Search

Background and Purpose: We aimed to determine the reliability and validity of the Stellenbosch Endometriosis Quality of Life (SEQOL) among patients with endometriosis in the United Kingdom. Methods: We used a cross-sectional research design that featured online data collection. We administered several measures to 596 participants. Data analysis included confirmatory factor analysis, exploratory factor analysis, reliability analysis, and correlations. Results: The data did not fit the original eight-factor structure, but rather a six-factor structure. Six items were removed. The measure produced strong internal consistency reliabilities. The SEQOL also demonstrated promising validity, producing strong correlations with another health-related quality of life (HRQOL) measure. Conclusion: In summary, we conclude that the United Kingdom version of the SEQOL is a viable measure of HRQOL., (© Copyright 2024 Springer Publishing Company, LLC.)

The purpose of this study was to better understand barriers and enabling conditions for HPV vaccination in school-based vaccination programs in Canada. Semi-structured interviews were conducted by telephone or in person with parents, nurses, and school staff (n = 50) in three Canadian provinces. Interviews explored views on HPV and HPV vaccination, strengths and weaknesses of the school-based HPV vaccination programs and proposed interventions to increase uptake. Interview transcripts were coded and analyzed thematically using the socio-ecological model. Participants had positive views towards HPV vaccination and school-based offer. They identified barriers and enabling conditions at the individual and interpersonal level (e.g., knowledge, attitudes, behaviours of - and relationships between - parents, nurses, and school personnel), at the organizational level (e.g., allocated resources, information provision, process to ensure informed consent, vaccination setting and environment) and at the community and policy level (e.g., social group values and norms, media coverage around the HPV vaccine). Participants also suggested strategies to reduce identified barriers (e.g., communication interventions, simpler inform consent process). Different layers of barriers and enabling conditions of HPV vaccination in school settings were identified. Tailored interventions remain key to enhance vaccine acceptance and uptake., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Author(s). Published by Elsevier Ltd.. All rights reserved.)

Introduction: Febrile infants under 3 months of age are at risk of invasive bacterial infection (IBI). It is currently unclear if testing for respiratory viruses may have a role in IBI risk stratification. If found to be associated with the likelihood of IBI, respiratory viral point-of-care testing may improve patient and caregiver experience, reduce costs and enhance antimicrobial stewardship., Methods and Analysis: This is a study protocol for a systematic review and meta-analysis that aims to answer the following question: In young febrile infants presenting to emergency care settings does a positive respiratory viral test for RSV, Influenza or SARS-CoV2 (relative to a negative test) add value to current risk stratification pathways for the exclusion of invasive bacterial infection, subsequently enabling safe de-escalation of investigation and treatment ?A search strategy will include MEDLINE, EMBASE, Web of Science, The Cochrane Library and grey literature. Abstracts and then full texts will be independently screened for selection. Data extraction and quality assessment will be completed by two independent authors.The primary objective is to analyse the ability of a positive respiratory viral test to identify the overall risk of IBI. The secondary objective is to perform a subgroup analysis to investigate how the risk stratification alters based on other variables including virus type, patient characteristics and the presence of an identified source of fever.Bivariate random-effects meta-analysis will be undertaken. Diagnostic odds ratios (OR), sensitivity, specificity and positive and negative likelihood ratios will be calculated. The degree of heterogeneity and publication bias will be investigated and presented., Ethics and Dissemination: Ethical approval is not required. We will follow the Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines to disseminate the study results through publication and conference presentations., Prospero Registration Number: This protocol is registered in PROSPERO-ID number: CRD42023433716., Competing Interests: Competing interests: None declared., (© Author(s) (or their employer(s)) 2024. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.)

The COVID-19 pandemic brought unplanned service disruption for breast cancer diagnostic, treatment and support services. This scoping review describes these changes and their impact in the UK and the Republic of Ireland based on studies published between January 2020 and August 2023. Thirty-four of 569 papers were included. Data were extracted and results thematically organized. Findings include fewer new cases; stage shift (fewer early- and more late-stage disease); and changes to healthcare organization, breast screening and treatment. Examples are accepting fewer referrals, applying stricter referral criteria and relying more on virtual consultations and multi-disciplinary meetings. Screening service programs paused during the pandemic before enacting risk-based phased restarts with longer appointment times to accommodate reduced staffing numbers and enhanced infection-control regimes. Treatments shifted from predominantly conventional to hypofractionated radiotherapy, fewer surgical procedures and increased use of bridging endocrine therapy. The long-term impact of such changes are unknown so definitive guidelines for future emergencies are not yet available. Cancer registries, with their large sample sizes and population coverage, are well placed to monitor changes to stage and survival despite difficulties obtaining definitive staging during diagnosis because surgery and pathological assessments are delayed. Multisite longitudinal studies can also provide guidance for future disaster preparedness., (© 2024. The Author(s).)

