -1 cm -2 ) and the determination of Pb 2+ (161.7 μAμM -1 cm -2 ). The performance of three fitting models for biosensor response to heavy metal toxicity was investigated based on the relationship between total coulomb yield and heavy metal concentration. The full-area model (Equation a) provided the best fit, and the response times tended to be the fastest based on the peak current model (Equation c). Recovery methods were proposed to ensure the electrical activity of the biofilm for long-term monitoring. 16S rRNA gene sequence analysis showed that the most dominant genus in the anodic biofilm was Geobacter (44.1%-45.8%), indicating a stable community structure after continuous toxicity shock for 22 days. The confocal laser scanning microscope (CLSM) further proved the restorable and reusability of the biosensor. Thanks to the thin and electrically active Geobacter-dominated biofilms, it could be a good alternative biosensor for groundwater analysis etc. The results of this study contribute to the development of a highly sensitive and accurate biosensor with long-term usage towards on-site monitoring of heavy metals at low concentrations, improving the test performance of the biosensor for practical application., (Copyright © 2022 Elsevier B.V. All rights reserved.)

Patients with malignant pleural mesothelioma (MPM) usually present with poor prognosis and short survival period, and there has been a lack of effective treatment options for a long time. Chemotherapy has limited improvement in the clinical outcome of advanced patients (the median survival is less than one year), and it is difficult to find suitable targets for targeted therapy. Recent in-depth research on immunotherapy has changed the treatment pattern of MPM. Especially, the dual immunotherapy regimen significantly improved the survival outcome of patients across subgroups and prolonged the survival time of MPM patients. Therefore, it has been approved for unresectable MPM as first-line treatment for patients. The exploration of other mono or combo immunotherapy regimens in the first and second-line settings of MPM is also underway. How to identify the best beneficial population of each regimen through predictive biomarkers is also a hot spot for researchers. This article will focus on the most up-to-date progress of MPM epidemiology, histological characteristics, pathogenesis, treatment patterns and the advances of immunotherapy in the disease.
.

As an organic sulfur pollutant generated in blast furnace gas, carbonyl sulfide (COS) has attracted more attention due to its negative effects on the environment and economy. The TiO 2 -Al 2 O 3 composite metal oxide (Ti 0.5 Al) with uniformly dispersed particles was prepared by the co-precipitation method. And on this basis, a series of Na/K-doped catalysts were prepared separately. The activity evaluation results showed that the introduction of Na/K significantly improved the low-temperature COS hydrolysis activity, which exhibited a COS conversion of 98% and H 2 S yield of 95% at 75 °C with 24,000 h -1 . And K showed a better promoting effect than Na. Brunauer-Emmett-Teller (BET) results revealed the increased mesopore proportion of Na/K-modified catalysts. X-ray diffraction (XRD) and scanning electron microscopy (SEM) showed that Na and K formed prismatic and nanorod-like structures, respectively. More weakly basic sites with enhanced intensity and decreased O ads /O lat content contributed to the excellent catalytic activity, as certified by the results of CO 2 temperature-programmed desorption (CO 2 -TPD) and X-ray photoelectron spectroscopy (XPS). It was also proposed that the decrease of weakly basic sites ultimately deactivated catalyst activity. In situ diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) showed that the introduction of Na/K enhanced the dissociation of H 2 O, and the generated abundant hydroxyl groups promoted the adsorption of COS and formed surface transition species, such as HSCO 2 - and HCO 3 - ., Competing Interests: The authors declare no competing financial interest., (© 2022 The Authors. Published by American Chemical Society.)

