Search

Rhizobium inoculation has been widely applied to alleviate heavy metal (HM) stress in legumes grown in contaminated soils, but it has generated inconsistent results with regard to HM accumulation in plant tissues. Here, we conducted a meta-analysis to assess the performance of Rhizobium inoculation for regulating HM in legumes and reveal the general influencing factors and processes. The meta-analysis showed that Rhizobium inoculation in legumes primarily increased the total HM uptake by stimulating plant biomass growth rather than HM phytoavailability. Inoculation had no significant effect on the average shoot HM concentration (p > 0.05); however, it significantly increased root HM uptake by 61 % and root HM concentration by 7 % (p < 0.05), indicating safe agricultural production while facilitating HM phytostabilisation. Inoculation decreased shoot HM concentrations and increased root HM uptake in Vicia, Medicago and Glycine, whereas it increased shoot HM concentrations in Sulla, Cicer and Vigna. The effects of inoculation on shoot biomass were suppressed by nitrogen fertiliser and native microorganisms, and the effect on shoot HM concentration was enhanced by high soil pH, organic matter content, and phosphorous content. Inoculation-boosted shoot nutrient concentration was positively correlated with increased shoot biomass, whereas the changes in pH and organic matter content were insufficient to significantly affect accumulation outcomes. Nitrogen content changes in the soil were positively correlated with changes in root HM concentration and uptake, whereas nitrogen translocation changes in the tissues were positively correlated with changes in HM translocation. Phosphorus solubilisation could improve HM phytoavailability at the expense of slight biomass promotion. These results suggest that the diverse growth-promoting characteristics of Rhizobia influence the trade-off between biomass-HM phytoavailability and HM translocation, impacting HM accumulation outcomes. Our findings can assist in optimising the utilisation of legume-Rhizobium systems in HM-contaminated soils., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Infections of hepatotropic viruses cause a wide array of liver diseases including acute hepatitis, chronic hepatitis and the consequently developed cirrhosis and hepatocellular carcinoma (HCC). Among the five classical hepatotropic viruses, hepatitis B virus (HBV) and hepatitis C virus (HCV) usually infect human persistently and cause chronic hepatitis, leading to major troubles to humanity. Previous studies have revealed that several types of inflammasomes are involved in the infections of HBV and HCV. Here, we summarize the current knowledge about their roles in hepatitis B and C. NLRP3 inflammasome can be activated and regulated by HBV and HCV. It is found to exert antiviral function or mediates inflammatory response in viral infections depending on different experimental models. Besides NLRP3 inflammasome, IFI16 and AIM2 inflammasomes participate in the pathological process of hepatitis B, and NALP3 inflammasome may sense HCV infection in hepatocytes. The inflammasomes affect the pathological process of viral hepatitis through its downstream secretion of inflammatory cytokines interleukin-1β (IL-1β) and IL-18 or induction of pyroptosis resulting from cleaved gasdermin D (GSDMD). However, the roles of inflammasomes in different stages of viral infection remains mainly unclear. More proper experimental models of viral hepatitis should be developed for specific studies in future, so that we can understand more about the complexity of inflammasome regulation and multifunction of inflammasomes and their downstream effectors during HBV and HCV infections., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Wan, Yang, Cheng, Zhang, Yue, Li, Liu, Yi, Jia, Liu, Xing, Sun and Li.)

After more than five decades, Moore's Law for transistors is approaching the end of the international technology roadmap of semiconductors (ITRS). The fate of complementary metal oxide semiconductor (CMOS) architecture has become increasingly unknown. In this era, 3D transistors in the form of gate-all-around (GAA) transistors are being considered as an excellent solution to scaling down beyond the 5 nm technology node, which solves the difficulties of carrier transport in the channel region which are mainly rooted in short channel effects (SCEs). In parallel to Moore, during the last two decades, transistors with a fully depleted SOI (FDSOI) design have also been processed for low-power electronics. Among all the possible designs, there are also tunneling field-effect transistors (TFETs), which offer very low power consumption and decent electrical characteristics. This review article presents new transistor designs, along with the integration of electronics and photonics, simulation methods, and continuation of CMOS process technology to the 5 nm technology node and beyond. The content highlights the innovative methods, challenges, and difficulties in device processing and design, as well as how to apply suitable metrology techniques as a tool to find out the imperfections and lattice distortions, strain status, and composition in the device structures.

Lactate dehydrogenase A (LDHA), a critical enzyme involved in glycolysis, is broadly involved multiple biological functions in human cancers. It is reported that LDHA can impact tumor immune surveillance and induce the transformation of tumor-associated macrophages, highlighting its unnoticed function of LDHA in immune system. However, in human cancers, the role of LDHA in prognosis and immunotherapy hasn't been investigated. In this study, we analyzed the expression pattern and prognostic value of LDHA in pan-cancer and explored its association between tumor microenvironment (TME), immune infiltration subtype, stemness scores, tumor mutation burden (TMB), and immunotherapy resistance. We found that LDHA expression is tumor heterogeneous and that its high expression is associated with poor prognosis in multiple human cancers. In addition, LDHA expression was positively correlated with the presence of mononuclear/macrophage cells, and also promoted the infiltration of a range of immune cells. Genomic alteration of LDHA was common in different types of cancer, while with prognostic value in pan-cancers. Pan-cancer analysis revealed that the significant correlations existed between LDHA expression and tumor microenvironment (including stromal cells and immune cells) as well as stemness scores (DNAss and RNAss) across cancer types. Drug sensitivity analysis also revealed that LDHA was able to predict response to chemotherapy and immunotherapy. Furthermore, it was confirmed that knockdown of LDHA reduced proliferation and migration ability of lung cancer cells. Taken together, LDHA could serve as a prognostic biomarker and a potential immunotherapy marker.