Despite the availability of school-based immunization programs (SBIPs) in Canada, human papillomavirus (HPV) vaccine uptake remains suboptimal. Vaccine education may improve vaccine uptake among adolescents. The objective of this qualitative study was to identify opportunities for HPV vaccine education in British Columbia, Canada, by exploring the perspectives of students, parents, school staff, and public health nurses on the current SBIP. Individual semi-structured interviews were conducted with adult participants and focus groups were conducted with grade 6 students between November 2019 and May 2020. The interviews and focus groups were transcribed and then analyzed using reflexive thematic analysis. Opportunities for HPV vaccine education were identified in three themes: 1) making SBIPs student-centered; 2) adopting a collaborative and interdisciplinary approach to vaccine education; and 3) actualizing parent education opportunities. Broad support existed for a formal, collaborative HPV grade 6 vaccine curriculum delivered by teachers and public health nurses to provide evidence-based health information. Participants voiced that the curriculum should integrate students' perspectives on topics of interest and address needle associated pain and anxiety. Parents were identified as the primary vaccine decisionmakers, therefore, participants stated it was crucial to also provide parent-directed vaccine education as part of SBIP. Our findings support the development of a collaborative HPV vaccine curriculum directed to and informed by students and parents to buttress current SBIPs in British Columbia.

Background: Technology has the potential to prevent patient falls in healthcare settings and to reduce work-related injuries among healthcare providers. However, the usefulness and acceptability of each technology requires careful evaluation. Framed by the Technology Acceptance Model (TAM) and using the Adaptive Robotic Nursing Assistant (ARNA) to assist with patient ambulation, the present study examined the perceived usefulness of robots in patients' fall prevention with implications for preventing associated work-related injuries among healthcare providers., Methods: Employing an experimental design, subjects were undergraduate nursing students ( N = 38) and one external subject (not a nursing student) who played the role of the patient. Procedures included subjects ambulating a simulated patient in three ways: (a) following the practice of a nurse assisting a patient to walk with the patient wearing a gait belt; (b) an ARNA-assisted process with the gait belt attached to ARNA; (c) an ARNA-assisted process with a subject walking a patient wearing a harness that is attached to ARNA. Block randomization was used with the following experimental scenarios: Gait Belt (human with a gait belt), "ARNA + Gait Belt" (a robot with a gait belt), and "ARNA + Harness" (a robot with a harness). Descriptive statistics and a multiple regression model were used to analyze the data and compare the outcome described as the Perceived Usefulness (PU) of a robot for patient walking versus a human "nurse assistant" without a robot. The independent variables included the experimental conditions of "Gait Belt," "ARNA + Gait Belt," and "ARNA + Harness," the subject's age, race, and previous videogame playing experience., Findings: Results indicated that PU was significantly higher in the Gait Belt + ARNA and Harness + ARNA conditions than in the Gait Belt condition ( p -value <.01 for both variables). In examining potential influencing factors, the effects of race (White, African American, and Asian), age, and previous video-playing experience were not statistically significant ( p -value >.05)., Discussion: Results demonstrated that using robot technology to assist in walking patients was perceived by subjects as more useful in preventing falls than the gait belt. Patient fall prevention also has implications for preventing associated work-related injuries among healthcare providers., Implications: Understanding the effects of a subject's perceptions can guide further development of assistive robots in patient care. Robotic engineers and interdisciplinary teams can design robots to accommodate worker characteristics and individual differences to improve worker safety and reduce work injuries., Competing Interests: Conflict of InterestThe author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

The SP/KLF family of transcription factors harbour three C-terminal C2H2 zinc fingers interspersed by two linkers which confers DNA-binding to a 9-10 bp motif. Mutations in KLF1, the founding member of the family, are common. Missense mutations in linker two result in a mild phenotype. However, when co-inherited with loss-of-function mutations, they result in severe non-spherocytic hemolytic anemia. We generate a mouse model of this disease by crossing Klf1 +/- mice with Klf1 H350R/+ mice that harbour a missense mutation in linker-2. Klf1 H350R/- mice exhibit severe hemolysis without thalassemia. RNA-seq demonstrate loss of expression of genes encoding transmembrane and cytoskeletal proteins, but not globins. ChIP-seq show no change in DNA-binding specificity, but a global reduction in affinity, which is confirmed using recombinant proteins and in vitro binding assays. This study provides new insights into how linker mutations in zinc finger transcription factors result in different phenotypes to those caused by loss-of-function mutations., (© 2024. The Author(s).)

