Search

Aims: The study evaluated the antiviral effect of Verapamil against respiratory syncytial virus (RSV) and investigated its underlying mechanism., Materials and Methods: RSV-infected BALB/c mice were treated with Verapamil. Body weight, survival rates, viral load, lung damage, inflammatory factors, and the expression of RSV fusion (F) protein were analyzed. In cellular studies, intracellular Ca 2+ and viral titers were measured in the presence of Verapamil, Calcium Chloride, and EGTA. A time-of-addition assay assessed the antiviral effect of Verapamil., Key Findings: Mice infected with RSV and treated with Verapamil exhibited a significant decrease in weight loss, an increase in survival rates, and reductions in viral titers, RSV F protein expression, inflammatory responses, and lung tissue injury. Verapamil reduced intracellular calcium levels, which correlated with reduced viral titers. The addition of calcium chloride reversed the anti-viral effects mediated by Verapamil, while EGTA potentiated them. The antiviral activity of Verapamil was observed during the early phase of RSV infection, likely by blocking Ca 2+ channels and inhibiting virus replication., Significance: Verapamil effectively inhibits RSV infection by blocking calcium channels and reducing intracellular calcium levels, thereby impeding viral replication. Thus, Verapamil shows promise as a treatment for RSV., Competing Interests: Declaration of competing interest The authors declare that they have no competing interests., (Copyright © 2024 The Authors. Published by Elsevier Inc. All rights reserved.)

This research presents an innovative reflective fiber optic probe structure, mutinously designed to detect H7N9 avian influenza virus gene precisely. This innovative structure skillfully combines multimode fiber (MMF) with a thin-diameter seven-core photonic crystal fiber (SCF-PCF), forming a semi-open Fabry-Pérot (FPI) cavity. This structure has demonstrated exceptional sensitivity in light intensity-refractive index (RI) response through rigorous theoretical and experimental validation. The development of a quasi-distributed parallel sensor array, which provides temperature compensation during measurements, has achieved a remarkable RI response sensitivity of up to 532.7 dB/RIU. The probe-type fiber optic sensitive unit, expertly functionalized with streptavidin, offers high specificity in detecting H7N9 avian influenza virus gene, with an impressively low detection limit of 10 -2 pM. The development of this biosensor marks a significant development in biological detection, offering a practical engineering solution for achieving high sensitivity and specificity in light-intensity-modulated biosensing. Its potential for wide-ranging applications in various fields is now well-established., Competing Interests: Declaration of competing interest All authors disclosed no relevant relationships., (Copyright © 2024 Elsevier B.V. All rights reserved.)

COVID-19 casualties vary among different ancestral groups due to a variety of factors. Here, we present a protocol for analyzing publicly available genome-wide association studies (GWASs) to search for ancestry-specific genetic factors related to severe COVID-19. We describe steps for downloading and comparing two COVID-19 GWASs, calculating expression quantitative trait loci, and single-cell gene expression analysis. We demonstrate this approach using GWASs from Host Genetics Initiative; however, it is applicable to other databases such as the UK Biobank. For complete details on the use and execution of this protocol, please refer to Cheng et al. 1 ., Competing Interests: Declaration of interests The authors declare no competing interests., (Copyright © 2024 The Author(s). Published by Elsevier Inc. All rights reserved.)

Retinal fibrosis is one of the major features of diabetic retinopathy (DR). Our recent research has shown that Poldip2 can affect early DR through oxidative stress, but whether Poldip2 would regulate retinal fibrosis during DR development is still enigmatic. Here, diabetic Sprague-Dawley (SD) rats were induced with streptozotocin (STZ) and treated with adeno-associated virus serotype 9-polymerase-δ interacting protein 2 (Poldip2) shRNA, while human adult retinal pigment epithelial (ARPE-19) cells were treated with high glucose or Poldip2 siRNA. We identified that in STZ-induced DR rats and ARPE-19 cells treated with high glucose, the expression of Poldip2, transforming growth factor-β1 (TGF-β1), phosphorylated-SMAD3/SMAD3, MMP9, COL-1, FN, and CTGF increased while the expression of cadherin decreased. However, deleting Poldip2 inhibited the TGF-β1/SMAD3 signaling pathway and attenuated the above protein expression in vivo and in vitro. Mechanistically, we found that Poldip2 promotes the activation of SMAD3, facilitates its nuclear translocation through interacting with it, and significantly enhances the expression of fibrosis makers. Collectively, Poldip2 was identified is a novel regulator of DR fibrosis and is expected to become a therapeutic target for PDR., (© 2024 by the American Diabetes Association.)

Human respiratory syncytial virus (RSV) is a common cause of respiratory infections in infants, young children, and elderly people. However, there are no effective treatments or vaccines available in most countries. In this study, we explored the anti-RSV potential of 2, 4-Di-tert-butylphenol (2, 4-DTBP), a compound derived from Houttuynia cordata Thunb. To overcome the poor solubility of 2, 4-DTBP, we encapsulated it in polymeric micelles and delivered it by inhalation. We found that 2, 4-DTBP-loaded micelles inhibited RSV infection in vitro and improved survival, lung pathology, and viral clearance in RSV-infected mice. Our results suggested that 2, 4-DTBP-loaded micelle is a promising novel therapeutic agent for RSV infection., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Purpose: To compare the effects of three common refractive surgeries on corneal biomechanics., Methods: Two hundred seven patients who had refractive surgery were included in this study, of whom 65 received transepithelial photorefractive keratectomy (tPRK), 73 received femtosecond laser-assisted laser in situ keratomileusis (FSLASIK), and 69 received small incision lenticule extraction (SMILE). Each patient had biomechanical measurements using the Corvis ST (Oculus Optikgeräte GmbH) preoperatively and at 3 and 6 months postoperatively. The measurements included five parameters expected to be associated with corneal biomechanics: deformation amplitude ratio at 2 mm (DAR2), integrated inverse radius (IIR), stiffness parameter at first applanation (SP-A1), highest concavity time (HCT), and the updated stress-strain index (SSIv2). The variations in these parameters postoperatively among the three surgeries, and their relationship with corneal thickness (CCT) and intraocular pressure measured by the Dynamic Contour Tonometer (DCT-IOP) were analyzed., Results: SP-A1 decreased significantly from preoperatively to 3 months postoperatively in all three groups, whereas DAR2 and IIR increased significantly, all indicating stiffness losses. Between 3 and 6 months postoperatively, the results were inconsistent, with DAR2 decreasing (indicating stiffness increases) and IIR increasing (denoting stiffness decreases) in the FS-LASIK and SMILE groups. The decrease in SSIv2 (the only measure of corneal material stiffness) postoperatively was comparatively less pronounced at both 3 and 6 months postoperatively. On the other hand, HCT remained generally stable after all three surgeries. Unlike DAR2, IIR, and SP-A1, the changes postoperatively in stiffness parameters HCT and SSIv2 were independent of the corresponding changes in both DCT-IOP and CCT., Conclusions: Among the stiffness parameters considered, SSIv2 was not correlated with CCT or DCT-IOP, and holds promise for representing the corneal material stiffness and how it remains largely unaffected by refractive surgeries. Overall, FS-LASIK had the most significant impact on corneal stiffness, followed by SMILE, and finally tPRK. [ J Refract Surg . 2024;40(5):e344-e352.] .