Grape ( Vitis vinifera ) is regarded as one of the most economically important fruit crops throughout the world and is widely cultivated in China. In March 2023, peduncle rot symptoms were observed on ripe grape (cv. Kyoho) of Guangxi Academy of Agricultural Sciences in Nanning, Guangxi Province (20°54' to 26°24' N, 104°26' to 112°04' E), causing severe shrink of infected grapes with incidence of 20 to 40%. Initially, a small portion of the grape peduncles turned from light brown to darker brown and gradually spread to the entire bunch of grape peduncles. Then the peduncles gradually dried up and became dark brown, resulting in necrosis and shedding of the fruits. Symptomatic peduncles were cut into small pieces (approximately 3 mm long), surface disinfected with 75% alcohol for 10 s, 1% NaOCl for 2 min followed by three washes in sterile distilled water and separately transferred to potato dextrose agar (PDA) plates. Forty-six Fusarium isolates were obtained from the seventy-five tissue pieces after 5 days of incubation at 25°C on PDA (average isolation frequency 61%). Based on the morphology, a representative isolate of Fusarium was selected for each of the three samples. Single spore isolates (PT1-1, PT3-1, and PT3-2) were selected for further study. The colonies produced abundant whitish to yellowish aerial mycelium on PDA after 7 days incubation at 25°C in the dark. Macroconidia cultured on carnation leaf agar (CLA) for 7 days were falcate, multiseptate, with a curved apical cell and foot-shaped basal cell, mostly 1-3-septate, measuring 21.3 ± 0.5 μm × 4.8 ± 0.1 μm, 24.3 ± 0.5 μm × 4.5 ± 0.1 μm, 21.9 ± 0.3 μm × 4.5 ± 0.1 μm (n=90) for PT1-1, PT3-1, and PT3-2, respectively. Microconidia were hyaline, fusoid or ovoid, 0- or 1-septate, measuring 10.5 ± 0.2 μm × 3.5 ± 0.1 μm, 10.4 ± 0.3 μm × 3.6 ± 0.1 μm, 10.0 ± 0.2 μm × 3.6 ± 0.1 μm (n=90) for PT1-1, PT3-1, and PT3-2, respectively. The internal transcribed spacer (ITS), translation elongation factor ( TEF1 ), calmodulin ( CAM ) and partial RNA polymerase second largest subunit ( RPB2 ) were amplified using primers ITS4/ITS1, EF1/EF2, CL1/CL2A, and 5F2/7cR, respectively (White et al. 1990; O'Donnell et al. 1998, 2000; Reeb et al. 2004; Liu et al. 1999). Sequences from the three isolates were deposited in GenBank (ITS: OR511756-OR511758; TEF1 : OR535156-OR535158; CAM : OR535153-OR535155; RPB2 : OR535159-OR535161). A maximum likelihood (ML) phylogenetic tree was constructed with RAxML version 8.2.10 based on the concatenated sequences (ITS, CAM , TEF1 , RPB2 ). According to morphology and phylogenetic analysis, the isolates were identified as Fusarium pernambucanum (Santos et al. 2019). A pathogenicity test was performed with three isolates on twenty-four asymptomatic strings of grapes in a field in Nanning, Guangxi Province, China. On twelve strings of ripe grapes (cv. Kyoho), 3-mm-long wounds were made on the peduncle of each string of grapes with a sterile needle, followed by inoculation with conidial suspension (10 6 spores/ml in 0.1% sterile Tween 20) by misting with an atomizer until runoff (Lorenz et al. 1995). Three isolates were separately inoculated onto three strings of grapes. Controls were inoculated with water containing 0.1% sterile Tween 20 under the same conditions. The same inoculation was applied to twelve strings of non-wound grapes. Plants were covered with polythene bags to maintain high humidity for 7 days. Typical dark brown lesions were observed on all inoculated peduncles with conidia. After 14 days, the necrotic lesions spread to the entire peduncles causing them to shrivel and die. No symptoms were observed on controls. Koch's postulates were completed by reisolating the fungus from the inoculated tissues. The results of morphological identification and multigene sequence analysis obtained by reisolation were consistent with original isolates. To our knowledge, this is the first report of F. pernambucanum causing peduncle rot on grape in China. These results will provide valuable information for prevention and management of peduncle rot on grape.

The coronavirus disease 2019 (COVID-19) global pandemic, caused by severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2), has been marked by severe cases demonstrating a "cytokine storm", an upsurge of pro-inflammatory cytokines in the bloodstream. NLRP3 inflammasomes, integral to the innate immune system, are speculated to be activated by SARS-CoV-2 within host cells. This review investigates the potential correlation between NLRP3 inflammasomes and COVID-19, exploring the cellular and molecular mechanisms through which SARS-CoV-2 triggers their activation. Furthermore, promising strategies targeting NLRP3 inflammasomes are proposed to mitigate the excessive inflammatory response provoked by SARS-CoV-2 infection. By synthesizing existing studies, this paper offers insights into NLRP3 as a therapeutic target, elucidating the interplay between COVID-19 and its pathophysiology. It serves as a valuable reference for future clinical approaches in addressing COVID-19 by targeting NLRP3, thus providing potential avenues for therapeutic intervention.

Objective: Post-stroke transcranial magnetic stimulation (TMS) has gradually become a brain intervention to assist patients in the recovery of motor function. The long lasting regulatory of TMS may involve the coupling changes between cortex and muscles. However, the effects of multi-day TMS on motor recovery after stroke is unclear., Methods: This study proposed to quantify the effects of three-week TMS on brain activity and muscles movement performance based on a generalized cortico-muscular-cortical network (gCMCN). The gCMCN-based features were further extracted and combined with the partial least squares (PLS) method to predict the Fugl-Meyer of upper extremity (FMUE) in stroke patients, thereby establishing an objective rehabilitation method that can evaluate the positive effects of continuous TMS on motor function., Results: We found that the improvement of motor function after three-week TMS was significantly correlated with the complexity trend of information interaction between hemispheres and the intensity of corticomuscular coupling. In addition, the fitting coefficient ([Formula: see text]) for predicted and actual FMUE before and after TMS were 0.856 and 0.963, respectively, suggesting that the gCMCN-based measurement may be a promising method for evaluating the therapeutic effect of TMS., Conclusion: From the perspective of a novel brain-muscles network with dynamic contraction as the entry point, this work quantified TMS-induced connectivity differences while evaluating the potential efficacy of multi-day TMS., Significance: It provides a unique insight for the further application of intervention therapy in the field of brain diseases.

SiGe/Si multilayer is the core structure of the active area of gate-all-around field-effect transistors and semiconductor quantum computing devices. In this paper, high-quality SiGe/Si multilayers have been grown by a reduced-pressure chemical vapor deposition system. The effects of temperature, pressure, interface processing (dichlorosilane (SiH 2 Cl 2 , DCS) and hydrogen chloride (HCl)) on improving the transition thickness of SiGe to Si interfaces were investigated. The interface quality was characterized by transmission electron microscopy/atomic force microscopy/high-resolution X-ray diffraction methods. It was observed that limiting the migration of Ge atoms in the interface was critical for optimizing a sharp interface, and the addition of DCS was found to decrease the interface transition thickness. The change of the interfacial transition layer is not significant in the short treatment time of HCl. When the processing time of HCl is increased, the internal interface is optimized to a certain extent but the corresponding film thickness is also reduced. This study provides technical support for the acquisition of an abrupt interface and will have a very favorable influence on the performance improvement of miniaturized devices in the future.

Both ternary copolymerization and ternary blending are effective methods to fine-tune polymer structure and manipulate thin-film morphology to improve device performance. In this work, three D-A-A-A (D: donor, A: acceptor) terpolymer donors (FY1, FY2, and FY3) are synthesized by introducing BDD (1,3-bis(2-ethylhexyl)-5,7-di(thiophen-2-yl)benzo[1,2-c:4,5-c']dithiophene-4,8-dione) units into the D-A alternating copolymer PM6 backbone. Owing to the promoted conjugated planarity and excellent absorption of BDD, the obtained terpolymers display an extended absorption range and enhanced π-π stacking orientation, which is a promising third component in ternary device. As a result, the optimal FY1:PM6:BTP-eC9-based ternary device afforded an impressive power conversion efficiency (PCE) as high as 18.52%, owing to the efficient charge transport, negligible energy loss, and suitable domain size. The result provides an efficient method to obtain high-performance polymer solar cells by using analogous polymer donors in ternary device., (© 2023 Wiley-VCH GmbH.)