The mold infection of wood reduces the quality of its surface and potentially endangers human health. One category of the most popular mold inhibitors on the market is water-soluble fungicides. However, easy leaching due to ionic forms is a problem, which reduces the effectiveness of their antimicrobial action, as well as causing environmental pollution. Interestingly, nanometer-sized sterilizing agents present strong permeability and highly fungicidal behavior, and they are not easily leached, due to the unique nanoscale effect, and they have become alternative candidates as marketable anti-mold agents for wood protection. In this study, we first designed and explored a nanoscale alloy (nano silver-copper alloy, nano-AgCu) to treat wood surfaces for mold growth resistance. The results showed that three molds, i.e., Aspergillus niger , Penicillium citrinum and Trichoderma viride , mainly grew on the surface of wood within a depth of 100 μm; and that the nano-AgCu alloy with a particle size of ~15 nm presented improved retention and anti-mold efficiency at a nanomaterial concentration on the wood surface. Its leaching rate increased non-linearly with the increase in nano-AgCu retention and then it showed a gradually decreasing trend. When the concentration reached 1000 mg/L, the nano-AgCu alloy uniformly distributed on the wood surface in a monodispersed state and exhibited a lower retention of 0.342 g/m 2 , with an anti-mold efficiency of more than 75% and a leaching rate of only 7.678%. Such results positioned 1000 mg/L as the toxic threshold concentration of nano-AgCu against the three molds. This study can provide a scientific basis for the analysis of the anti-mold mechanisms of nano-AgCu alloy on wood surfaces and guide the application of nano-metal alloy materials in the field of wood antimicrobials.

Aerobic biocathodes are effective construct for the simultaneous nitrification and denitrification, but the disturbance of cathodic oxygen reduction on ammonia oxidation and denitrification remains unclear. In this study, we revealed the oxygen reduction peak at -0.4 V (versus silver/silver chloride) by cyclic voltammetry analysis at a cathode without a biofilm. The reduction peak, however, showed a right shift from -0.4 to -0.3 V for the biocathode, indicating that the aerobic biocathode could simultaneously perform traditional nitrification and cathode oxygen reduction. Therefore, different electrode potentials ranging from -0.5 to -0.1 V were designed for regulating the ammonia oxidation rate, and the results showed that the highest oxidation rate reached 3.08 mg/h/L at a potential of -0.2 V under a low-aeration rate of 5 mL/min. High-throughput sequencing showed that Nitrosomonas and Rhodococcus were the dominant nitrogen removal genera in the biocathode, and the abundance of Devosia was related to the interactions between the aeration rate and the electrode potential. Furthermore, the amoC and hao genes responded to aeration and electrode potential regulation, and -0.2 V was more suitable for promoting the denitrification process under low-aeration conditions. Therefore, these findings provided new insights on cathodic potential control for ammonia oxidation and nitrogen removal as well as for the regulation of microbial communities., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2021 Elsevier B.V. All rights reserved.)

Organic acids are important contributors to the acidity of atmospheric precipitation, but their existence in the Chinese atmosphere is largely unclear. In this study, twelve atmospheric gaseous organic acids, including C 1 -C 9 alkanoic acids, methacrylic acid, pyruvic acid, and benzoic acid, were observed in the suburb of Wangdu, Hebei Province, a typical rural site in the northern China plain from 16 th December, 2018 to 22 nd January, 2019, using a Vocus® Proton-Transfer-Reaction time-of-flight mass spectrometer (Vocus PTR-ToF). The quantification of C 2 -C 4 alkanoic acids by the Vocus PTR-ToF was calibrated according to the titration of a NaOH solution by C 2 -C 4 alkanoic acids from home-made permeation sources, and the other organic acids except for formic acid were quantified based on the k cap -sensitivity linearity in the Vocus PTR-ToF, whereas formic acid was not quantified because our instrument setting led to a significant underestimation in its concentration. The average total concentration of eleven gaseous organic acids was 6.96 ± 5.20 ppbv (parts per billion by volume). The average concentration of acetic acid was the highest (3.86 ± 3.00 ppbv), followed by propanoic acid, butyric acid, and methacrylic acid. Domestic straw burning was likely the dominant source of the observed gaseous organic acids according to the good correlations between acetonitrile and organic acids and between particulate K + and organic acids, and traffic emissions could also have contributed. During episodes with continuously high concentrations of organic acids, short-distance transport dominated in Wangdu according to the backward trajectory analysis. Baoding, Shijiazhuang, and Hengshui areas were the main source areas based on potential source contribution function and concentration weighing track analysis., (Copyright © 2021. Published by Elsevier B.V.)