Implantable neuromodulation devices have significantly advanced treatments for neurological disorders such as Parkinson's disease, epilepsy, and depression. Traditional open-loop devices like deep brain stimulation (DBS) and spinal cord stimulators (SCS) often lead to overstimulation and lack adaptive precision, raising safety and side-effect concerns. Next-generation closed-loop systems offer real-time monitoring and on-device diagnostics for responsive stimulation, presenting a significant advancement for treating a range of brain diseases. However, the high false alarm rates of current closed-loop technologies limit their efficacy and increase energy consumption due to unnecessary stimulations. In this study, we introduce an artificial intelligence-integrated circuit co-design that targets these issues and using an online demonstration system for closed-loop seizure prediction to showcase its effectiveness. Firstly, two neural network models are obtained with neural-network search and quantization strategies. A binary neural network is optimized for minimal computation with high sensitivity and a convolutional neural network with a false alarm rate as low as 0.1/h for false alarm rejection. Then, a dedicated low-power processor is fabricated in 55 nm technology to implement the two models. With reconfigurable design and event-driven processing feature the resulting application-specific integrated circuit (ASIC) occupies only 5mm 2 silicon area and the average power consumption is 142 μW. The proposed solution achieves a significant reduction in both false alarm rates and power consumption when benchmarked against state-of-the-art counterparts., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Yang, Zhao, Wang, Lin, Hou and Sawan.)

Smilax glabra Roxb is a medicinal plant distributed in 17 countries and used in the production of food and tea (Wu et al. 2022). In May 2021, a leaf spot disease was observed on ~60% of S. glabra plants in a field (∼0.4 ha) in Qinzhou City, Guangxi Province. Initially, small, circular, brown spots appeared on the leaf surfaces, which then gradually expanded into large, sunken, dark brown necrotic areas. As disease progressed, lesions merged into large spots, eventually leading to defoliation. To determine the causal agent, six symptomatic plants were collected from the field. Small pieces (∼5 mm2) were cut from the infected leaves (n = 12), sterilized for two min in 1% NaOCl, and rinsed three times in sterile water. Then, the leaf tissues were placed on potato dextrose agar (PDA) with chloramphenicol (0.1 g/liter) and incubated for 3 days at 28°C (12-h photoperiod). Pure cultures were obtained by transferring hyphal tips from recently germinated spores or colony edges onto PDA. Among the 17 isolates, 15 exhibited similar morphologies. Two single-spore isolates (TFL45.1 and TFL46.2) were subjected to further morphological and molecular characterization. Colonies on PDA were grayish green with a white outer ring and cottony surface, and pale blackish green on the reverse side. Conidia were hyaline, aseptate, straight, and cylindrical, with rounded ends, and 11.4 to 16.5 μm × 4.1 to 6.1 μm (average 13.9 × 4.8 μm, n = 100). Appressoria were brown to dark brown, with a smooth edge and different shapes such as ovoid, elliptical or irregular, and 6.8 to 8.9 μm × 5.9 to 7.8 μm (average 7.7 × 6.6 μm, n = 25). For molecular identification, eight target gene sequences, internal transcribed spacer (ITS), glyceraldehydes-3-phosphate dehydrogenase (GAPHD), calmodulin (CAL), partial actin (ACT), chitin synthase (CHS-1), glutamine synthetase (GS), manganese superoxide dismutase (SOD2), and β-tubulin (TUB) were selected for PCR amplification (Weir et al. 2012). The resulting sequences were deposited in GenBank (OR399160-61 and OR432537-50). BLASTn analysis of the obtained sequences showed 99-100% identity with those of the ex-type strain C. fructicola ICMP:18581 (JX010165, JX010033, FJ917508, FJ907426, JX009866, JX010095, JX010327, JX010405) (Weir et al. 2012). In addition, a phylogenetic analysis confirmed the isolates as C. fructicola. Therefore, based on morphological and molecular characteristics (Park et al. 2018; Weir et al. 2012), the isolates were identified as C. fructicola. To verify pathogenicity, three healthy leaves on each of six two-year-old S. glabra plants were inoculated with ∼5 mm2 mycelial discs or aliquots of 10 μl suspension (106 conidia/ml) of the strain TFL46.2, and six control plants were inoculated with sterile PDA discs or sterile water. All plants were enclosed in plastic bags and incubated in a greenhouse at 25°C (12-h photoperiod). Six days post-inoculation, leaf spot symptoms appeared on the inoculated leaves. No symptoms were detected in the controls. Experiments were replicated three times with similar results. To fulfill Koch's postulates, C. fructicola was consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing of the eight genes, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of C. fructicola causing leaf spot disease on S. glabra. Further studies will be needed to develop strategies against this disease based on the identification of this pathogen.

Objective: We propose a procedure for calibrating 4 parameters governing the mechanical boundary conditions (BCs) of a thoracic aorta (TA) model derived from one patient with ascending aortic aneurysm. The BCs reproduce the visco-elastic structural support provided by the soft tissue and the spine and allow for the inclusion of the heart motion effect., Methods: We first segment the TA from magnetic resonance imaging (MRI) angiography and derive the heart motion by tracking the aortic annulus from cine-MRI. A rigid-wall fluid-dynamic simulation is performed to derive the time-varying wall pressure field. We build the finite element model considering patient-specific material properties and imposing the derived pressure field and the motion at the annulus boundary. The calibration, which involves the zero-pressure state computation, is based on purely structural simulations. After obtaining the vessel boundaries from the cine-MRI sequences, an iterative procedure is performed to minimize the distance between them and the corresponding boundaries derived from the deformed structural model. A strongly-coupled fluid-structure interaction (FSI) analysis is finally performed with the tuned parameters and compared to the purely structural simulation., Results and Conclusion: The calibration with structural simulations allows to reduce maximum and mean distances between image-derived and simulation-derived boundaries from 8.64 mm to 6.37 mm and from 2.24 mm to 1.83 mm, respectively. The maximum root mean square error between the deformed structural and FSI surface meshes is 0.19 mm. This procedure may prove crucial for increasing the model fidelity in replicating the real aortic root kinematics.