A special Ge nanowire/nanosheet (NW/NS) p-type vertical sandwich gate-all-around (GAA) field-effect transistor (FET) (Ge NW/NS pVSAFET) with self-aligned high-κ metal gates (HKMGs) is proposed. The Ge pVSAFETs were fabricated by high-quality GeSi/Ge epitaxy, an exclusively developed self-limiting isotropic quasi atomic layer etching (qALE) of Ge selective to both GeSi and the (111) plane, top-drain implantation, and ozone postoxidation (OPO) channel passivation. The Ge pVSAFETs, which have hourglass-shaped (111) channels with the smallest size range from 5 to 20 nm formed by qALE, have reached a record high I on of ∼291 μA/μm and exhibited good short channel effects (SCEs) control. The integration flow is compatible with mainstream CMOS processes, and Ge pVSAFETs with precise control of gate lengths/channel sizes were obtained.

Prostate-specific membrane antigen (PSMA) imaging probes are a promising tool for the diagnosis and image-guided surgery of prostate cancer (PCa). However, PSMA-specific luminescence probes for PCa detection and heterogeneity studies with high imaging contrast are lacking. Here, we report the first near-infrared (NIR) iridium(III) complex for the wash-free and specific imaging of PSMA in PCa cells and spheroids. The conjugation of a PSMA inhibitor, Lys-urea-Glu, to an iridium(III) complex synergizes the PSMA-specific affinity and biocompatibility of the inhibitor with the desirable photophysical properties of the iridium(III) complex, including NIR emission (670 nm), high photostability and a large Stokes shift. The cellular impermeability of the probe along with its strong binding affinity to PSMA enhances its specificity for PSMA, enabling the washing-free luminescent imaging of membrane PSMA with lower cytotoxicity. The probe was successfully applied for selectively visualizing PSMA-expressing cells and for the imaging of PSMA in a multicellular PCa model with good imaging penetration, indicating its potential use in complicated and heterogeneous tumor microenvironments. Furthermore, the probe showed good imaging performance in the PCa-bearing tumor mice via targeting PSMA in vivo. This work provides a novel strategy for the development of highly sensitive and specific NIR probes for PSMA in biological systems in vitro, which is of great significance for the precise diagnosis of PCa and for elucidating PCa heterogeneity., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Masson SAS. All rights reserved.)

Electro-optic modulators are essential devices on silicon photonic chips in modern optical communication networks. This paper presents a compact, low-loss electro-optic modulator. The modulation efficiency is greatly improved by embedding the lower half of the slot waveguide into the buried oxide layer and inserting graphene at the junction. The interaction of graphene with an optical field in a waveguide is studied using the finite element method. The functions of phase modulation and absorption modulation are realized by changing the gate voltage to change the chemical potential of graphene. The semi-embedded slot waveguide optical modulator has a length of 50 µm. After simulation verification, it can be used as an electro-absorption modulator and can achieve a modulation depth of 26.38 dB and an insertion loss of 0.60 dB. When used as an electro-refractive modulator, it can be realized with a linear change of phase from zero to π ; the total insertion loss is only 0.59 dB. The modulator has a modulation bandwidth of 79.6 GHz, and the energy consumption as electro-absorption and electro-refraction modulation are 0.51 and 1.92 pj/bit, respectively. Compared with common electro-optic modulators, the electro-optic modulator designed in this paper has a higher modulation effect and also takes into account the advantages of low insertion loss and low energy consumption. This research is helpful for the design of higher-performance optical communication network devices.

The deep application of chiral metasurfaces requires higher flexibility. Herein, we propose a multidimensional tunable chiral graphene metasurface, which uses coherent control to obtain more than 0.8 circular conversion dichroism (CCD) at 2.4 THz as a transmission structure. Its operating frequency can be changed in the 1.3-2.4 THz range, while the amplitude has almost perfect modulation depth in the range of 0-0.8. The mechanism of differential absorption was analyzed through numerical simulation. The device designed is easy to obtain reverse CCD, which is used for unit layout and proves its advantages in near-field imaging. Our work has broadened the path for the development of chiral metasurfaces towards higher degrees of freedom.

In this paper, a nested micro-ring refractive index sensor based on a subwavelength grating waveguide and the Vernier effect is proposed. In this scheme, the nested micro-ring structure is combined with a subwavelength grating structure to enhance the contact area between the optical field and the analyte, and the wavelength offset is doubled through the Vernier effect. The proposed sensor can effectively increase sensing sensitivity, taking into account the improvement of the free spectral range. This structure enables the device to reach a sensitivity of 8030 nm/RIU near 1550 nm wavelength in a deionized water environment, with a detection limit of 5.659×10 -5  RIU and free spectral range of 41.956 nm. The device suggested in this study has a greater reduced footprint than the conventional micro-ring resonant sensor, measuring just 35µ m ×25µ m . Due to its high integration, high sensitivity, and large free spectral range compared to conventional micro-ring resonant sensors, such structures are of great value in biosensing and environmental monitoring.

Caries is considered to be the most prevalent non-communicable disease in humans, mainly deriving from acidogenic bacterial biofilm and resulting in the demineralization and decomposition of hard dental tissue. Herein, a composite responsive foam brace loaded with magnesium organic framework (MPC) is designed for caries prevention and tooth remineralization. MPC can intelligently release organic antibacterial molecules (gallic acid) and mineralized ions (Mg 2+ , Ca 2+ and PO 4 3- ) under acidic conditions (pH < 5.5) of biofilm infection, regulating pH and killing bacteria. Additionally, due to the excellent photothermal conversion efficiency, MPC can further enhance the destruction of bacterial biofilm by inhibiting virulence genes and destroying bacterial adhesion under near-infrared light irradiation (808 nm). More importantly, MPC can not only reverse the cariogenic environment at both pH and microbial levels, but also promote self-healing of demineralized teeth in terms of both the micro-structure and mechanical properties., Competing Interests: All authors declared that no conflict of interest existed., (© 2023 The Authors.)