Purpose: The issue of employee engagement has increasingly become a focus of concern in public management practice. Based on the theory of purposeful work behavior, integrative theory of employee engagement and Pratt and Ashforth's typology of work meaningfulness, this study proposes and examines the mediating effects of two types of meaningfulness between transformational leadership and work engagement and the moderating effects of transformational leadership on the relationship between two types of meaningfulness and work engagement., Patients and Methods: By adopting a multilevel cross-sectional design, this study examines assumed mediation and moderation effects. The data collection was conducted anonymously by means of an online survey. A total of 261 local police officers from 32 police stations were recruited in professional training programs as a sample., Results: The analysis reveals that both meaningfulness in work and meaningfulness at work positively mediate the relationship between transformational leadership and work engagement. Transformational leadership moderates the relationship between meaningfulness at work and work engagement rather than the relationship between meaningfulness in work and work engagement. There are no other significant effects of sex, age or length of service., Conclusion: Work meaningfulness transmits and combines the effect of transformational leadership to impact work engagement. These findings not only confirm the critical role of work meaningfulness proposed by the theoretical frameworks of the theory of purposeful work behavior, integrative theory of employee engagement and Pratt and Ashforth's typology of work meaningfulness, but also further extend and clarify the role of and difference in two substructures of work meaningfulness (ie, work meaningfulness in work and at work) in the context of the linkage between transformational leadership and work engagement., Competing Interests: The authors report no conflicts of interest in this work., (© 2022 Meng et al.)

Increasing global cement and steel consumption means that a significant amount of greenhouse gases and metallurgical wastes are discharged every year. Using metallurgical waste as supplementary cementitious materials (SCMs) shows promise as a strategy for reducing greenhouse gas emissions by reducing cement production. This strategy also contributes to the utilization and management of waste resources. Controlled low-strength materials (CLSMs) are a type of backfill material consisting of industrial by-products that do not meet specification requirements. The preparation of CLSMs using metallurgical waste slag as the auxiliary cementing material instead of cement itself is a key feature of the sustainable development of the construction industry. Therefore, this paper reviews the recent research progress on the use of metallurgical waste residues (including blast furnace slag, steel slag, red mud, and copper slag) as SCMs to partially replace cement, as well as the use of alkali-activated metallurgical waste residues as cementitious materials to completely replace cement for the production of CLSMs. The general background information, mechanical features, and properties of pozzolanic metallurgical slag are introduced, and the relationship and mechanism of metallurgical slag on the performance and mechanical properties of CLSMs are analyzed. The analysis and observations in this article offer a new resource for SCM development, describe a basis for using metallurgical waste slag as a cementitious material for CLSM preparation, and offer a strategy for reducing the environmental problems associated with the treatment of metallurgical waste.

Air-cathode microbial fuel cells (ACMFCs) can extract available electrons from the low C/N ratio wastewater (LCNW) for pollutant degradation and power generation. However, the multiple effects of operating parameters and their relationship between the performances and parameters are still lacking. In this study, several ACMFCs for simultaneous nitritation/denitritation (SND) and energy recovery were constructed and evaluated in terms of chemical oxygen demand (COD), NH 4 + -N, C/N ratio, phosphate buffer solution (PBS), and external resistance (R ext ), and several derived parameters (e.g., organic loading rate (OLR), nitrogen loading rate (NLR)). Results indicated that ACMFCs could be used to treat LCNW successfully with high pollutant removal rates and sustainable current generation. Maximum removal efficiencies of 94% COD, 92% NH 4 + -N, and 92% total nitrogen (TN) were achieved. A maximum power density of 1400 mW m -2 and columbic efficiency of 69.2% were also obtained at a low C/N ratio of 1.7-2.6. Low C/N ratios promoted SND by balancing nitritation and denitritation. The microbial community and their predicated function results showed considerable nitrifiers and denitrificans were enriched in the ACMFCs, contributing to SND and power recovery. Further analyses showed that the NH 4 + -N could inhibit SND, but PBS and R ext had no obvious effects on this outcome. Co-occurrence network analysis demonstrated that power is positively correlated with COD and R ext ; strong correlations between organic removal and COD, and between nitrogen removal and ammonia, conductivity, and C/N ratio were also noted. Overall, the appropriate control of such parameters is necessary to achieve efficient SND in ACMFCs for LCNW treatment., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2021. Published by Elsevier B.V.)