A hypoglossal nerve stimulator (HGNS) is an invasive device that is used to treat obstructive sleep apnea (OSA) through electrical stimulation. The conventional implantable HGNS device consists of a stimuli generator, a breathing sensor, and electrodes connected to the hypoglossal nerve via leads. However, this implant is bulky and causes significant trauma. In this paper, we propose a minimally invasive HGNS based on an electrocardiogram (ECG) sensor and wireless power transfer (WPT), consisting of a wearable breathing monitor and an implantable stimulator. The breathing external monitor utilizes an ECG sensor to identify abnormal breathing patterns associated with OSA with 88.68% accuracy, achieved through the utilization of a convolutional neural network (CNN) algorithm. With a skin thickness of 5 mm and a receiving coil diameter of 9 mm, the power conversion efficiency was measured as 31.8%. The implantable device, on the other hand, is composed of a front-end CMOS power management module (PMM), a binary-phase-shift-keying (BPSK)-based data demodulator, and a bipolar biphasic current stimuli generator. The PMM, with a silicon area of 0.06 mm2 (excluding PADs), demonstrated a power conversion efficiency of 77.5% when operating at a receiving frequency of 2 MHz. Furthermore, it offers three-voltage options (1.2 V, 1.8 V, and 3.1 V). Within the data receiver component, a low-power BPSK demodulator was ingeniously incorporated, consuming only 42 μW when supplied with a voltage of 0.7 V. The performance was achieved through the implementation of the self-biased phase-locked-loop (PLL) technique. The stimuli generator delivers biphasic constant currents, providing a 5 bit programmable range spanning from 0 to 2.4 mA. The functionality of the proposed ECG- and WPT-based HGNS was validated, representing a highly promising solution for the effective management of OSA, all while minimizing the trauma and space requirements.

Objective: In the management of the aortic aneurysm, 4D flow magnetic resonance Imaging provides valuable information for the computation of new biomarkers using computational fluid dynamics (CFD). However, accurate segmentation of the aorta is required. Thus, our objective is to evaluate the performance of two automatic segmentation methods on the calculation of aortic wall pressure., Methods: Automatic segmentation of the aorta was performed with methods based on deep learning and multi-atlas using the systolic phase in the 4D flow MRI magnitude image of 36 patients. Using mesh morphing, isotopological meshes were generated, and CFD was performed to calculate the aortic wall pressure. Node-to-node comparisons of the pressure results were made to identify the most robust automatic method respect to the pressures obtained with a manually segmented model., Results: Deep learning approach presented the best segmentation performance with a mean Dice similarity coefficient and a mean Hausdorff distance (HD) equal to 0.92+/- 0.02 and 21.02+/- 24.20 mm, respectively. At the global level HD is affected by the performance in the abdominal aorta. Locally, this distance decreases to 9.41+/- 3.45 and 5.82+/- 6.23 for the ascending and descending thoracic aorta, respectively. Moreover, with respect to the pressures from the manual segmentations, the differences in the pressures computed from deep learning were lower than those computed from multi-atlas method., Conclusion: To reduce biases in the calculation of aortic wall pressure, accurate segmentation is needed, particularly in regions with high blood flow velocities. Thus, the deep learning segmen-tation method should be preferred., (© 2023. The Author(s), under exclusive licence to European Society for Magnetic Resonance in Medicine and Biology (ESMRMB).)

Background: The metabolic profile of bile acids and their potential role as biomarkers in the pathogenesis of polycystic ovary syndrome (PCOS) have not been thoroughly characterized. Assessing their predictive value for PCOS is of significant importance., Methods: In this study, we enrolled 408 women with PCOS and 204 non-PCOS controls. The serum bile acid profile was measured using high-performance liquid chromatography-tandem mass spectrometry (LC/MS). We analyzed the differences in serum bile acid profiles between PCOS patients using the OPLS-DA model. Additionally, we examined the relationship between bile acid profiles and parameters related to glucose metabolism and hyperandrogenism. ROC analysis was employed to identify potential biomarkers for PCOS pathogenesis. XGboost was utilized for cross-validation., Results: The bile acid profile was found to be altered in PCOS patients. Specifically, the primary and secondary unconjugated bile acid fractions were significantly higher in the PCOS population. We identified five bile acid metabolite candidates that exhibited the most significant differences between PCOS and non-PCOS controls. DCA was associated with deposition index, fasting and postprandial insulin but was influenced by testosterone. CDCA and LCA combined with testosterone showed potential as biomarkers for the pathogenesis of PCOS., Conclusion: The circulating bile acid profile undergoes changes in PCOS. DCA is associated with deposition index, fasting and postprandial insulin and its level is influenced by testosterone. CDCA and LCA combined with testosterone have the potential to serve as biomarkers for the pathogenesis of PCOS., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer YG declared a shared parent affiliation with the authors to the handling editor at the time of review., (Copyright © 2023 Yu, Zhang, Zhu, Li, Lin, Liu and Tao.)

Objective: ascending aortic aneurysm growth prediction is still challenging in clinics. In this study, we evaluate and compare the ability of local and global shape features to predict the ascending aortic aneurysm growth., Material and Methods: 70 patients with aneurysm, for which two 3D acquisitions were available, are included. Following segmentation, three local shape features are computed: (1) the ratio between maximum diameter and length of the ascending aorta centerline, (2) the ratio between the length of external and internal lines on the ascending aorta and (3) the tortuosity of the ascending tract. By exploiting longitudinal data, the aneurysm growth rate is derived. Using radial basis function mesh morphing, iso-topological surface meshes are created. Statistical shape analysis is performed through unsupervised principal component analysis (PCA) and supervised partial least squares (PLS). Two types of global shape features are identified: three PCA-derived and three PLS-based shape modes. Three regression models are set for growth prediction: two based on gaussian support vector machine using local and PCA-derived global shape features; the third is a PLS linear regression model based on the related global shape features. The prediction results are assessed and the aortic shapes most prone to growth are identified., Results: the prediction root mean square error from leave-one-out cross-validation is: 0.112 mm/month, 0.083 mm/month and 0.066 mm/month for local, PCA-based and PLS-derived shape features, respectively. Aneurysms close to the root with a large initial diameter report faster growth., Conclusion: global shape features might provide an important contribution for predicting the aneurysm growth., Competing Interests: Declaration of Competing Interest During the development of the work, Leonardo Geronzi, Antonio Martinez, Kexin Yan and Michel Rochette were employed by Ansys France. The other authors have no commercial, proprietary, or financial relationships that could be construed as a potential conflict of interest. In any case, there has been no financial support for this work that could have influenced its outcome., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Begonia semperflorens Link et Otto (Begoniaceae) is a flowering, ornamental plant widely cultivated in China. In April of 2020, a foliar blight disease on B. semperflorens was observed in plant nurseries (∼0.2 ha), with ~ 20% disease incidence (n = 150) in Nanning, Guangxi Province, China. Initial symptoms included irregular to circular, grayish white spots surrounded by a dark brown halo, mainly scattered on the edges the leaves. In severe infections, the spots frequently coalesced to form large, blighted areas, followed by defoliation. To isolate the pathogen, three representative plants exhibiting symptoms were collected from the nurseries. Leaf tissues (5 × 5 mm) were cut from the margin of necrotic lesions (n = 18), surface disinfected in 1% NaOCl for 2 min, then rinsed three times in sterile H2O. Then the tissues were plated on potato dextrose agar (PDA), and incubated at 28°C (12 h photoperiod) for 3 days. Hyphal tips from recently germinated spores were transferred to PDA to purify fungal isolates. A total of 11 isolates (85% isolation frequency) with similar morphological characteristics were obtained. Colonies on PDA plates were villose, had a dense growth of white aerial mycelia and appeared pale but becoming violet with age. On Spezieller Nährstoffarmer Agar (SNA), the macroconidia were slender, slight falcate, two to three septate, and 23.5 to 48.8 × 2.8 to 4.8 μm (n = 60), and the microconidia were abundant and formed in false heads on monophialides or polyphialides, slim, oval, zero to one septate, and 7.8 to 22.4 × 2.4 to 4.0 μm (n = 60). For molecular identification, the internal transcribed spacer (ITS) region of rDNA, and partial translation elongation factor-1 alpha (TEF-1α), and RNA polymerase second largest subunit (RPB2) genes of the representative isolate HT-2B were amplified and sequenced using primer pairs ITS1/ITS4 (White et al. 1990), EF-1/EF-2 (O'Donnell et al. 1998), and 5f2/11ar (Liu et al. 1999, Reeb et al. 2004), respectively. The obtained sequences were deposited in NCBI GenBank under the accession numbers OQ048268 (TIS), OP994260 (TEF-1α), OP994262 (RPB2) and showed 99.4%, 99.8%, and 99.4% similarity with the corresponding sequences (X94168，AF160278，and JX171580, respectively) of Fusarium sacchari from type material. In addition, a phylogenetic analysis showed that HT-2B was grouped with F. sacchari. Therefore, based on morphological (Leslie et al. 2005) and molecular characteristics, the isolates were identified as F. sacchari. To test pathogenicity, three healthy leaves on each of three B. semperflorens plants were stab-wounded with a sterile syringe and inoculated with a 10-μl droplet of a conidial suspension (106 spores/ml) of the isolate HT-2B. As a control, another three leaves were wound inoculated with sterilized dH2O. All plants were enclosed in transparent plastic bags and incubated in a greenhouse at 28°C (12 h photoperiod, ~ 80% relative humidity). Six days post-inoculation, symptoms appeared on the inoculated leaves. No symptoms were detected on control plants. Experiments were replicated three times with similar results. To fulfill Koch's postulates, the F. sacchari isolates were consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of F. sacchari causing foliar blight on B. semperflorens in China. This result will help develop management strategies for this disease.