Aiming at the problems of narrow working bandwidth, low efficiency, and complex structure of existing terahertz chiral absorption, we propose a chiral metamirror composed of C-shaped metal split ring and L-shaped vanadium dioxide (VO 2 ). This chiral metamirror is composed of three layers of structure, a gold substrate at the bottom, the first polyethylene cyclic olefin copolymer (Topas) dielectric layer and VO 2 -metal hybrid structure as the top. Our theoretical results led us to show that this chiral metamirror has a circular dichroism (CD) value greater than 0.9 at 5.70 to 8.55 THz and has a maximum value of 0.942 at f = 7.18 THz. In addition, by adjusting the conductivity of VO 2 , the CD value can be continuously adjustable from 0 to 0.942, which means that the proposed chiral metamirror supports the free switching of the CD response between the on and off states, and the CD modulation depth exceeds 0.99 in the range of 3 to 10 THz. Moreover, we discuss the influence of structural parameters and the change of incident angle on the performance of the metamirror. Finally, we believe that the proposed chiral metamirror has important reference value in the terahertz range for constructing chiral light detectors, CD metamirrors, switchable chiral absorbers and spin-related systems. This work will provide a new idea for improving the terahertz chiral metamirror operating bandwidth and promote the development of terahertz broadband tunable chiral optical devices.

At sub-3 nm nodes, the scaling of lateral devices represented by a fin field-effect transistor (FinFET) and gate-all-around field effect transistors (GAAFET) faces increasing technical challenges. At the same time, the development of vertical devices in the three-dimensional direction has excellent potential for scaling. However, existing vertical devices face two technical challenges: "self-alignment of gate and channel" and "precise gate length control". A recrystallization-based vertical C-shaped-channel nanosheet field effect transistor (RC-VCNFET) was proposed, and related process modules were developed. The vertical nanosheet with an "exposed top" structure was successfully fabricated. Moreover, through physical characterization methods such as scanning electron microscopy (SEM), atomic force microscopy (AFM), conductive atomic force microscopy (C-AFM) and transmission electron microscopy (TEM), the influencing factors of the crystal structure of the vertical nanosheet were analyzed. This lays the foundation for fabricating high-performance and low-cost RC-VCNFETs devices in the future.

We develop a method to fabricate an undoped Ge quantum well (QW) under a 32 nm relaxed Si 0.2 Ge 0.8 shallow barrier. The bottom barrier contains Si 0.2 Ge 0.8 (650 °C) and Si 0.1 Ge 0.9 (800 °C) such that variation of Ge content forms a sharp interface that can suppress the threading dislocation density (TDD) penetrating into the undoped Ge quantum well. The SiGe barrier introduces enough in-plane parallel strain (ε ∥ strain -0.41%) in the Ge quantum well. The heterostructure field-effect transistors with a shallow buried channel obtain an ultrahigh two-dimensional hole gas (2DHG) mobility over 2 × 10 6 cm 2 /(V s) and a very low percolation density of (5.689 ± 0.062) × 10 10 cm -2 . The fractional indication is also observed at high density and high magnetic fields. This strained germanium as a noise mitigation material provides a platform for integration of quantum computation with a long coherence time and fast all-electrical manipulation.

Background: The Anterior Cruciate Ligament-Quality of Life (ACL-QOL) questionnaire is a widely used and effective scale for quality of life in patients with chronic anterior cruciate ligament (ACL) injury., Purpose: To translate and adapt the ACL-QOL questionnaire for Chinese patients and evaluate its reliability, validity, and responsiveness in this population., Study Design: Cohort study (diagnosis); Level of evidence, 2., Methods: Translation and adaptation were conducted in accordance with the guidelines of the A merican Academy of Orthopaedic Surgeons Outcome Committee. Included were 121 patients who were diagnosed with a chronic ACL injury and underwent ACL reconstruction between January 2020 and June 2021. Preoperatively, patients completed the simplified Chinese version of the ACL-QOL (ACL-QOL-C), the Knee injury and Osteoarthritis Outcome Score, and the 12-Item Short Form Health Survey. The ACL-QOL-C was also completed at 12- and 24-week follow-ups. Psychometric evaluations were then performed and included score distribution, internal consistency, test-retest reliability, construct validity, and responsiveness., Results: The Cronbach alpha ranged from .905 to .975, indicating excellent internal consistency, and the intraclass correlation coefficient ranged from 0.864 to 0.985, indicating excellent test-retest reliability. The consistency between the above results and our a priori hypotheses was more than 70% (35/42), indicating good construct validity. The standard error of measurement and effect size of the total score and each item of the ACL-QOL-C were >0.8 at the final follow-up, indicating good responsiveness., Conclusion: The English version of the ACL-QOL has been successfully translated into Chinese, and it has been shown to be applicable for the assessment of the quality of life in Chinese patients with chronic ACL injury., Competing Interests: One or more of the authors has declared the following potential conflict of interest or source of funding: The present work was supported by the General Hospital of Western Theater Command Project (grant 2021-XZYG-B05), the Cadre health care project of Sichuan Province (grant 2017-1302), the Fundamental Research Funds for the Central Universities (grants 2682022ZTPY036 and 2682022ZTPY043), the Projects in the Management of Traditional Chinese Medicine in Sichuan Province (grant 2023MS215) and the Department of Science and Technology of Sichuan Province (CN) Project (grants 2023YFS0052 and 2019YFS0269). AOSSM checks author disclosures against the Open Payments Database (OPD). AOSSM has not conducted an independent investigation on the OPD and disclaims any liability or responsibility relating thereto., (© The Author(s) 2023.)

Transistor scaling has become increasingly difficult in the dynamic random access memory (DRAM). However, vertical devices will be good candidates for 4F 2 DRAM cell transistors (F = pitch/2). Most vertical devices are facing some technical challenges. For example, the gate length cannot be precisely controlled, and the gate and the source/drain of the device cannot be aligned. Recrystallization-based vertical C-shaped-channel nanosheet field-effect transistors (RC-VCNFETs) were fabricated. The critical process modules of the RC-VCNFETs were developed as well. The RC-VCNFET with a self-aligned gate structure has excellent device performance, and its subthreshold swing (SS) is 62.91 mV/dec. Drain-induced barrier lowering (DIBL) is 6.16 mV/V.

With the development of photonic integration technology, meta-waveguides have become a new research hotspot. They have broken through the theoretical diffraction limit by virtue of the strong electromagnetic manipulation ability of the metasurface and the strong electromagnetic field limitation and guidance ability of the waveguide. However, the reported meta-waveguides lack research on dynamic modulation. Therefore, we analyze the modulation effect of the metasurface on the optical field in the waveguide and design an ultra-compact on-chip meta-waveguide phase modulator using split ring magnetic resonance. It has a very short modulation length of only 3.65 µm, wide modulation bandwidth of 116.8 GHz, and low energy consumption of 263.49 fJ/bit. By optimizing the structure, the energy consumption can be further reduced to 90.69 fJ/bit. Meta-waveguides provide a promising method for the design of integrated photonic devices.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines., Competing Interests: Declaration of interests An international application PCT/US2022/036,367 was filed on July 7, 2022, and published as WO2023283342A2 on January 12, 2023, via Temple University related to this work., (Copyright © 2023 The Author(s). Published by Elsevier Inc. All rights reserved.)