Atmospheric gas-to-particle conversion is a crucial or even dominant contributor to haze formation in Chinese megacities in terms of aerosol number, surface area and mass. Based on our comprehensive observations in Beijing during 15 January 2018-31 March 2019, we are able to show that 80-90% of the aerosol mass (PM 2.5 ) was formed via atmospheric reactions during the haze days and over 65% of the number concentration of haze particles resulted from new particle formation (NPF). Furthermore, the haze formation was faster when the subsequent growth of newly formed particles was enhanced. Our findings suggest that in practice almost all present-day haze episodes originate from NPF, mainly since the direct emission of primary particles in Beijing has considerably decreased during recent years. We also show that reducing the subsequent growth rate of freshly formed particles by a factor of 3-5 would delay the buildup of haze episodes by 1-3 days. Actually, this delay would decrease the length of each haze episode, so that the number of annual haze days could be approximately halved. Such improvement in air quality can be achieved with targeted reduction of gas-phase precursors for NPF, mainly dimethyl amine and ammonia, and further reductions of SO 2 emissions. Furthermore, reduction of anthropogenic organic and inorganic precursor emissions would slow down the growth rate of newly-formed particles and consequently reduce the haze formation.

Al 17 clusters exhibit apparent changes in curvature, which resemble macroscopic metal tips. Here, we show, using the density functional theory method, how surface charges of Al 17 q (q = -2  to +3) ions affect the adsorption and dissociation behavior of HCl molecules. Geometries, adsorption energies, vibrational frequencies, Mulliken population analysis and transition states of (Al 17 HCl) q (q = -2  to +3) adsorption complexes were studied. The results revealed that HCl molecules tend to locate on tip sites of the Al 17 q (q = -2  to  +3) ions. Anionic adsorption complexes are prone to H affinity adsorption, whereas cationic adsorption complexes favor Cl-affinity adsorptions. These adsorption behaviors look quite like macroscopic tip effects. H-Cl bonds of the adsorption complexes weaken with an increase in either positive or negative charge. Dissociation barriers of the H-Cl bonds exhibit binding energies that are 2 orders of magnitude smaller than those of an isolated HCl molecule. Considering adsorption energies and dissociation barriers comprehensively, HCl molecules should dissociate spontaneously for all the models considered. Generally, the more negative charges the clusters carry, the more energy the reaction will release. Graphical abstract Dissociation barriers of the H-Cl bonds in Al 17 q (q = -2 - +3) cluster ions exhibit energy barriers ~2 orders of magnitude smaller than isolated HCI molecules.

Millimeter-wave (mmWave) communication is one of the key enabling technologies for fifth generation (5G) mobile networks. In this paper, we study the problem of secure communication in a mmWave wiretap network, where directional beamforming and link blockages are taken into account. For the secure transmission in the presence of spatially random eavesdroppers, an adaptive transmission scheme is adopted, for which sector secrecy guard zone and artificial noise (AN) are employed to enhance secrecy performance. When there exists no eavesdroppers within the sector secrecy guard zone, the transmitter only transmits information-bearing signal, and, conversely, AN along with information-bearing signal are transmitted. The closed-form expressions for secrecy outage probability (SOP), connection outage probability (COP) and secrecy throughput are derived under stochastic geometry. Then, we evaluate the effect of the sector secrecy guard zone and AN on the secrecy performance. Our results reveal that the application of the sector secrecy guard zone and AN can significantly improve the security of the system, and blockages also can be utilized to improve secrecy performance. An easy choice of transmit power and power allocation factor is provided for achieving higher secrecy throughput. Furthermore, increasing the density of eavesdroppers not always deteriorates the secrecy performance due to the use of the sector secrecy guard zone and AN.

Insect societies have evolved a series of disease defenses against pathogens, including social sanitary behavior and individual innate immunity. However, whether sanitary behavior can affect individual innate immunity remains unknown. Here, we exposed the termite Reticulitermes chinensis Snyder to the entomopathogenic fungus Metarhizium anisopliae (Metchnikoff) Sorokin(Ascomycota: Hypocreales), and then measured their allogrooming behavior, conidia load, infection mortality, antifungal activity and immune gene expressions . Our results showed that most of the fungal conidia were fast removed from the cuticles of the grouped termites by intensive allogrooming behavior, resulting in low mortality. The antifungal activity and immune gene expressions (termicin and transferrin) in grouped exposed termites were significantly lower than those in single exposed termite but not significantly different from those in unexposed treatments. These results suggest that allogrooming behavior can fast remove fungal conidia from termite cuticles and then decrease their physiological investment in individual innate immunity.