Objectives: To assess the (i) predictors of and associated rates of success and; (ii) maternal and perinatal outcomes of women undergoing trial of labour after two previous caesarean sections (TOLA2C)., Study Design: This retrospective cohort study collected data from two regional obstetric centres with 12,000 deliveries per annum collectively. The population included singleton pregnancies undergoing (i) TOLA2C, (ii) elective repeat caesarean section following two caesarean sections (ERCS) and (iii) trial of labour after one caesarean section (TOLA1C). Data was collected electronically from 2013 to 2021. Statistical analysis included Fisher exact and Kruskal-Wallis test to compare unpaired samples alongside univariate and multivariable logistic regression. The primary outcome measure was maternal and perinatal outcome., Results: The three groups included; n = 146 TOLA2C, n = 206 ERCS and n = 99 TOLA1C. TOLA2C had a success rate of 65 % compared to 74 % for TOLA1C (p = 0.16). The optimal predictor of successful TOLA2C was previous successful TOLA1C OR 8.65 (95 % CI 2.75-38.41). TOLA2C was associated with greater risk of endometritis and/or sepsis postnatally compared to the other two groups [10.3 % (n = 15) versus 0.5 % (n = 1) and 3 % (n = 3) for ERCS and TOLA1C respectively p < 0.01]. It was also associated with longer maternal hospital stay [2.4 days (+/-1.8) versus 1.8 (+/-0.8) and 1.8 (+/-1.7) p < 0.01], a greater proportion of neonates with Apgar scores less than 7 (p=<0.01) and higher rates of neonatal unit admission [14 % (n = 20) versus 5 % (n = 11) versus 4 % (n = 4) (p=<0.01)]., Conclusion: Women considering trial of labour following two caesarean sections should be counselled regarding the potential increased risk of endometritis, sepsis and adverse neonatal outcome., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Authors. Published by Elsevier B.V. All rights reserved.)

Objective: Youth who display elevated callous-unemotional (CU) traits are at risk for negative developmental outcomes. Previous studies demonstrate that environmental conditions contribute to elevated levels of CU traits, but the majority of this work focuses on a single source of environmental influence. To better understand how environmental conditions contribute to changes in CU traits during adolescence, the current study examined the time-varying relation between CU traits, parent, peer, and community conditions., Method: Using data from the longitudinal Pathways to Desistance study (N = 1,026 males, M age   = 15.98, SD  = 1.16; 40.94% Black, 34.11% Latino, 20.66% White, 4.29% Other), full-factorial fixed effect regression models were implemented to examine how parental hostility, antisocial peers, community violence, and neighborhood disorder are individually and interactively associated with within-person changes in CU traits during adolescence (15-21 years)., Results: Results indicated that proximal conditions (i.e., negative parenting, antisocial peers) had more consistent associations with CU traits than distal conditions (i.e., neighborhood disorder, community violence). Affiliation with antisocial peers was not significantly related to CU traits when youth were simultaneously exposed to high community violence and low neighborhood disorder. Further, the association between CU traits and impact of living in high disordered, high violence neighborhoods was stronger for younger youth., Conclusion: Results indicate that the association among parents, peers, and CU trait development is more nuanced than previously suggested, such that the risk that each environmental condition poses is moderated by a youth's age and their exposure to distal conditions.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter., (© 2024 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.)

L1 elements are retrotransposons currently active in mammals. Although L1s are typically silenced in most normal tissues, elevated L1 expression is associated with a variety of conditions, including cancer, aging, infertility and neurological disease. These associations have raised interest in the mapping of human endogenous de novo L1 insertions, and a variety of methods have been developed for this purpose. Adapting these methods to mouse genomes would allow us to monitor endogenous in vivo L1 activity in controlled, experimental conditions using mouse disease models. Here, we use a modified version of transposon insertion profiling, called nanoTIPseq, to selectively enrich young mouse L1s. By linking this amplification step with nanopore sequencing, we identified >95% annotated L1s from C57BL/6 genomic DNA using only 200 000 sequencing reads. In the process, we discovered 82 unannotated L1 insertions from a single C57BL/6 genome. Most of these unannotated L1s were near repetitive sequence and were not found with short-read TIPseq. We used nanoTIPseq on individual mouse breast cancer cells and were able to identify the annotated and unannotated L1s, as well as new insertions specific to individual cells, providing proof of principle for using nanoTIPseq to interrogate retrotransposition activity at the single-cell level in vivo., (© The Author(s) 2024. Published by Oxford University Press on behalf of Nucleic Acids Research.)