In patients with severe COVID-19, acute respiratory distress syndrome (ARDS), multiple organ dysfunction syndrome (MODS), and even mortality can result from cytokine storm, which is a hyperinflammatory medical condition caused by the excessive and uncontrolled release of pro-inflammatory cytokines. High levels of numerous crucial pro-inflammatory cytokines, such as interleukin-1 (IL-1), IL-2, IL-6, tumor necrosis factor-α, interferon (IFN)-γ, IFN-induced protein 10 kDa, granulocyte-macrophage colony-stimulating factor, monocyte chemoattractant protein-1, and IL-10 and so on, have been found in severe COVID-19. They participate in cascade amplification pathways of pro-inflammatory responses through complex inflammatory networks. Here, we review the involvements of these critical inflammatory cytokines in SARS-CoV-2 infection and discuss their potential roles in triggering or regulating cytokine storm, which can help to understand the pathogenesis of severe COVID-19. So far, there is rarely effective therapeutic strategy for patients with cytokine storm besides using glucocorticoids, which is proved to result in fatal side effects. Clarifying the roles of key involved cytokines in the complex inflammatory network of cytokine storm will help to develop an ideal therapeutic intervention, such as neutralizing antibody of certain cytokine or inhibitor of some inflammatory signal pathways., (© 2023 The Authors. Journal of Medical Virology published by Wiley Periodicals LLC.)

Circular dichroism has promising applications in biology, molecular chemistry, and other fields. The key to obtaining strong circular dichroism is to introduce symmetry breaking into the structure, which leads to a great difference in the response to different circularly polarized waves. Here, we propose a metasurface structure based on three circular arcs, which produces strong circular dichroism. The metasurface structure combines the split ring with the three circular arcs and increases the structural asymmetry by changing the relative torsional angle. The causes of the strong circular dichroism are analyzed in this paper, and the influence of metasurface parameters on it is discussed. According to the simulation data, the response of the proposed metasurface to different circularly polarized waves varies greatly, with absorption of up to 0.99 at 5.095 THz for a left-handed circularly polarized wave and a maximum circular dichroism of over 0.93. In addition, the incorporation of the phase change material vanadium dioxide on the structure allows flexible modulation of circular dichroism and modulation depths of up to 98.6%. The change of angle within a certain range has little effect on the structural performance. We believe that this flexible and angle robust chiral metasurface structure is suitable for complex reality, and large modulation depth is more practical.

Zika virus (ZIKV) evolves non-structural proteins to evade immune response and ensure efficient replication in the host cells. Cholesterol metabolic enzyme 7-dehydrocholesterol reductase (DHCR7) was recently reported to impact innate immune responses in ZIKV infection. However, the vital non-structural protein and mechanisms involved in DHCR7-mediated viral evasion are not well elucidated. In this study, we demonstrated that ZIKV infection facilitated DHCR7 expression. Notably, the upregulated DHCR7 in turn facilitated ZIKV infection and blocking DHCR7 suppressed ZIKV infection. Mechanically, ZIKV non-structural protein 4B (NS4B) interacted with DHCR7 to induce DHCR7 expression. Moreover, DHCR7 inhibited TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3) phosphorylation, which resulted in the reduction of interferon-beta (IFN-β) and interferon-stimulated genes (ISGs) productions. Therefore, we propose that ZIKV NS4B binds to DHCR7 to repress TBK1 and IRF3 activation, which in turn inhibits IFN-β and ISGs, and thereby facilitating ZIKV evasion. This study broadens the insights on how viral non-structural proteins antagonize innate immunity to facilitate viral infection via cholesterol metabolic enzymes and intermediates., (Copyright © 2022 The Authors. Publishing services by Elsevier B.V. All rights reserved.)

Boron trifluoride (BF 3 ) is a potential environmental pollutant, and excess exposure to it may cause human diseases. However, the sensitive, rapid and accurate detection of BF 3 for on-site purposes is still a challenge. In this work, we developed the first NIR iridium(III)-based probe with dual emission and a Stokes shift of 370 nm for self-calibrated and luminogenic detection of BF 3 . This probe exhibited a strong luminescence enhancement at around 650 nm to BF 3 (0-100 μM) with almost no change in luminescence at 475 nm, displaying a 220-fold I 650 nm /I 475 nm enhancement at 100 μM of BF 3 with a detection limit of 0.35 μM. Moreover, the probe showed a fast response time of less than 5 s to BF 3 along with an obvious color change under UV irradiation for visual detection. Importantly, the desirable photophysical properties of the iridium(III)-based probe can be harnessed for time-resolved detection of BF 3 in the presence of the fluorescence background. The applicability of the probe was further verified in an organic solvent waste-spiked system and on a glass pane. This work will provide a solid basis for the development of sensitive and on-site BF 3 sensing toolkits for environmental monitoring., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 Elsevier B.V. All rights reserved.)

The adsorption and recovery of uranium from wastewater is of positive significance to the development of nuclear industry and environmental remediation. The ternary polymer (PZS-co-TA) was prepared from hexachlorocyclotriphosphazene (HCCP), 4,4-sulfonyldiphenol (BPS) and tannic acid (TA) under ultrasonic. TAC was then obtained after carbonization under high temperature from PZS-co-TA. The structure and performance of TAC were analyzed using SEM, EDS, FT-IR, XRD, Raman, BET and TG. The adsorption capacity of TAC for uranium under different static adsorption conditions was investigated. The adsorption process was more consistent with pseudo-second-order model. The maximum adsorption capacity calculated by non-linear Langmuir model was 492.5 mg/g at pH 5.5. The thermodynamic values suggested that the adsorption process was spontaneous and endothermic. Moreover, after five cycles of adsorption-desorption tests, TAC remained effective at adsorbing uranium, implying the introducing of TA to the precursor (PZS-co-TA) could enhance the adsorption capacity for uranium., Competing Interests: Declaration of competing interest The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Yan Liu reports financial support was provided by National Natural Science Foundation of China. Yan Liu reports was provided by College Students’ Innovation and Entrepreneurship Training Program of Jiangxi Province., (Copyright © 2022 Elsevier Ltd. All rights reserved.)

Herein, we report a highly selective fluorescent probe for the detection of Cu(ii). The detection mechanism relies on the Cu(ii)-catalyzed oxidative hydroxylation of 2-(aminocarbonyl)phenylboronic acid into salicylamide, thus recovering the excited-state intramolecular proton transfer (ESIPT) effect and inducing more than 35-fold fluorescence enhancement. The simple structure and readily available fluorescent probe give a novel method for quantitatively detecting Cu(ii) in the linear range of 0-22 μM, with a limit of detection down to 68 nM, and exhibiting high selectivity for Cu(ii) over 16 other metal ions., Competing Interests: The authors declare that they have no known competing financial interests or personal relationships that could have influenced the work reported in this paper., (This journal is © The Royal Society of Chemistry.)