One-step conversion of low-purity polyolefins to value-added products without pretreatments represents a great opportunity for chemical recycling of waste plastics. However, additives, contaminants, and heteroatom-linking polymers tend to be incompatible with catalysts that break down polyolefins. Here, we disclose a reusable, noble metal-free and impurity-tolerant bifunctional catalyst, MoS x -Hbeta, for hydroconversion of polyolefins into branched liquid alkanes under mild conditions. The catalyst works for a wide scope of polyolefins, including different kinds of high-molecular weight polyolefins, polyolefins mixed with various heteroatom-linking polymers, contaminated polyolefins, and postconsumer polyolefins with/without cleaning under 250°C and 20 to 30 bar H 2 in 6 to 12 hours. A 96% yield of small alkanes was successfully achieved even at a temperature as low as 180°C. These results demonstrate the great potentials of hydroconversion in practical use of waste plastics as a largely untapped carbon feedstock.

A thoracic aortic aneurysm is an abnormal dilatation of the aorta that can progress and lead to rupture. The decision to conduct surgery is made by considering the maximum diameter, but it is now well known that this metric alone is not completely reliable. The advent of 4D flow magnetic resonance imaging has allowed for the calculation of new biomarkers for the study of aortic diseases, such as wall shear stress. However, the calculation of these biomarkers requires the precise segmentation of the aorta during all phases of the cardiac cycle. The objective of this work was to compare two different methods for automatically segmenting the thoracic aorta in the systolic phase using 4D flow MRI. The first method is based on a level set framework and uses the velocity field in addition to 3D phase contrast magnetic resonance imaging. The second method is a U-Net-like approach that is only applied to magnitude images from 4D flow MRI. The used dataset was composed of 36 exams from different patients, with ground truth data for the systolic phase of the cardiac cycle. The comparison was performed based on selected metrics, such as the Dice similarity coefficient (DSC) and Hausdorf distance (HD), for the whole aorta and also three aortic regions. Wall shear stress was also assessed and the maximum wall shear stress values were used for comparison. The U-Net-based approach provided statistically better results for the 3D segmentation of the aorta, with a DSC of 0.92 ± 0.02 vs. 0.86 ± 0.5 and an HD of 21.49 ± 24.8 mm vs. 35.79 ± 31.33 mm for the whole aorta. The absolute difference between the wall shear stress and ground truth slightly favored the level set method, but not significantly (0.754 ± 1.07 Pa vs. 0.737 ± 0.79 Pa). The results showed that the deep learning-based method should be considered for the segmentation of all time steps in order to evaluate biomarkers based on 4D flow MRI.

Background: 4D flow MRI allows the analysis of hemodynamic changes in the aorta caused by pathologies such as thoracic aortic aneurysms (TAA). For personalized management of TAA, new biomarkers are required to analyze the effect of fluid structure iteration which can be obtained from 4D flow MRI. However, the generation of these biomarkers requires prior 4D segmentation of the aorta., Objective: To develop an automatic deep learning model to segment the aorta in 4D from 4D flow MRI., Methods: Segmentation is addressed with a U-Net based segmentation model that treats each 4D flow MRI frame as an independent sample. Performance is measured with respect to Dice score (DS) and Hausdorff distance (HD). In addition, the maximum and minimum surface areas at the level of the ascending aorta are measured and compared with those obtained from cine-MRI., Results: The segmentation performance was 0.90 ± 0.02 for the DS and the mean HD was 9.58 ± 4.36 mm. A correlation coefficient of r = 0.85 was obtained for the maximum surface and r = 0.86 for the minimum surface between the 4D flow MRI and cine-MRI., Conclusion: The proposed automatic approach of 4D aortic segmentation from 4D flow MRI seems to be accurate enough to contribute to the wider use of this imaging technique in the analysis of pathologies such as TAA., (Copyright © 2023 Elsevier Inc. All rights reserved.)

Conventional approaches for screening anticancer drugs rely on chemical reactions, which are time consuming, labor intensive, and costly. Here, we present a protocol for label-free and high-throughput assessment of drug efficacy using a vision transformer and a Conv2D. We describe the steps for cell culture, drug treatment, data collection, and preprocessing. We then detail the building of deep learning models and their use to predict drug potency. This protocol can be adapted for screening chemicals that affect the density or morphological features of cells. For complete details on the use and execution of this protocol, please refer to Wang et al. 1 ., Competing Interests: Declaration of interests The authors, on behalf of the University of California, Davis, are preparing a patent application covering aspects of the work presented here., (Copyright © 2023 The Authors. Published by Elsevier Inc. All rights reserved.)