According to the application characteristics of the K-Rb- 21 Ne comagnetometer, a space-stable navigation mechanization is designed and the requirements of the comagnetometer prototype are presented. By analysing the error propagation rule of the space-stable Inertial Navigation System (INS), the three biases, the scale factor of the z -axis, and the misalignment of the x - and y -axis non-orthogonal with the z -axis, are confirmed to be the main error source. A numerical simulation of the mathematical model for each single error verified the theoretical analysis result of the system's error propagation rule. Thus, numerical simulation based on the semi-physical data result proves the feasibility of the navigation scheme proposed in this paper., Competing Interests: The authors declare no conflict of interest.

One-dimensional (1D) gold nanostructures have been extensively studied due to their potential applications in nanoelectronic devices. Using first-principles calculations, composites consisting of a well-defined linear Au n (n = 2-4) chain encapsulated in a (9,0) single-walled carbon nanotube (SWCNT) were studied. The translational energy barrier of a single Au atom in a (9,0) SWCNT was found to be 0.03 eV. This low barrier guaranteed the formation of Au n @ (9,0) SWCNT (n = 1-4) composites. Bond lengths, differential charge densities, and electronic band structures of the composites were studied. The average Au-Au bond lengths in the composites were found to be almost the same as those in the corresponding free-standing linear Au n . The average bond length increased as the number of Au atoms increased. Charge transfer in all of these composites was slight, although a few valence electrons were transferred from the (9,0) SWCNT and the Au chains to intercalations. The conductivities of the encapsulated linear Au n (n = 2-4) chains were enhanced to some extent by encapsulating them in the SWCNT.

An inertial navigation system (INS) has been widely used in challenging GPS environments. With the rapid development of modern physics, an atomic gyroscope will come into use in the near future with a predicted accuracy of 5 × 10(-6)°/h or better. However, existing calibration methods and devices can not satisfy the accuracy requirements of future ultra-high accuracy inertial sensors. In this paper, an improved calibration model is established by introducing gyro g-sensitivity errors, accelerometer cross-coupling errors and lever arm errors. A systematic calibration method is proposed based on a 51-state Kalman filter and smoother. Simulation results show that the proposed calibration method can realize the estimation of all the parameters using a common dual-axis turntable. Laboratory and sailing tests prove that the position accuracy in a five-day inertial navigation can be improved about 8% by the proposed calibration method. The accuracy can be improved at least 20% when the position accuracy of the atomic gyro INS can reach a level of 0.1 nautical miles/5 d. Compared with the existing calibration methods, the proposed method, with more error sources and high order small error parameters calibrated for ultra-high accuracy inertial measurement units (IMUs) using common turntables, has a great application potential in future atomic gyro INSs.

Keep composting matrix in continuous collision and friction under a relatively high-temperature can significantly accelerate the progress of composting. A bioreactor was designed according to the novel process. Using this technology, organic fertilizer could be produced within 96h. The electric conductivity (EC) and pH value reached to a stable value of 2.35mS/cm and 7.7 after 96h of fermentation. The total carbon/total nitrogen (TC/TN) and dissolved carbon/dissolved nitrogen (DC/DN) ratio was decrease from 27.3 and 36.2 to 17.4 and 7.6 respectively. In contrast, it needed 24days to achieve the similar result in traditional static composting (TSC). Compost particles with different size were analyzed to explore the rapid degradation mechanism of food waste. The evidence of anaerobic fermentation was firstly discovered in aerobic composting., (Copyright © 2015 Elsevier Ltd. All rights reserved.)