Novel terpolymers were developed with ester group incorporation (BDT-2EST). DM1 with 5% BDT-2EST possesses suitable crystallinity and miscibility matching with Y6 acceptor to offer an excellent power conversation efficiency up to 17.21%. Moreover, the intertwined random features in DM1 offer robust photovoltaic performances with a broad molecular weight tolerance.

The muscle synergy hypothesis assumes that the nervous system controls muscles in groups to simplify behavioral tasks, which makes it possible for modularizing motor function assessment. This paper presents a new assessment method based on muscle synergy space (MSS) model to evaluate motor functions after stroke. It consists of spatiotemporal feature module, muscle activation module and synergy activation module, and focuses on the spatial and temporal characteristics of muscle synergies via synergy vectors and activation coefficients. We further applied this method to reveal spatial and temporal characteristics difference of muscle synergy between healthy controls and stroke patients. The effectiveness and accuracy of MSS model were proved by significant positive correlations between Fugl-Meyer score and the total number of optimal synergies of three modules. This measurement methodology could serve as a quantitative indicator for motor function and provide more scientific rehabilitation guidance.

Powdery mildew is an economic threat for viticulture because it not only affects grape yield, but also causes a series of impacts on the qualities of fruit and wine, especially the flavors and various metabolites. Different grape varieties may have different levels of powdery mildew resistance/tolerance and their components of their metabolome are also various. In this study, two wine grape varieties, Guipu No.6 (GP6) and Marselan (Mar) with different levels of powdery mildew tolerance, were used to compare the quality differences in metabolism level by using the widely targeted metabolomics method. The results show that GP6 has a better powdery mildew leaf tolerance than Mar. A total of 774 metabolites were detected by using a UPLC-QQQ-MS-based metabolomics approach, and 57 differential metabolites were identified as key metabolites that were accumulated after infection with powdery mildew in GP6 and Mar, including phenolic acids, flavonoids, terpenoids, stilbenes, lipids, nucleotides and derivatives, lignans and coumarins, and quinones. This finding indicates that the defense mechanisms of grape fruit are mainly associated with phenylpropane-flavonoid metabolism. Specifically, stilbenes had greater variations after powdery mildew infection in GP6; while in Mar, the variations of flavonoids, especially kaempferol-3- O -glucuronide and luteolin-7- O -glucuronide, were more remarkable. The above results demonstrate that stilbenes may play a more important role than flavonoids in resisting powdery mildew infection in GP6's fruits, and the drastic variations of these phenolic compounds in different wine grapes after powdery mildew infection might also lead to quality difference in the flavors. This study can provide new insights into the understanding of the cause of powdery mildew tolerance in different grape varieties and the effects on the quality of wine grapes infected with the disease exerted by metabolism level.

With the increased demands of human-machine interaction, haptic feedback is becoming increasingly critical. However, the high cost, large size and low efficiency of current haptic systems severely hinder further development. As a portable and efficient technology, cutaneous electrotactile stimulation has shown promising potential for these issues. This paper presents a review on and insight into cutaneous electrotactile perception and its applications. Research results on perceptual properties and evaluation methods have been summarized and discussed to understand the effects of electrotactile stimulation on humans. Electrotactile applications are presented in categories to understand the methods and progress in various fields such as prostheses control, sensory substitution, sensory restoration and sensorimotor restoration. State of the art has demonstrated the superiority of electrotactile feedback, its efficiency and its flexibility. However, the complex factors and the limitations of evaluation methods made it challenging for precise electrotactile control. Groundbreaking innovation in electrotactile theory is expected to overcome challenges such as precise perception control, information capacity increasing, comprehension burden reducing and implementation costs.

Biofilm-driven caries and tooth discoloration are two major problems in oral health care. The current methods have the disadvantages of insufficient biofilm targeting and irreversible enamel damage. Herein, an injectable sodium alginate hydrogel membrane doped with bismuth oxychloride (Bi 12 O 17 Cl 2 ) and cubic cuprous oxide (Cu 2 O) nanoparticles was designed to simultaneously achieve local tooth whitening and biofilm removal through a photodynamic dental therapy process. This fast cross-linked hydrogel could form a biofilm removal coating on the target tooth surface precisely. Afterward, reactive oxygen species was effectively released on demand under green light, which could not only eradicate the biofilm but also whiten the tooth non-destructively in a facile manner without significant damage to both the enamel and biological cells. After the usage, the removal of this hydrogel can also enhance the effect of biofilm destruction and caries prevention.

A label-free immunosensor was constructed in oxidation and reduction dual channel mode for the trace detection of cancer antigen 125 (CA125) in serum. The gold-vertical graphene/titanium dioxide (Au-VG/TiO 2 ) electrode was used as the signal-amplification platform, and cytosine and dopamine were used as probes in the oxidation and reduction channels, respectively. VG nanosheets were synthesized on a TiO 2 nanotube array via chemical vapor deposition (CVD), and Au nanoparticles were deeply embedded on the surface and in the root of the VG nanosheets via electrodeposition. The CA125 antibody was then directly immobilized onto the electrode surface, benefitting from its natural affinity for Au nanoparticles. In the oxidation and reduction channels the CA125 antibody-Au-VG/TiO 2 immune electrode had the same response concentration range (0.01-1000 mU∙mL -1 ) for the determination of the CA125 antigen. However, the oxidation channel had a higher sensitivity (14.82 μA•(log(mU•mL -1 )) -1 at a working potential of ~ 1.25 V vs. SCE), lower detection limit (0.0001 mU∙mL -1 ), higher stability, and lower performance deviation than the reduction channel. This immunosensor was successfully used for CA125 detection in human serum. The recoveries of spiked serum samples ranged from 99.8 ± 0.5 to 100 ± 0.4%. The study on the difference in the sensing performance between oxidation and reduction channels provides a preliminary experimental reference for exploring dual-channel synchronous detection immunosensors and verifying the accuracy of the assay based on dual-channel data, which will promote the development of reliable electrochemical immunosensor technology., (© 2022. The Author(s), under exclusive licence to Springer-Verlag GmbH Austria, part of Springer Nature.)

Brain networks allow a topological understanding into the pathophysiology of stroke-induced motor deficits, and have been an influential tool for investigating brain functions. Unfortunately, currently applied methods generally lack in the recognition of the dynamic changes in the cortical networks related to muscle activity, which is crucial to clarify the alterations of the cooperative working patterns in the motor control system after stroke. In this study, we integrate corticomuscular and intermuscular interactions to cortico-cortical network and propose a novel closed-loop construction of cortico-muscular-cortical functional network, named closed-loop network (CLN). Directional characteristic in terms of differentiating causal interactions is endowed on basis of the CLN framework, further expanding the definition of functional connectivity (FC) and effective connectivity (EC) dedicated to CLN. Next, CLN is applied to stroke patients to reveal the underlying after-effects mechanism of low frequency repetitive transcranial magnetic stimulation (rTMS) induced alterations of cortical physiologic functions during movement. Results show that the short-term modulation of rTMS is reflected in the enhancement of information interaction within the interhemispheric primary motor regions and inhibition of the coupling between motor cortex and effector muscles. CLN provides a new perspective for the study of motor-related cortical networks with muscle activities involvement instead of being restricted to brain network analysis of behaviors.