With the development of three-dimensional (3D) printing, 3D-printed products have been widely used in medical fields, such as plastic surgery, orthopedics, dentistry, etc . In cardiovascular research, 3D-printed models are becoming more realistic in shape. However, from a biomechanical point of view, only a few studies have explored printable materials that can represent the properties of the human aorta. This study focuses on 3D-printed materials that might simulate the stiffness of human aortic tissue. First, the biomechanical properties of a healthy human aorta were defined and used as reference. The main objective of this study was to identify 3D printable materials that possess similar properties to the human aorta. Three synthetic materials, NinjaFlex (Fenner Inc., Manheim, USA), Filastic TM (Filastic Inc., Jardim Paulistano, Brazil), and RGD450+TangoPlus (Stratasys Ltd. © , Rehovot, Israel), were printed in different thicknesses. Uniaxial and biaxial tensile tests were performed to compute several biomechanical properties, such as thickness, stress, strain, and stiffness. We found that with the mixed material RGD450+TangoPlus, it was possible to achieve a similar stiffness to healthy human aorta. Moreover, the 50-shore-hardness RGD450+TangoPlus had similar thickness and stiffness to the human aorta., Competing Interests: The authors declare no conflict of interests., (Copyright:© 2023, Lin S, Tarris G, Bernard C, et al.)

The purification of carbon monoxide in H 2 -rich streams is an urgent problem for the practical application of fuel cells, and requires the development of efficient and economical catalysts for the preferential oxidation of CO (CO-PROX). In the present work, a facile solid phase synthesis method followed by an impregnation method were adopted to prepare a ternary CuCoMnO x spinel oxide, which shows superior catalytic performance with CO conversion of 90% for photothermal CO-PROX at 250 mW cm -2 . The dopant of copper species leads to the incorporation of Cu ions into the CoMnO x spinel lattice forming a ternary CuCoMnO x spinel oxide. The appropriate calcination temperature (300 °C) contributes to the generation of abundant oxygen vacancies and strong synergetic Cu-Co-Mn interactions, which are conducive to the mobility of oxygen species to participate in CO oxidation reactions. On the other hand, the highest photocurrent response of CuCoMnO x -300 also promotes the photo-oxidation activity of CO due to the high carrier concentration and efficient carrier separation. In addition, the in situ diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) confirmed that doping copper species could enhance the CO adsorption capacity of the catalyst due to the generation of Cu + species, which significantly increased the CO oxidation activity of the CuCoMnO x spinel oxide. The present work provides a promising and eco-friendly solution to remove the trace CO in H 2 -rich gas over CuCoMnO x ternary spinel oxide with solar light as the only energy source.

The current guidelines for the ascending aortic aneurysm (AsAA) treatment recommend surgery mainly according to the maximum diameter assessment. This criterion has already proven to be often inefficient in identifying patients at high risk of aneurysm growth and rupture. In this study, we propose a method to compute a set of local shape features that, in addition to the maximum diameter D , are intended to improve the classification performances for the ascending aortic aneurysm growth risk assessment. Apart from D , these are the ratio DCR between D and the length of the ascending aorta centerline, the ratio EILR between the length of the external and the internal lines and the tortuosity T . 50 patients with two 3D acquisitions at least 6 months apart were segmented and the growth rate (GR) with the shape features related to the first exam computed. The correlation between them has been investigated. After, the dataset was divided into two classes according to the growth rate value. We used six different classifiers with input data exclusively from the first exam to predict the class to which each patient belonged. A first classification was performed using only D and a second with all the shape features together. The performances have been evaluated by computing accuracy, sensitivity, specificity, area under the receiver operating characteristic curve (AUROC) and positive (negative) likelihood ratio LHR+ (LHR-). A positive correlation was observed between growth rate and DCR ( r = 0.511, p = 1.3e-4) and between GR and EILR ( r = 0.472, p = 2.7e-4). Overall, the classifiers based on the four metrics outperformed the same ones based only on D . Among the diameter-based classifiers, k-nearest neighbours (KNN) reported the best accuracy (86%), sensitivity (55.6%), AUROC (0.74), LHR+ (7.62) and LHR- (0.48). Concerning the classifiers based on the four shape features, we obtained the best accuracy (94%), sensitivity (66.7%), specificity (100%), AUROC (0.94), LHR+ (+ ∞ ) and LHR- (0.33) with support vector machine (SVM). This demonstrates how automatic shape features detection combined with risk classification criteria could be crucial in planning the follow-up of patients with ascending aortic aneurysm and in predicting the possible dangerous progression of the disease., Competing Interests: Authors LG, AM, KY, and MR were employed by Ansys France. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Geronzi, Haigron, Martinez, Yan, Rochette, Bel-Brunon, Porterie, Lin, Marin-Castrillon, Lalande, Bouchot, Daniel, Escrig, Tomasi, Valentini and Biancolini.)

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 μm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 μm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and β-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

Ascending aortic aneurysm is a pathology that is important to be supervised and treated. During the years the aorta dilates, it becomes stiff, and its elastic properties decrease. In some cases, the aortic wall can rupture leading to aortic dissection with a high mortality rate. The main reference standard to measure when the patient needs to undertake surgery is the aortic diameter. However, the aortic diameter was shown not to be sufficient to predict aortic dissection, implying other characteristics should be considered. Therefore, the main objective of this work is to assess in-vivo the elastic properties of four different quadrants of the ascending aorta and compare the results with equivalent properties obtained ex-vivo. The database consists of 73 cine-MRI sequences of thoracic aorta acquired in axial orientation at the level of the pulmonary trunk. All the patients have dilated aorta and surgery is required. The exams were acquired just prior to surgery, each consisting of 30 slices on average across the cardiac cycle. Multiple deep learning architectures have been explored with different hyperparameters and settings to automatically segment the contour of the aorta on each image and then automatically calculate the aortic compliance. A semantic segmentation U-Net network outperforms the rest explored networks with a Dice score of 98.09% (±0.96%) and a Hausdorff distance of 4.88 mm (±1.70 mm). Local aortic compliance and local aortic wall strain were calculated from the segmented surfaces for each quadrant and then compared with elastic properties obtained ex-vivo. Good agreement was observed between Young's modulus and in-vivo strain. Our results suggest that the lateral and posterior quadrants are the stiffest. In contrast, the medial and anterior quadrants have the lowest aortic stiffness. The in-vivo stiffness tendency agrees with the values obtained ex-vivo. We can conclude that our automatic segmentation method is robust and compatible with clinical practice (thanks to a graphical user interface), while the in-vivo elastic properties are reliable and compatible with the ex-vivo ones.