The COVID-19 pandemic had a major impact on cancer patients and services but has been difficult to quantify. We examined how the entire cancer pathway-from incidence, presentation, diagnosis, stage, treatment and survival-was affected in Northern Ireland during April-December 2020 compared to equivalent 2018-2019 periods using retrospective, observational cancer registry data from the Northern Ireland Cancer Registry (NICR). There were 6748 cancer cases in April-December 2020 and an average 7724 patients in April-December 2018-2019. Incident cases decreased by 13% (almost 1000). Significant differences were found across age cohorts and deprivation quintiles, with reductions greatest for younger people (<55 years; 19% decrease) and less deprived (22% decrease). A higher proportion had emergency admission (16%-to-20%) with lower proportions diagnosed pathologically (85%-to-83%). There was a significant stage shift, with lower proportions of early stage (29%-to-25%) and higher late-stage (21%-to-23%). Lower proportions received surgery (41%-to-38%) and radiotherapy (24%-to-22%) with a higher proportion not receiving treatment (29%-to-33%). One-year observed-survival decreased from 73.7% to 69.8% and 1-year net-survival decreased from 76.1% to 72.9%, with differences driven by five tumours; Lung (40.3%-to-35.0%), Head-and-Neck (77.4%-to-68.4%), Oesophageal (53.5%-to-42.3%), Lymphoma (81.1%-to-75.2%) and Uterine cancer (87.4%-to-80.4%). Our study reveals profound adverse impact of COVID-19 on the entire cancer patient pathway, with 13% fewer cases, greater emergency admissions and significant stage-shift from early to more advanced-stage disease. There was major treatment impact with lower rates of surgery and radiotherapy and higher proportions receiving no treatment. There were significant reductions in 1-year survival. Our study will support service recovery and protect cancer services in future pandemics or disruptions., (© 2024 The Authors. International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.)

A new approach using orthogonal analytical techniques is developed for chemical identification. High resolution mass spectrometry and infrared ion spectroscopy are applied through a 5-level confidence paradigm to demonstrate the effectiveness of nontargeted workflow for the identification of hazardous organophosphates. Triphenyl phosphate is used as a surrogate organophosphate for occupational exposure, and silicone wristbands are used to represent personal samplers. Spectral data of a target compound is combined with spectral data of the sodium adduct and quantum chemical calculations to achieve a confirmed identification. Here, we demonstrate a nontargeted workflow that identifies organophosphate exposure and provides a mechanism for selecting validated methods for quantitative analyses.

Background: Patients with cirrhosis have a 30-day readmission rate of over 30%. Novel care delivery models are needed to reduce healthcare costs and utilization associated with cirrhosis care. One such model is Home Hospital (HH), which provides inpatient-level care at home. Limited evidence currently exists supporting HH for cirrhosis patients., Aims: The aims of this study were to characterize patients with cirrhosis who received hospital-level care at home in a two-site clinical trial and to describe the care they received. Secondary aims included describing their outcomes, including adverse events, readmissions and mortality., Methods: We identified all patients with cirrhosis who enrolled in HH as part of a two-site clinical trial between 2017 and 2022. HH services include daily clinician visits, intravenous and oral medications, continuous vital sign monitoring, and telehealth specialist consultation. We collected sociodemographic data and analyzed HH stays, including interventions, outcomes, adverse events, and follow-up., Results: 22 patients with cirrhosis (45% Hispanic; 50% limited English proficiency, median MELD-Na 12) enrolled in HH during the study period. Interventions included lab chemistries (82%), intravenous medications (77%), specialist consultation (23%), and advanced diagnostics/procedures (23%). The median length of stay was 7 days (IQR 4-12); 186 bed-days were saved. Two patients (9%) experienced adverse events (AKI). No patients required escalation of care; 9% were readmitted within 30 days., Conclusions: In this two-site study, HH was feasible for patients with cirrhosis, holding promise as a hepatology delivery model. Future randomized trials are needed to further evaluate the efficacy of HH for patients with cirrhosis., (© 2024. The Author(s), under exclusive licence to Springer Science+Business Media, LLC, part of Springer Nature.)