The linear and nonlinear optical susceptibilities for LiInS2 and LiInSe2 are studied by density functional theory using total energy pseudo potential plane wave method. The structure, band structure, density of states, and frequency-dependent complex dielectric function ε(ω) are calculated. The direct band gap of LiInSe2 is smaller than that of LiInS2. The birefringence Δn (0) is negative for LiInS2 and LiInSe2. The imaginary and real parts of the second-order susceptibility are evaluated. It is found that χ 333 ((2)) (ω) is the dominant component which shows the largest total Re χ ijk ((2)) (0) values. The contribution from the intra-band and inter-band to the second harmonic generation is increased when S is replaced by Se. It is found that a compound with smaller energy band gap has larger values of χ 333(0) which would lead to a possible route to further enhancement of Im χ 333(ω) by band gap engineering.

A stochastic delay logistic system with Markov switching and impulsive toxicant input in a polluted environment is proposed and studied. Some sufficient criteria for extinction, non-persistence in the mean and weak persistence of the solutions are established., (Copyright © 2013 Elsevier Ltd. All rights reserved.)

Equilibrium geometries of AlnTi (n = 2-24) clusters were studied using density-functional theory with generalized gradient approximation. The resulting geometries showed that the titanium atom remains on the surface of clusters for n < 20 but is endohedrally doped from n = 20. This structural transition confirms the previous experiment results obtained by studying their abilities for argon physisorption (Lang, S. M.; Claes, P.; Neukermans, S.; Janssens, E. J. Am. Soc. Mass Spectrom.2011, 22, 1508). The average bond lengths, coordination numbers, relative stabilities, electronic properties, and other relevant properties were discussed. It was found that the doped titanium atoms strengthen the stabilities of the pure aluminum clusters. The coordination numbers of titanium atoms along with the average Al-Ti bond lengths undergo dramatic increases during the structural transition. The intra-atomic hybridization exists in both Ti and Al atoms, and charge transfer from Al atoms to Ti atom were found in these complexes, which should reflect the strength of Al-Ti interactions. Electronic structure analysis based on the partial density of states reveals stronger Al-Ti interactions for the endohedrally doped structures.

Geometries and dissociation energies of water molecules on Al(n) (n = 2-25) clusters were investigated using density functional theory with all electron relativistic spin-polarized calculations under the generalized gradient approximation. An extensive structure search was performed to identify the low-energy conformations of Al(n)H(2)O complexes for each size. Optimal adsorption sites were assigned for low-energy isomers of the clusters. Size and site specific dependences were studied for the Al(n)H(2)O complexes in stabilities, geometries, adsorption energies, dissociation energies, Al-O bond lengths, and other characteristic quantities. The stabilities and geometries revealed that H atom in H(2)O is not inclined to bond with Al atoms. The most stable Al(n)H(2)O configurations for each size tend to correspond to the most stable bare Al(n) cluster except of Al(6) and Al(24) clusters. The HO bond lengths increase generally 0.01 Å with respect to the isolated H(2)O in all of the adsorption complexes. The dissociation energy of an isolated H(2)O into HO and H was 5.39 eV, which decreased about two-thirds to the energy range of 0.83-2.12 eV with the help of Al(n) clusters. In spite of the fluctuations, the dissociation energies of Al(n)H(2)O complexes rise with the size increasing as a whole. In addition, we also found that the bare Al(n) clusters with high vertical ionization potentials usually have high dissociation energies of H(2)O in the corresponding adsorption models. The energetically preferred spin-multiplicity of all the odd-n Al(n)H(2)O complexes is doublet, and it is singlet for all the even-n complexes with exception of Al(2)H(2)O which is triplet.

Synuclein gamma (SNCG), previously identified as a breast cancer-specific gene, is highly expressed in malignant cancer cells but not in normal epithelium. The molecular targets of SNCG during breast cancer progression have not been fully identified. Here we analyzed the effect of SNCG on stimulation of membrane-initiated estrogen signaling. While SNCG expression enhanced estrogen-induced activation of ERK1/2 and mammalian target of rapamycin, knockdown of endogenous SNCG decreased membrane-initiated estrogen signaling. SNCG functions as a molecular chaperone protein for estrogen receptor (ER)-alpha36, a membrane-based variant of ER-alpha. SNCG bound to ER-alpha36 in the presence and absence of functional molecular chaperone heat shock protein 90. Disruption of heat shock protein 90 with 17-AAG significantly reduced ER-alpha36 expression and membrane-initiated estrogen signaling. However, expression of SNCG prevented ER-alpha36 degradation and completely recovered 17-AAG-mediated down-regulation of estrogen signaling. The function of SNCG in ER-alpha36-mediated estrogen signaling is consistent with its ability to stimulate cell growth in response to estrogen. Expression of SNCG also renders tamoxifen resistance, which is consistent with the clinical observation on the association of ER-alpha36 expression and tamoxifen resistance. The present study indicates that ER-alpha36 is a new member of the ER-alpha family that mediates membrane-initiated estrogen signaling and that SNCG can replace the function of heat shock protein 90, chaperone ER-alpha36 activity, stimulate ligand-dependent cell growth, and render tamoxifen resistance.