Ascending aortic aneurysm (AsAA) is a high-risk cardiovascular disease with an increased incidence over years. In this study, we compared different risk factors based on the pre-failure behavior (from a biomechanical point of view) obtained ex-vivo from an equi-biaxial tensile test. A total of 100 patients (63 ± 12 years, 72 males) with AsAA replacement, were recruited. Equi-biaxial tensile tests of AsAA walls were performed on freshly sampled aortic wall tissue after ascending aortic replacement. The aneurysmal aortic walls were divided into four quadrants (medial, anterior, lateral, and posterior) and two directions (longitudinal and circumferential) were considered. The stiffness was represented by the maximum Young modulus (MYM). Based on patient information, the following subgroups were considered: age, gender, hypertension, obesity, dyslipidemia, diabetes, smoking history, aortic insufficiency, aortic stenosis, coronary artery disease, aortic diameter and aortic valve type. In general, when the aortic diameter increased, the aortic wall became thicker. In terms of the MYM, the longitudinal direction was significantly higher than that in the circumferential direction. In the multivariant analysis, the impact factors of age (p = 0.07), smoking (p = 0.05), diabetes (p = 0.03), aortic stenosis (p = 0.02), coronary artery disease (p < 10 -3 ), and aortic diameters (p = 0.02) were significantly influencing the MYM. There was no significant MYM difference when the patients presented arterial hypertension, dyslipidemia, obesity, or bicuspid aortic valve. To conclude, the pre-failure aortic stiffness is multi-factorial, according to our population of 100 patients with AsAA. STATEMENT OF SIGNIFICANCE: Our research on the topic of "Aortic local biomechanical properties in case of ascending aortic aneurysms" is about the biomechanical properties on one hundred aortic samples according to the aortic wall quadrants and the direction. More than ten factors and risks which may impact ascending aortic aneurysms have been studied. According to our knowledge, so far, this article involved the largest population on this topic. It will be our pleasure to share this information with all the readers., Competing Interests: Declaration of Competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:, (Copyright © 2022. Published by Elsevier Ltd.)

Association of quadricuspid aortic valve (QAV) with ascending aortic aneurysms (AsAA) is rare. A 63-year-old female with hypertension was found (on MRI) to have an ascending aortic aneurysm (52 mm in maximum diameter) and dilatation at the level of the sinotubular junction (38 mm in diameter) associated with quadricuspid aortic valve. An ascending aortic wall replacement surgery was performed. In this study, we focus on the behavior of the aorta associated with QAV considering the in vitro biomechanical characteristics and histology. The properties of QAV are closer to bicuspid aortic valve than tricuspid aortic valve, but with higher wall thickness.

Research on expressional regulation of genes at the initial sex differentiation of gonads will help to elucidate the mechanisms of sex determination and differentiation in animals. However, information on initial sex differentiation of gonads is limited in bivalves. MicroRNAs (miRNAs) are a class of endogenous small noncoding RNAs that can regulate the target gene expression at the posttranscription level by degrading the mRNA or repressing the mRNA translation. In the present study, we investigated the small RNAs transcriptome using the testes and ovaries of Zhikong scallop Chlamys farreri juveniles with a shell height of 5.0 mm, a critical stage of initial sex differentiation of gonads. A total of 75 known mature miRNAs and 103 novel miRNAs were identified. By comparing the expression of miRNAs between the ovary and testis, 11 miRNAs were determined to be differentially expressed. GO annotations and KEGG analyses indicated that many putative target genes that matched to these differentially expressed miRNAs participated in the regulation of sex differentiation. Furthermore, two selected miRNAs, cfa-novel&#95;miR65 and cfa-miR-87a-3p&#95;1, were confirmed to downregulate expressions of Foxl2 (a female-critical gene) and Klf4 (a male-critical gene), respectively, using a dual-luciferase reporter analysis. Our findings provided new insights into the initial sex differentiation of gonads regulated by miRNAs in bivalves.

The intertidal zone is a transitional area of the land-sea continuum, in which physical and chemical properties vary during the tidal cycle and highly toxic sulfides are rich in sediments due to the dynamic regimes. As a typical species thriving in this habitat, Urechis unicinctus presents strong sulfide tolerance and is expected to be a model species for sulfide stress research. Heat shock proteins (HSPs) consist of a large group of highly conserved molecular chaperones, which play important roles in stress responses. In this study, we systematically analyzed the composition and expression of HSPs in U. unicinctus . A total of eighty-six HSP genes from seven families were identified, in which two families, including sHSP and HSP70, showed moderate expansion, and this variation may be related to the benthic habitat of the intertidal zone. Furthermore, expression analysis revealed that almost all the HSP genes in U. unicinctus were significantly induced under sulfide stress, suggesting that they may be involved in sulfide stress response. Weighted gene co-expression network analysis (WGCNA) showed that 12 HSPs, including 5 sHSP and 4 HSP70 family genes, were highly correlated with the sulfide stress response which was distributed in steelblue and green modules. Our data indicate that HSPs, especially sHSP and HSP70 families, may play significant roles in response to sulfide stress in U. unicinctus . This systematic analysis provides valuable information for further understanding of the function of the HSP gene family for sulfide adaptation in U. unicinctus and contributes a better understanding of the species adaptation strategies of marine benthos in the intertidal zone.

Foxl2 is an evolutionarily conserved female sex gene, which is specifically expressed in the ovary and mainly involved in oogenesis and ovarian function maintenance. However, little is known about the mechanism that regulates Foxl2 specific expression during the ovary development. In the present study, we constructed the gonadal yeast one-hybrid (Y1H) library of Chlamys farreri with ovaries and testes at different developmental stages using the Gateway technology. The library capacity was more than 1.36 × 10 7 CFU, and the length of the inserted fragment was 0.75 Kb~2 Kb, which fully met the demand of yeast library screening. The highly transcriptional activity promoter sequence of C. farreri Foxl2 ( Cf-Foxl2 ) was determined at -1000~-616 bp by dual-luciferase reporter (DLR) assay and was used as bait to screen possible transcription factors from the Y1H library. Eleven candidate factors, including five unannotated factors, were selected based on Y1H as well as their expressional differences between ovaries and testes and were verified for the first time to be involved in the transcriptional regulation of Cf-Foxl2 by RT-qPCR and DLR. Our findings provided valuable data for further studying the specific regulation mechanism of Foxl2 in the ovary.

The study of distinct genes, chromosomes and the spatio-temporal relationships between them is of great significance in genetics, developmental biology and biomedicine. CRISPR/Cas9 has become the most widely used gene editing tool due to its excellent targeting ability. Recently, researchers have developed a series of advanced live cell imaging techniques based on the nuclease-inactivated mutant of Cas9 (dCas9), providing rapid and convenient tools for high-resolution imaging of specific sites in the chromatin and genome. This review summarizes the advances of CRISPR/dCas9 system in live cell imaging from three aspects, including the strategies of cell delivery, optimization of the fluorescence signals, as well as orthogonal and multicolor imaging. Furthermore, we shed light on the development trends and prospects of this field.