Objective . Transcranial magnetic stimulation (TMS) is an experimental therapy for promoting motor recovery from hemiparesis. At present, hemiparesis patients' responses to TMS are variable. To maximize its therapeutic potential, we need an approach that relates the electrophysiology of motor recovery and TMS. To this end, we propose corticomuscular network (CMN) representing the holistic motor system, including the cortico-cortical pathway, corticospinal tract, and muscle co-activation. Approach . CMN is made up of coherence between pairs of electrode signals and spatial locations of the electrodes. We associated coherence and graph features of CMN with Fugl-Meyer Assessment (FMA) for the upper extremity. Besides, we compared CMN between 8 patients with hemiparesis and 6 healthy controls and contrasted CMN of patients before and after a 1 Hz TMS. Main results . Corticomuscular coherence (CMC) correlated positively with FMA. The regression model between FMA and CMC between five pairs of channels had 0.99 adjusted and a p -value less than 0.01. Compared to healthy controls, CMN of patients tended to be a small-world network and was more interconnected with higher CMC. CMC between cortex and triceps brachii long head was higher in patients. 15 min 1 Hz TMS protocol induced coherence changes beyond the stimulation side and had a limited impact on CMN parameters that are related to motor recovery. Significance . CMN is a potential clinical approach to quantify rehabilitating progress. It also sheds light on the desirable electrophysiological effects of TMS based on which rehabilitating strategies can be optimized., (© 2022 IOP Publishing Ltd.)

In this work, low-temperature Schottky source/drain (S/D) MOSFETs are investigated as the top-tier devices for 3D sequential integration. Complementary Schottky S/D FinFETs are successfully fabricated with a maximum processing temperature of 500 °C. Through source/drain extension (SDE) engineering, competitive driving capability and switching properties are achieved in comparison to the conventional devices fabricated with a standard high-temperature (≥1000 °C) process flow. Schottky S/D PMOS exhibits an ON-state current ( I ON ) of 76.07 μA/μm and ON-state to OFF-state current ratio ( I ON / I OFF ) of 7 × 10 5 , and those for NMOS are 48.57 μA/μm and 1 × 10 6 . The CMOS inverter shows a voltage gain of 18V/V, a noise margin for high ( NM H ) of 0.17 V and for low ( NM L ) of 0.43 V, with power consumption less than 0.9 μW at V DD of 0.8 V. Full functionality of CMOS ring oscillators (RO) are further demonstrated.

Objective: While the corticomuscularcoupling between motor cortex and muscle tissue has received considerable attention, which is typically quantitative measure to evaluate neural signals synchronization in the motor control system, little work has been published regarding the effect of underlying delay of two coupled physiological signals on coherence., Methods: In this study, we developed a novel delay estimation method, named rate of voxels change (RVC), detecting time delay in two coupled physiological signals. Based on RVC framework, delay compensation was used to adjust magnitude squared coherence (MSC) image. To illustrate the effectiveness of the RVC method, we compared the estimated delays and the adjusted MSC results based on RVC method and corticomuscular coherence with time lag (CMCTL) method., Results: The simulation results suggested that RVC method was not only superior to the CMCTL method in estimating different time delays, but also has better optimization effect on MSC image. The experimental results further confirmed that delay estimated by the proposed RVC method was more in line with the underlying physiology (controls: 22.8 ms vs patients: 34.5 ms). Meanwhile, RVC-based delay compensation could significantly optimize the MSC of specific regions., Significance: This study proved that RVC has remarkably higher reliability in detecting time delay between coupled neurophysiological signals, and the application of RVC was an improvement on the previous studies that mainly focused on biased MSC estimation.

Nonvolatile logic devices are crucial for the development of logic-in-memory (LiM) technology to build the next-generation non-von Neumann computing architecture. Ferroelectric field-effect transistors (Fe FET) are one of the most promising candidates for LiMs because of high compatibility with mainstream silicon-based complementary metal-oxide semiconductor processes, nonvolatile memory, and low power consumption. However, because of the unipolar characteristics of a Fe FET, a nonlinear XOR or XNOR logic gate function is difficult to realize with a single device. In addition, because single Fe polarization switch modulation is available in the devices, a reconfigurable logic gate usually needs multiple devices to construct and realize fewer logic functions. Here, we introduced polarization-switching (PS) and charge-trapping (CT) effects in a single Fe FET and fabricated a multi-field-effect transistor with bipolar-like characteristics based on advanced 10 nm node fin field-effect transistors (PS-CT FinFET) with 9 nm thick Hf 0.5 Zr 0.5 O 2 films. The special hybrid effects of charge-trapping and polarization-switching enabled eight Boolean logic functions with a single PS-CT FinFET and 16 Boolean logic functions with two complementary PS-CT FinFETs were obtained with three operations. Furthermore, reconfigurable full 1 bit adder and subtractor functions were demonstrated by connecting only two n -type and two p -type PS-CT FinFET devices, indicating that the technology was promising for LiM applications.

A tandem cyclization between 2-(2-aminophenyl)acetonitriles and 2-(hydroxy(aryl)methyl)phenols for the preparation of dihydrochromeno[2,3- b ]indole derivatives was successfully developed. The transformation proceeded smoothly in the presence of a catalytic environmentally benign iron salt, and various multisubstituted dihydrochromeno[2,3- b ]indoles were synthesized in moderate to high yields.

Porcine circovirus type 4 (PCV4) was first reported in 2019 in China. So far, the viral DNA was detected from both healthy and diseased pigs in China and South Korea by using molecular techniques including PCR and real-time PCR. In contrast, a serological survey regarding the presence of PCV4 antibodies in the pig population was seldomly reported. In the present study, we describe the development of an indirect enzyme-linked immunosorbent assay (ELISA) based on capsid protein for the detection of PCV4 antibodies in swine sera. After validating the specificity and sensitivity, the ELISA was used in a retrospective serological survey for PCV4 antibodies in pig sera from Jiangsu Province of China. Note that 3.44% of analyzed samples collected between 2018 and 2021 were tested positive for PCV4 antibodies. However, PCV4 genome was absent in all ELISA-positive serum samples. Therefore, the dynamic of viremia and antibody response to PCV4 infection in pigs warrant further investigation., (© 2021 Wiley-VCH GmbH.)