Background: Febrile infants presenting in the first 90 days of life are at higher risk of invasive and serious bacterial infections than older children. Modern clinical practice guidelines, mostly using procalcitonin as a diagnostic biomarker, can identify infants who are at low risk and therefore suitable for tailored management. C-reactive protein, by comparison, is widely available, but whether C-reactive protein and procalcitonin have similar diagnostic accuracy is unclear. We aimed to compare the test accuracy of procalcitonin and C-reactive protein in the prediction of invasive or serious bacterial infections in febrile infants., Methods: For this systematic review and meta-analysis, we searched MEDLINE, EMBASE, Web of Science, and The Cochrane Library for diagnostic test accuracy studies up to June 19, 2023, using MeSH terms "procalcitonin", and "bacterial infection" or "fever" and keywords "invasive bacterial infection*" and "serious bacterial infection*", without language or date restrictions. Studies were selected by independent authors against eligibility criteria. Eligible studies included participants aged 90 days or younger presenting to hospital with a fever (≥38°C) or history of fever within the preceding 48 h. The primary index test was procalcitonin, and the secondary index test was C-reactive protein. Test kits had to be commercially available, and test samples had to be collected upon presentation to hospital. Invasive bacterial infection was defined as the presence of a bacterial pathogen in blood or cerebrospinal fluid, as detected by culture or quantitative PCR; authors' definitions of serious bacterial infection were used. Data were extracted from selected studies, and the detection of invasive or serious bacterial infections was analysed with two models for each biomarker. Diagnostic accuracy was determined against internationally recognised cutoff values (0·5 ng/mL for procalcitonin, 20 mg/L for C-reactive protein) and pooled to calculate partial area under the curve (pAUC) values for each biomarker. Optimum cutoff values were identified for each biomarker. This study is registered with PROSPERO, CRD42022293284., Findings: Of 734 studies derived from the literature search, 14 studies (n=7755) were included in the meta-analysis. For the detection of invasive bacterial infections, pAUC values were greater for procalcitonin (0·72, 95% CI 0·56-0·79) than C-reactive protein (0·28, 0·17-0·61; p=0·016). Optimal cutoffs for detecting invasive bacterial infections were 0·49 ng/mL for procalcitonin and 13·12 mg/L for C-reactive protein. For the detection of serious bacterial infections, procalcitonin and C-reactive protein had similar pAUC values (0·55, 0·44-0·69 vs 0·54, 0·40-0·61; p=0·92). For serious bacterial infections, the optimal cutoffs for procalcitonin and C-reactive protein were 0·17 ng/mL and 16·18 mg/L, respectively. Heterogeneity was low for studies investigating the test accuracy of procalcitonin in detecting invasive bacterial infection (I 2 =23·5%), high for studies investigating procalcitonin for serious bacterial infection (I 2 =75·5%), and moderate for studies investigating C-reactive protein for invasive bacterial infection (I 2 =49·5%) and serious bacterial infection (I 2 =28·3%). The absence of a single definition of serious bacterial infection across studies was the greatest source of interstudy variability and potential bias., Interpretation: Within a large cohort of febrile infants, a procalcitonin cutoff of 0·5 ng/mL had a superior pAUC value to a C-reactive protein cutoff of 20 mg/L for identifying invasive bacterial infections. In settings without access to procalcitonin, C-reactive protein should therefore be used cautiously for the identification of invasive bacterial infections, and a cutoff value below 20 mg/L should be considered. C-reactive protein and procalcitonin showed similar test accuracy for the identification of serious bacterial infection with internationally recognised cutoff values. This might reflect the challenges involved in confirming serious bacterial infection and the absence of a universally accepted definition of serious bacterial infection., Funding: None., Competing Interests: Declaration of interests We declare no competing interests., (Copyright © 2024 The Author(s). Published by Elsevier Ltd. This is an Open Access article under the CC BY-NC-ND 4.0 license. Published by Elsevier Ltd.. All rights reserved.)

Objective: Successful clinical conversations about vaccination in pregnancy (pertussis, COVID-19, and influenza) are key to improving low uptake rates of both vaccination in pregnancy and infancy. The purpose of this study was to understand Canadian perinatal care providers' knowledge, attitudes, and practices around vaccination in pregnancy., Methods: Qualitative interviews with 49 perinatal care providers (nurse practitioner, general practitioner, registered nurse, registered midwife, obstetrician-gynecologist, and family physicians) in 6 of 13 provinces and territories were deductively coded using directed content analysis [1] and analyzed according to key themes., Results: Participants detailed their professional training and experiences, patient community demographics, knowledge of vaccines, views and beliefs about vaccination in pregnancy, and attitudes about vaccine counselling. Providers generally described having a good range of information sources to keep vaccine knowledge up to date. Some providers lacked the necessary logistical setups to administer vaccines within their practice. Responses suggest diverging approaches to vaccine counselling. With merely hesitant patients, some opted to dig in and have more in-depth discussions, while others felt the likelihood of persuading an outright vaccine-refusing patient to vaccinate was too low to be worthwhile., Conclusion: Provider knowledge, attitudes, and practices around vaccination varied by professional background. To support perinatal providers' knowledge and practices, clinical guidelines should detail the importance of vaccination relative to other care priorities, emphasize the positive impact of engaging hesitant patients in vaccine counselling., Competing Interests: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (© 2024 The Authors. Published by Elsevier Ltd.)