Purpose: Lignans such as secoisolariciresinol diglucoside in flaxseed, are metabolizes to bioactive mammalian lignans of END and ENL. Because mammalian lignans have chemical structural similarity to the natural estrogen, they are thought to behave like selective estrogen receptor modulators and therefore have anticancer effect against hormone-related cancers. We isolated a series of lignan compounds, named as Vitexins, from the seed of Chinese herb Vitex Negundo., Experimental Design: We purified several Vitexin lignan compounds. Cytotoxic and antitumor effects were analyzed in cancer cells and in tumor xenograft models. In vivo metabolism of Vitexins was determined in rat., Results: Contrasts to the classic lignans, Vitexins were not metabolized to END and ENL. A mixture of Vitexins EVn-50 and purified Vitexin compound 6-hydroxy-4-(4-hydroxy-3-methoxyphenyl)-3-hydroxymethyl-7-methoxy-3, 4-dihydro-2-naphthaldehyde have cytotoxic effect on breast, prostate, and ovarian cancer cells and induces apoptosis with cleavage in poly ADP ribose polymerase protein, up-regulation of Bax, and down-regulation of Bcl-2. This induction of apoptosis seems to be mediated by activation of caspases because inhibition of caspases activity significantly reduced induced apoptosis. We showed a broad antitumor activity of EVn-50 on seven tumor xenograft models including breast, prostate, liver, and cervical cancers. Consistent with in vitro data, EVn-50 treatment induced apoptosis, down-regulated of Bcl-2, and up-regulated Bax in tumor xenografts., Conclusion: Vitexin is a class of nature lignan compounds, whose action and anticancer effect is mediated by the mechanisms different from the classic lignans. Vitexin-induced antitumor effect and cytotoxic activity is exerted through proapoptotic process, which is mediated by a decreased Bcl-2/Bax ratio and activation of caspases.

The protective effect of early pregnancy against breast cancer can be attributed to the transition from undifferentiated cells in the nulliparous to the differentiated mature cells during pregnancy. Considerable evidence suggests strongly that the n-3 polyunsaturated fatty acid (PUFA) content of adipose breast tissue is inversely associated with an increased risk of breast cancer. Here, we report that there was a decrease in the n-6/n-3 PUFA ratio and a significant increase in concentration of n-3 PUFA docosapentaenoic acid and eicosapentaenoic acid in the pregnant gland. The functional role of n-3 PUFAs on differentiation was supported by the studies in the fat-1 transgenic mouse, which converts endogenous n-6 to n-3 PUFAs. Alternation of the n-6/n-3 ratio in favor of n-3 PUFA, and particularly docosapentaenoic acid, in the mammary gland of fat-1 mouse resulted in development of lobulo-alveolar-like structure and milk protein beta-casein expression, mimicking the differentiated state of the pregnant gland. Docosapentaenoic acid and eicosapentaenoic acid activated the Jak2/Stat5 signaling pathway and induced a functional differentiation with production of beta-casein. Expression of brain type fatty acid binding protein brain type fatty acid binding protein in virgin transgenic mice also resulted in a reduced ratio of n-6/n-3 PUFA, a robust increase in docosapentaenoic acid accumulation, and mammary differentiation. These data indicate a role of mammary derived growth inhibitor related gene for preferential accumulation of n-3 docosapentaenoic acid and eicosapentaenoic acid in the differentiated gland during pregnancy. Thus, alternation of n-6/n-3 fatty acid compositional ratio in favor of n-3 PUFA, and particularly docosapentaenoic acid and eicosapentaenoic acid, is one of the underlying mechanisms of pregnancy-induced mammary differentiation.