Objective: While neuroplasticity and functional reorganization during motor recovery can be indirectly reflected and evaluated by functional corticomuscular coupling (fCMC), little work has been published regarding the cortical origin of abnormal muscle synergy and compensatory mechanism in the separation movement of stroke patients., Methods: In this study, we proposed to use extended partial directed coherence (ePDC) combined with an optimal spatial filtering approach to estimate fCMC in stroke patients and healthy controls, and further established muscle synergy model (MSM) to jointly explore the modulation mechanism between cortex and muscles., Results: Compared to healthy controls, stroke patients had significantly reduced coupling strength in both descending and ascending pathway. Moreover, the MSM were abnormal with high variability and low similarity in the separation stage of stroke patients. Further exploration of the positive relationship between fCMC characteristics and MSM parameters proved the possibility of using fCMC-MSM-based correlation indicator to evaluate abnormality of the cortical related synergy movement as well as the rehabilitation level of stroke patients., Conclusion: We developed a computational procedure to evaluate the correlation between fCMC and MSM in stroke patients., Significance: This article provides a quantitative evaluation metrics based on fCMC to reveal the deficits during poststroke motor restoration and a promising approach to help patients correct abnormal movement habits, paving the way for neurophysiological assessment of neuromuscular control in conjunction with clinical scores.

GeSn alloys have already attracted extensive attention due to their excellent properties and wide-ranging electronic and optoelectronic applications. Both theoretical and experimental results have shown that direct bandgap GeSn alloys are preferable for Si-based, high-efficiency light source applications. For the abovementioned purposes, molecular beam epitaxy (MBE), physical vapour deposition (PVD), and chemical vapor deposition (CVD) technologies have been extensively explored to grow high-quality GeSn alloys. However, CVD is the dominant growth method in the industry, and it is therefore more easily transferred. This review is focused on the recent progress in GeSn CVD growth (including ion implantation, in situ doping technology, and ohmic contacts), GeSn detectors, GeSn lasers, and GeSn transistors. These review results will provide huge advancements for the research and development of high-performance electronic and optoelectronic devices.

Background: As the COVID-19 pandemic rages on, the new SARS-CoV-2 variants have emerged in the different regions of the world. These newly emerged variants have mutations in their spike (S) protein that may confer resistance to vaccine-elicited immunity and existing neutralizing antibody therapeutics. Therefore, there is still an urgent need of safe, effective, and affordable agents for prevention/treatment of SARS-CoV-2 and its variant infection., Results: We demonstrated that green tea beverage (GTB) or its major ingredient, epigallocatechin gallate (EGCG), were highly effective in inhibiting infection of live SARS-CoV-2 and human coronavirus (HCoV OC43). In addition, infection of the pseudoviruses with spikes of the new variants (UK-B.1.1.7, SA-B.1.351, and CA-B.1.429) was efficiently blocked by GTB or EGCG. Among the 4 active green tea catechins at noncytotoxic doses, EGCG was the most potent in the action against the viruses. The highest inhibitory activity was observed when the viruses or the cells were pre-incubated with EGCG prior to the infection. Mechanistic studies revealed that EGCG blocked infection at the entry step through interfering with the engagement of the receptor binding domain (RBD) of the viral spikes to angiotensin-converting enzyme 2 (ACE2) receptor of the host cells., Conclusions: These data support further clinical evaluation and development of EGCG as a novel, safe, and cost-effective natural product for prevention/treatment of SARS-CoV-2 transmission and infection., (© 2021. The Author(s).)

Human cerebral organoid (CO) is a three-dimensional (3D) cell culture system that recapitulates the developing human brain. While CO has proved an invaluable tool for studying neurological disorders in a more clinically relevant matter, there have still been several shortcomings including CO variability and reproducibility as well as lack of or underrepresentation of certain cell types typically found in the brain. As the technology to generate COs has continued to improve, more efficient and streamlined protocols have addressed some of these issues. Here we present a novel scalable and simplified system to generate microglia-containing CO (MCO). We characterize the cell types and dynamic development of MCOs and validate that these MCOs harbor microglia, astrocytes, neurons, and neural stem/progenitor cells, maturing in a manner that reflects human brain development. We introduce a novel technique for the generation of embryoid bodies (EBs) directly from induced pluripotent stem cells (iPSCs) that involves simplified steps of transitioning directly from 3D cultures as well as orbital shaking culture in a standard 6-well culture plate. This allows for the generation of MCOs with an easy-to-use system that is affordable and accessible by any general lab., Competing Interests: A U.S provisional patent application related to this work was filed with WH as the inventor. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2021 Bodnar, Zhang, Liu, Lin, Wang, Wei, Saribas, Zhu, Li, Wang, Yang, Li, Ho and Hu.)

Corticomuscular coupling reflects nonlinear interactions and multi-layer neural information transmission between the motor cortex and effector muscle in the sensorimotor system. Transfer spectral entropy (TSE) method has been used to describe corticomuscular coupling within single scale. As an extension of TSE, multiscale transfer spectral entropy (MSTSE) is proposed in this paper to depict multi-layer of neural information transfer between two coupling signals. The reliability and effectiveness of MSTSE were verified on data generated by nonlinear numerical models and those of a force tracking task. Compared with TSE, MSTSE is more robust to the embedding dimension and performs optimally in the detection of the coupling properties. Further analysis of the physiological signals showed that the MSTSE provided more detailed band characteristics than the single scale TSE measurement. MSTSE indicates significant coupling scattered in alpha, beta and low gamma bands during the force tracking task. Besides, the coupling strength in the descending direction of the beta band was significantly higher than that in the ascending direction. This study constructs multi-scale coupling information to provide a new perspective for exploring corticomuscular interaction.

This article presents a novel method to grow a high-quality compressive-strain Ge epilayer on Si using the selective epitaxial growth (SEG) applying the RPCVD technique. The procedures are composed of a global growth of Ge layer on Si followed by a planarization using CMP as initial process steps. The growth parameters of the Ge layer were carefully optimized and after cycle-annealing treatments, the threading dislocation density (TDD) was reduced to 3 × 10 7 cm -2 . As a result of this process, a tensile strain of 0.25% was induced, whereas the RMS value was as low as 0.81 nm. Later, these substrates were covered by an oxide layer and patterned to create trenches for selective epitaxy growth (SEG) of the Ge layer. In these structures, a type of compressive strain was formed in the SEG Ge top layer. The strain amount was -0.34%; meanwhile, the TDD and RMS surface roughness were 2 × 10 6 cm -2 and 0.68 nm, respectively. HRXRD and TEM results also verified the existence of compressive strain in selectively grown Ge layer. In contrast to the tensile strained Ge layer (globally grown), enhanced PL intensity by a factor of more than 2 is partially due to the improved material quality. The significantly high PL intensity is attributed to the improved crystalline quality of the selectively grown Ge layer. The change in direct bandgap energy of PL was observed, owing to the compressive strain introduced. Hall measurement shows that a selectively grown Ge layer possesses room temperature hole mobility up to 375 cm 2 /Vs, which is approximately 3 times larger than that of the Ge (132 cm 2 /Vs). Our work offers fundamental guidance for the growth of high-quality and compressive strain Ge epilayer on Si for future Ge-based optoelectronics integration applications.