Objectives: HIV pre-exposure prophylaxis (PrEP) is highly effective in preventing HIV acquisition. In England, NHS availability was limited to participants of the PrEP Impact Trial until late 2020. Some key populations at greater risk of HIV were under-represented in the trial suggesting inequities in trial PrEP access. We used the PrEP-to-need ratio (PnR; number of PrEP users divided by new HIV diagnoses) to investigate whether PrEP access improved following routine commissioning in October 2020 and identify populations most underserved by PrEP., Methods: Aggregated numbers of people receiving ≥1 PrEP prescription and non-late new HIV diagnoses (epidemiological proxy for PrEP need) were taken from national surveillance data sets. We calculated the PnR across socio-demographics during Impact (October 2017 to February 2020; pre-COVID-19 pandemic) and post-commissioning PrEP era (2021) in England., Results: PnR increased >11 fold, from 4.2 precommissioning to 48.9 in 2021, due to a fourfold reduction in non-late new HIV diagnoses and near threefold increase in PrEP users. PnR increased across genders, however, the men's PnR increased 12-fold (from 5.4 precommissioning to 63.9 postcommissioning) while the women's increased sevenfold (0.5 to 3.5). This increasing gender-based inequity was observed across age, ethnicity and region of residence: white men had the highest PnR, increasing >13 fold (7.1 to 96.0), while Black African women consistently had the lowest PnR, only increasing slightly (0.1 to 0.3) postcommissioning, suggesting they were the most underserved group. Precommissioning, the PnR was 78-fold higher among white men than Black women, increasing to 278-fold postcommissioning., Conclusions: Despite the overall increase in PrEP use, substantial PrEP Impact trial inequities widened postcommissioning in England, particularly across gender, ethnicity and region of residence. This study emphasises the need to guide HIV combination prevention based on equity metrics relative to the HIV epidemic. The PnR could support the optimisation of combination prevention to achieve zero new HIV infections in England by 2030., Competing Interests: Competing interests: Flavien Coukan has received funding from the BHIVA/ViiV Implementation Science Scholarship to investigate the barriers and facilitators to PrEP access faced by Black women., (© Author(s) (or their employer(s)) 2024. Re-use permitted under CC BY. Published by BMJ.)

Background: In England, over 80 % of those with hepatitis C virus (HCV) infection have injected drugs. We quantified the HCV cascade of care (CoC) among people who inject drugs (PWID) in England and determined whether this improved after direct-acting antivirals (DAAs) were introduced., Methods: We analysed data from nine rounds of national annual cross-sectional surveys of PWID recruited from drug services (2011-2019; N = 12,320). Study rounds were grouped as: 'Pre-DAAs' (2011-2014), 'Prioritised DAAs' (2015-2016) and 'Unrestricted DAAs' (2017-2019). Participants were anonymously tested for HCV antibodies and RNA and completed a short survey. We assessed the proportion of PWID recently (current/previous year) tested for HCV. For participants ever HCV treatment eligible (past chronic infection with history of treatment or current chronic infection), we assessed the CoC as: HCV testing (ever), received a positive test result, seen a specialist nurse/doctor, and ever treated. We used logistic regression to determine if individuals progressed through the CoC differently depending on time-period, whether time-period was associated with recent testing (all participants) and lifetime HCV treatment (ever eligible participants), and predictors of HCV testing and treatment in the Unrestricted DAAs period., Results: The proportion of ever HCV treatment eligible PWID reporting lifetime HCV treatment increased from 12.5 % in the Pre-DAAs period to 25.6 % in the Unrestricted DAAs period (aOR:2.40, 95 %CI:1.95-2.96). There were also increases in seeing a specialist nurse/doctor. The largest loss in the CoC was at treatment for all time periods. During the Unrestricted DAAs period, recent (past year) homelessness (vs never, aOR:0.66, 95 %CI:0.45-0.97), duration of injecting (≤3 years vs >3 years; aOR:0.26, 95 %CI:0.12-0.60), never (vs current, aOR:0.31, 95 %CI:0.13-0.75) or previously being prescribed OAT (vs current, aOR:0.67, 95 %CI:0.47-0.95), and never using a NSP (vs past year, aOR:0.27, 95 %CI:0.08-0.89) were negatively associated with lifetime HCV treatment. The proportion of PWID reporting recent HCV testing was higher during Unrestricted DAAs (56 %) compared to Pre-DAAs (48 %; aOR:1.28, 95 %CI:1.06-1.54)., Conclusion: COC stages from seeing a specialist onwards improved after DAAs became widely available. Further improvements in HCV testing are needed to eliminate HCV in England., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Author(s). Published by Elsevier B.V. All rights reserved.)