Introduction: Aneurysms of the ascending aorta (AA) correspond to a dilatation of the ascending aorta that progressively evolves over several years. The main complication of aneurysms of the ascending aorta is type A aortic dissection, which is associated with very high rates of morbidity and mortality. Prophylactic ascending aorta replacement guidelines are currently based on maximal AA diameter. However, this criterion is imperfect. Stretching tests on the aorta carried out ex-vivo make it possible to determine the elastic properties of healthy and aneurysmal aortic fragments (tension test, resistance before rupture). For several years now, cardiac magnetic resonance imaging (MRI) has provided another means of evaluating the elastic properties of the aorta. This imaging technique has the advantage of being non-invasive and of establishing aortic compliance (local measurement of stiffness) without using contrast material by measuring the variation of the aortic surface area during the cardiac cycle, and pulse wave velocity (overall stiffness of the aorta)., Materials and Methods: Prospective single-center study including 100 patients with ascending aortic aneurysm requiring surgery. We will perform preoperative cine-MRI and biomechanical laboratory stretching tests on aortic samples collected during the cardiac procedure. Images will be acquired with a 3T MRI with only four other acquisitions in addition to the conventional protocol. These additional sequences are a Fast Low Angle Shot (FLASH)-type sequence performed during a short breath-hold in the transverse plane at the level of the bifurcation of the pulmonary artery, and phase-contrast sequences that encodes velocity at the same localization, and also in planes perpendicular to the aorta at the levels of the sino-tubular junction and the diaphragm for the descending aorta. For ex-vivo tests, the experiments will be carried out by a biaxial tensile test machine (ElectroForce®). Each specimen will be stretched with 10 times of 10% preconditioning and at a rate of 10 mm/min until rupture. During the experiment, the tissue is treated under a 37°C saline bath. The maximum elastic modulus from each sample will be calculated., Results: The aim of this study is to obtain local patient-specific elastic modulus distribution of the ascending aorta from biaxial tensile tests and to assess elastic properties of the aorta using MRI, then to evaluate the correlation between biaxial tests and MRI measurements., Discussion: Our research hypothesis is that there is a correlation between the evaluation of the elastic properties of the aorta from cardiac MRI and from stretching tests performed ex-vivo on aorta samples collected during ascending aorta replacement., Competing Interests: The authors have declared that no competing interests exist.

The effects of different concentrations of xanthan and konjac gums on the pasting, rheological properties, microstructure, crystallinity, and digestibility of mung bean resistant starch (MRS) were investigated. Based on the results of pasting properties, the adjunction of gums increased the peak, breakdown, and final viscosities of resistant starch. Compared with resistant starch, the addition of gum significantly increased the K value and dynamic moduli (G', G") of MRS with increasing gum concentration. This finding indicates that the mixtures had higher viscoelasticity. Mixtures with xanthan gum of MRS had larger starch particle compared with MRS, as revealed by SEM. All starches showed B and V-type crystallinity with high crystallinity. MRS had the highest summation of resistant starch (RS) and slowly digestible starch (SDS) of 71.89%. MRS had the lowest hydrolysis rate, which obviously decreased from 71.89% to 57.71% with increasing konjac gum from 0 to 0.30%., (Copyright © 2020 Elsevier Ltd. All rights reserved.)

Cas12a ribonucleoprotein (RNP) is an RNA-guided CRISPR-associated nuclease used widely for genome editing and molecular diagnostics. Conventional detection methods rely on adopting antibody-based reagents that are expensive and lack scalability, and, moreover, only detect Cas12 enzyme rather than RNP, which is the true effector. Here, we describe a method for the rapid and quantitative detection of the effective Cas12a RNPs by the combined use of anti-CRISPR protein AcrVA1 and stem-loop RT-qPCR, achieving a limit of detection (LOD) of 1 fM in reaction buffer and 0.1 pM under biologically representative conditions.

Objective: The aim of our study was to evaluate the impact of aortic root replacement by graft on the elastic properties of the descending thoracic aorta using cardiac magnetic resonance imaging (MRI) and automatic post-processing., Materials and Methods: Nineteen patients were operated for an aortic root aneurysm. Cardiac MRI was performed before and after surgery to measure aortic compliance. Images were acquired on a 1.5 T MRI with a conventional aortic MRI protocol plus one additional kinetic sequence orientated perpendicularly to the aorta at the level of pulmonary trunk. The contours of the ascending and descending aortas were detected automatically for each phase with homemade software., Results: Mean time between surgical procedure and earliest post-operative MRI was 18.2 ± 7.1 months. There was no significant difference between the pre- and earliest post-operative mean descending aorta areas and no significant modification in descending aortic compliance after aortic root replacement (1.43 ± 0.84 vs 1.37 ± 0.58 mm 2 /mmHg, p = 0.47). Pre- and post-operative systolic and diastolic blood pressure were similar. There was a significant decrease in ascending aortic compliance after surgery (2.52 ± 1.24 vs 0.91 ± 0.52 mm 2 /mmHg; p < 0.0001)., Discussion: The aortic root replacement by graft was not associated with changes in elastic properties of the descending aorta at short term., Clinical Registration Number: NCT03817008.

Postoperative cognitive dysfunction (POCD) is a common postoperative complication observed in patients following. Here we tested the molecular mechanisms of memory loss in hippocampus of rat POCD model. We found that high-dose propofol anesthesia significantly alleviated spatial memory loss. The proteomes and transcriptomes in hippocampus showed that hippocampal cytoskeleton related pathways were abnormal in low group while not in high group. The protein assays confirmed that hippocampal actin cytoskeleton was depolymerized in low group while maintained in high group. This study confirms that high-dose propofol anesthesia could mitigate the development of POCD and provides evidences for actin cytoskeleton associated with this syndrome., (Copyright © 2019. Published by Elsevier Ltd.)

We propose and demonstrate a novel approach to transport a strongly absorbing particle in an X-typed trajectory reciprocally in pure liquid glycerol based on a dual-beam optical fiber trap. We perform the X-typed light field by integrating a glass microsphere on the tip of a two-core fiber. The motion of the absorbing particle in pure liquid glycerol is dominated by the Δα-type photophoretic forces (F Δα ). The incident laser power determines the direction of F Δα . Therefore, we may perform the reciprocating transport of the absorbing particle by changing and controlling the laser power. It is simple to manufacture the fiber probe and convenient to operate the transport of the microparticle. Our research expands the applications of absorbing particles in targeted drug delivery, biological sampling, and optically mediated particle clearing.

CRISPR/Cas9 ribonucleoprotein (RNP) complexes are promising biological tools with diverse biomedical applications. However, to date there are no efficient methods that can produce these proteins at large scales and low cost. Here, we present a streamlined method for direct production of Cas9 RNPs from Escherichia coli by co-expression of Cas9 and the target-specific single-guided RNAs. Harnessing an ultrahigh-affinity CL7/Im7 purification system recently developed we achieve one-step purification of the self-assembling CRISPR/Cas RNPs, including the commonly used Cas9 and Cas12a, within half a day and with a ~fourfold higher yield than incumbent methods. The prepared Cas RNPs show remarkable stability in the absence of RNase inhibitors, as well as profound gene-editing efficiency in vitro and in vivo. Our method is convenient, cost-effective, and can be used to prepare other CRISPR/Cas RNPs., Competing Interests: W.Q.L., L.X.M., and Y.L. have applied a provisional patent on direct production of CRISPR/Cas RNPs from E. coli, which partly presented in this paper. The remaining authors declare no competing interests.