Synucleins are emerging as central players in the formation of pathologically insoluble deposits characteristic of neurodegenerative diseases. gamma synuclein (SNCG), previously identified as a breast cancer-specific gene (BCSG1), is also highly associated with breast or ovarian cancer progression. However, the molecular targets of SNCG aberrant expression in breast cancer have not been identified. Here, we demonstrated a chaperone activity of SNCG in the heat-shock protein (Hsp)-based multiprotein chaperone complex for stimulation of estrogen receptor (ER)-alpha signaling. As an ER-alpha-associated chaperone, SNCG participated in Hsp-ER-alpha complex, enhanced the high-affinity ligand-binding capacity of ER-alpha, and stimulated ligand-dependent activation of ER-alpha. The SNCG-mediated stimulation of ER-alpha transcriptional activity is consistent with its stimulation of mammary tumorigenesis in response to estrogen. These data indicate that SNCG is a new chaperone protein in the Hsp-based multiprotein chaperone complex for stimulation of ligand-dependent ER-alpha signaling and thus stimulates hormone-responsive mammary tumorigenesis.

A mammary-derived growth inhibitor-related gene (MRG) was previously identified and characterized. MRG induces differentiation of mammary epithelial cells in vitro and its expression is associated with mammary differentiation. To further define the role of MRG on mammary gland differentiation, a MRG transgenic mice model under the control of mouse mammary tumor virus promoter was established and the effect of MRG on mammary gland differentiation was investigated at histological and molecular levels. Expression of endogenous mouse MRG gene was significantly increased from the non-differentiated gland of control virgin mice to the functionally differentiated gland of pregnant control mice. Whole mount analyses demonstrated that ductal development was not affected by MRG transgene expression. While there was no lobuloalveolar structure in control virgin mice, expression of MRG transgene in the mammary gland resulted in the development of lobuloalveolar-like structure, which mimics the gland from early pregnancy. Consistent with the morphological change, expression of MRG also increased milk protein beta-casein expression in the gland. To study the mechanism of MRG-induced mammary differentiation, we investigated the Stat5 activation in the glands from the transgenic mouse versus virgin control mouse. While activated Stat5 was expressed at the minimal level in the non-differentiated control virgin gland, a significant Stat5 phosphorylation was observed in the virgin transgenic gland. Our data indicate that MRG is a mediator of the differentiating effects of pregnancy on breast epithelium, and overexpression of MRG in young nulliparous mice can induce differentiation.

Synucleins are emerging as central player in the fundamental neural processes and in the formation of pathologically insoluble deposits characteristic of Alzheimer's disease and Parkinson's disease. However, gamma Synuclein (SNCG) is also highly associated with breast cancer and ovarian cancer progression. Whereas most studies of this group of proteins have been directed to the elucidation of their role in the formation of depositions in brain tissue, the normal cellular function of this highly conserved synuclein family remains largely unknown. A notable finding in this study is that SNCG, identified previously as a breast cancer-specific gene 1, strongly stimulated the ligand-dependent transcriptional activity of estrogen receptor-alpha (ER-alpha) in breast cancer cells. Augmentation of SNCG expression stimulated transcriptional activity of ER-alpha, whereas compromising endogenous SNCG expression suppressed ER-alpha signaling. The SNCG-stimulated ER-alpha signaling was demonstrated in three different cell systems including ER-alpha-positive and SNCG-negative MCF-7 cells, ER-alpha-positive and SNCG-positive T47D cells, and SNCG-negative and ER-alpha-negative MDA-MB-435 cells. The SNCG-mediated stimulation of ER-alpha transcriptional activity is consistent with its stimulation of the ligand-dependent cell growth. Whereas overexpression of SNCG stimulated the ligand-dependent cell proliferation, suppression of endogenous SNCG expression significantly inhibited cell growth in response to estrogen. The stimulatory effect of SNCG on ERalpha-regulated gene expression and cell growth can be effectively inhibited by antiestrogens. These data indicate that SNCG is required for efficient ER-alpha signaling and, thus, stimulated hormone-responsive mammary tumors.