Adult maltreatment is a pervasive problem in the United States and has serious individual and societal consequences. Adult protective services (APS) agencies are the social services programs responsible for serving older adults and adults with disabilities who may be experiencing adult maltreatment. The adult maltreatment literature differentiates elder maltreatment from the maltreatment of adults with disabilities, yet APS agencies serve both groups. Understanding the etiology of adult maltreatment as well as the associated risk and protective factors is crucial for APS workers, clinical practitioners, researchers, and policymakers. To advance the evidence in this area, we undertook a scoping review to examine recent evidence on risk and protective factors associated with adult maltreatment. Searches of nine electronic databases were conducted in 2020 to identify studies published in peer-reviewed journals since 2010. A total of 29 studies were included in the final review. The findings identified several categories of risk factors associated with the individual: demographic traits, socioeconomic characteristics, physical and mental health, interpersonal issues, and historical events. Several studies identified caregiver and alleged perpetrator risk factors. However, the current body of research lacks community and contextual risk and protective factors. Therefore, we present several potential data sources that may be leveraged to examine the links between social-contextual characteristics and adult maltreatment. These data may be combined with APS data to advance the field's understanding of risk and protective factors through advanced analytic techniques., Competing Interests: Declaration of Conflicting InterestsThe author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Objectives: The objective of this study was to collect information on human chorionic gonadotrophin (hCG) laboratory testing and reporting in women with gestational trophoblastic disease (GTD), to assess the associated challenges, and to offer perspectives on hCG testing harmonisation., Design: Information was collected from laboratories by electronic survey (SurveyMonkey) using a questionnaire designed by members of the European Organisation for the Treatment of Trophoblastic Disease (EOTTD) hCG working party., Participants: The questionnaire was distributed by the EOTTD board to member laboratories and their associated scientists who work within the GTD field., Setting: The questionnaire was distributed and accessed via an online platform., Methods: The questionnaire consisted of 5 main sections. These included methods used for hCG testing, quality procedures, reporting of results, laboratory operational aspects, and non-GTD testing capability. In addition to reporting these survey results, examples of case scenarios which illustrate the difficulties faced by laboratories providing hCG measurement for GTD patient management were described. The benefits and challenges of using centralised versus non-centralised hCG testing were discussed alongside the utilisation of regression curves for management of GTD patients., Results: Information from the survey was collated and presented for each section and showed huge variability in responses across laboratories even for those using the same hCG testing platforms. An educational example was presented, highlighting the consequence of using inappropriate hCG assays on clinical patient management (Educational Example A), along with an example of biotin interference (Educational Example B) and an example of high-dose hook effect (Educational Example C), demonstrating the importance of knowing the limitations of hCG tests. The merits of centralised versus non-centralised hCG testing and use of hCG regression curves to aid patient management were discussed., Limitations: To ensure the survey was completed by laboratories providing hCG testing for GTD management, the questionnaire was distributed by the EOTTD board. It was assumed the EOTTD board held the correct laboratory contact, and that the questionnaire was completed by a scientist with in-depth knowledge of laboratory procedures., Conclusions: The hCG survey highlighted a lack of harmonisation of hCG testing across laboratories. Healthcare professionals involved in the management of women with GTD should be aware of this limitation. Further work is needed to ensure an appropriate, quality-assured laboratory service is available for hCG monitoring in women with GTD., (© 2023 The Author(s). Published by S. Karger AG, Basel.)

Background: Live attenuated varicella vaccine (LAVV) has historically been contraindicated in children who are immunocompromised due to solid organ transplant (SOT) because of safety concerns. Recently, clinical guidelines were developed that support post-transplant varicella vaccination in selected SOT recipients based on emerging evidence of LAVV safety. This qualitative study sought to explore barriers and facilitators to implementing the new guidelines, as well as acceptability of LAVV among healthcare providers (HCPs) and parents., Methods: HCPs and parents of transplant recipients were recruited from four sites using purposive sampling. Data from semi-structured interviews were analyzed using an Interpretive Description approach that incorporated data from the interviews, academic knowledge and clinical experience, and drew from Grounded Theory and Thematic Analysis. The theoretical framework used was Adaptive Leadership., Results: Thirty-four participants (16 HCPs and 18 parents) were included in the analysis. Parents developed skills in adaptive leadership that included strategies to protect their child against infectious diseases. Foundational information that live vaccines were absolutely contraindicated post-transplant "stuck" with parents and led them to develop strategies other than vaccination to keep their child safe. Some parents struggled to understand that information previously presented as a certainty (contraindication of LAVV) could change. Their approach to adaptive leadership informed their appraisal of the new vaccination guidelines and willingness to accept vaccination., Conclusions: HCPs should adopt a family-centered approach to communicating changing guidelines that considers parents' approach to adaptive leadership and discusses the changing nature of medical evidence. Trust between HCPs and parents can facilitate these conversations., (© 2023 The Authors. Pediatric Transplantation published by Wiley Periodicals LLC.)