Though plenty of viral and non-viral methods have been rapidly developed for the delivery of the CRISPR/Cas9 system, the direct delivery of Cas9 ribonucleoproteins (RNPs) into the nucleus for genome editing via the non-homologous end joining (NHEJ) or homology-directed repair (HDR) pathway, especially the latter one, remains a challenge. Here we report a delivery vehicle achieved by encapsulating red fluorescent protein (RFP) within chitosan (CS), which can simultaneously deliver engineered Cas9 RNPs with a poly-glutamate peptide tag (E-tag) and DNA donors into a range of cell types with high genome editing efficacy and non-cytotoxicity.

Cell surface display systems for immobilization of peptides and proteins on the surface of cells have various applications, such as vaccine generation, protein engineering, bio-conversion and bio-adsorption. Though plenty of methods have been established in terms of traditional yeast surface display systems, the development of a universal display method with high efficiency remains a challenge. Here we report an indirect yeast surface display method by anchoring Im7 proteins on the surface of P. pastoris , achieving highly efficient display of target proteins, including fluorescence proteins (sfGFP and mCherry) or enzymes (human Arginase I), with a CL7 fusion tag through the ultra-high-affinity interaction between Im7 and CL7. This indirect P. pastoris surface display approach is highly efficient and provides a robust platform for displaying biomolecules., Competing Interests: Yi Liu and Lixin Ma have applied a provisional patent on the indirect display of enzymes on yeast cell surface which was partly presented in this manuscript. The remaining authors have declared no conflict of interest.

A novel hydrogel (HA-az-F127 hydrogel) formed by reacting hydrazide modified hyaluronic acid (HAAD) and benzaldehyde terminated F127 triblock copolymers (BAF127) was developed in this work. The hydrogel with dynamic covalent chemically and micellar physically double-cross-linked networks exhibited rapid gelation and shear thinning properties. Besides, the hydrogel possessed functions, such as adaptable mechanical strength, self-healability, liquid-absorption, or drainage and tissue adhesion, which are important for wound treatment. Studies on cytocompatibility and histopathology by 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl tetrazolium bromide tests, live/death staining, and cell counting kit 8 assay demonstrated excellent biocompatibility of the hydrogels. After it was applied in the deep partial-thickness burn model, the hydrogel contributed effectively in promoting burn wound repair. Therefore, the HA-az-F127 hydrogel combined multiple functions in one system, demonstrating potential application in promoting burn wound healing.

Brackish water samples from Lake Pontchartrain in Louisiana were assessed for the presence of pathogenic amoeba Naegleria fowleri, which causes primary amoebic meningoencephalitis (PAM). In our study, quantitative polymerase chain reaction (qPCR) methods were used to determine N. fowleri, E. coli, and enterococci in water collected from Lake Pontchartrain. N. fowleri target sequence was detected in 35.4% (56/158) of the water samples from ten sites around the lake. Statistically significant positive correlations between N. fowleri concentration and water temperature as well as E. coli (qPCR) were observed. Multiple linear regression (MLR) model shows seasonal factor (summer or winter) has significant effect on the concentration of N. fowleri, E. coli and enterococci (qPCR) concentration. Significant positive relationships between E. coli and enterococci was observed from both qPCR (r=0.25) and culture based method (r=0.54). Meanwhile, significant positive correlation between qPCR and culture based methods for enterococci concentration was observed (r=0.33). In our study, water temperature and E. coli concentration were indicative of N. fowleri concentrations in brackish water environment. Future research is needed to determine whether sediment is a source of N. fowleri found in the water column., (Copyright © 2017 Elsevier B.V. All rights reserved.)

Water quality in Lake Pontchartrain was deteriorating and recreational activities along the beach were restricted by the end of the 20th Century. A microbial source tracking (MST) study was conducted to determine the fecal contamination sources at public beach of the lake, so that effective pollution control strategies can be developed. Water samples were collected over an eight-month period at ten locations along the lake in 2016 and 2017. E. coli and Enterococcus were detected in 90.6% (culture) and 97.5% (qPCR), 95.8% (culture) and 91.8% (qPCR) of water samples from all sampling sites, respectively. Significant positive relationship between E. coli and Enterococcus results was observed for both qPCR and culture methods. HF183 marker was detected in 94.3% water samples (149 of 158), with concentrations ranging from 29.0 to 6073.5GC/100ml and from 129.8 to 38,465.6GC/100ml in summer and winter, respectively. The results also indicate that significant rainfall events have the potential to supply considerable loads of fecal bacteria to lake waters. Further research is needed to determine the contribution of other animals to fecal contamination in the region., (Copyright © 2017 Elsevier Ltd. All rights reserved.)

Pd/CeO2-ZrO2-Pr2O3 (CZP) catalysts with different Ce/Zr molar ratios were synthesized and systematically investigated by XRD, N2 adsorption-desorption, XPS, H2-TPR, OSC and in situ DRIFTS techniques. The results of XPS, in situ DRIFTS, etc., show that the number of oxygen vacancies increases with the increasing Zr content and thus leads to the enhanced metal-support interaction and the accelerative formation rate of nitrate, formate, acetate and carbonate species, resulting in improving catalytic performance for HC and NO elimination, especially for Pd/CZP catalysts with Ce/Zr from 1/2 to 1/3. While Pd/CZP catalysts with higher OSC value (Ce/Zr=4/1-1/2) exhibit better catalytic activity of CO and NO2 elimination. An appropriate concentration of Zr facilitates the diffusion of Pr from the surface to the bulk of the CZP supports, thus forming more homogeneous CZP solid solution and improving the structure/textual stability, which promotes the thermal stability of catalysts. Pd/CZP catalysts with Ce/Zr from 2/1 to 1/2 exhibit good thermal stability., (Copyright © 2014 Elsevier B.V. All rights reserved.)

The influence of alkaline earth metal (M=Mg, Ca, Sr and Ba) promoter on the structural/textural properties of Ce0.67Zr0.33O2 (designated as CZ) and the catalytic behavior of its supported Pd-only three-way catalyst (Pd/CZM) have been investigated. The results show that the modification with alkaline earth metal obviously improves the catalytic activity for hydrocarbon (HC) and nitrogen oxides (NOx) conversion, especially the introduction of Ba. Furthermore, the operation window of the promoted catalysts has also been widened. The doping of alkaline earth metal leads to the formation of more homogeneous Ce-Zr-M ternary solid solution with higher surface area and smaller crystallite size, and the corresponding Pd/CZM catalysts present improved reducibility of PdO species. The modification with Ca, Sr and Ba improves the thermal aging resistance, especially Ba. DRIFTS results reveal that the doping of alkaline earth metal enhances the oxygen and electron transfer ability and favors the dissociation of NO, which promotes the activation and storage capacity of the acidic atoms like NOx, and leads to enhanced catalytic activity performance., (Copyright © 2014 Elsevier B.V. All rights reserved.)