Acquired thrombotic thrombocytopenic purpura (aTTP) is a thrombotic microangiopathy resulting in high mortality. Caplacizumab is approved for treatment of adults with acquired thrombotic thrombocytopenic purpura that has shown faster platelet normalization, clinical improvement, and reduced risk of recurrent/refractory disease. We report 2 cases of adolescents treated off-label with caplacizumab who were able to stop before 30 days from end of plasma exchange after platelets normalized and ADAMTS13 activity recovered to >20% to 30%. Our results show similar efficacy to other reports of patients under 18 receiving caplacizumab in first line, regardless of plasma exchange strategy, and may offer insight into early cessation criteria., Competing Interests: The authors declare no conflict of interest., (Copyright © 2023 Wolters Kluwer Health, Inc. All rights reserved.)

Background: Many people living with cancer are admitted as an emergency, some just prior to diagnosis and others in their last year of life. Factors associated with accessing emergency care for people dying of cancer are complex and not well understood. This can make it difficult to have the resources and staffing in place to best care for individuals in their last year of life and their families., Methods: This study uses routinely collected administrative data from people who died of cancer in N. Ireland (NI) during 2015 and explores how personal characteristics (e.g., gender, age) and disease related factors (e.g., tumour site, cancer stage at initial diagnosis) were associated with having an emergency admission to hospital in the last year and the last 28 days of their lives, using multivariate logistic regression., Results: Almost three in four people had at least one emergency admission in the last year of life, and over one in three had an emergency admission the last 28 days of life. Patterns were similar for both time outcomes with males, people with haematological, lung or brain cancers, younger persons, those diagnosed with late-stage cancer, and people diagnosed close to time of death, being significantly more likely to have an emergency admission. While there was no significant association between deprivation and emergency admission rates, those living in urban areas were more likely to have an emergency admission in their last month of life compared to rural dwellers. Late diagnosis was evident with 538 people (12.8% of all deaths from cancer) being diagnosed within one month of death and 1242 (29%) within 3 months of death., Conclusion: The high level of emergency admissions points to gaps in routine end-of-life care, and the need for additional training for hospital staff including frontline emergency department (ED) staff who are often the 'gatekeepers' to emergency inpatient care for people living with cancer. The levels of late diagnosis indicate a need for increased population awareness of cancer symptoms and system change to promote earlier diagnosis., (© 2023. The Author(s).)

Introduction: Febrile infants 90 days and younger are at risk of invasive bacterial infections (bacteraemia and meningitis) and urinary tract infections. Together this is previously termed serious bacterial infection with an incidence of approximately 10-20%. The National Institute for Health and Care Excellence guidance advocates a cautious approach with most infants requiring septic screening, parenteral broad-spectrum antibiotics and hospital admission. Internationally, variations exist in the approach to febrile infants, with European and North American guidance advocating a tailored approach based on clinical features and biomarker testing. None of the available international clinical decision aids (CDAs) has been validated in the UK and Irish cohorts. The aim of the Febrile Infant Diagnostic Assessment and Outcome (FIDO) Study is to prospectively validate a range of CDAs in a UK and Irish population including CDAs that use procalcitonin testing., Methods and Analysis: The FIDO Study is a prospective multicentre mixed-methods cohort study conducted in UK and Irish hospitals. All infants aged 90 days and younger presenting with fever or history of fever (≥38°C) are eligible for inclusion. Infants will receive standard emergency clinical care without delay. Clinical data and blood samples will be collected, and consent will be obtained at the earliest appropriate opportunity using research without prior consent methodology. The performance and cost-effectiveness of CDAs will be assessed. An embedded qualitative study will explore clinician and caregiver views on different approaches to care and perceptions of risk., Ethics and Dissemination: This study was reviewed and approved by the Office for Research Ethics Committees Northern Ireland-Health and Social Care Research Ethics Committee B, Public Benefit and Privacy Panel for Health and Social Care Scotland, and Children's Health Ireland Research and Ethics Committee Ireland. The results of this study will be presented at academic conferences and in peer-reviewed publications., Trial Registration Number: NCT05259683., (© Author(s) (or their employer(s)) 2023. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.)

Background: Childhood cancer survivors (CCS) experience many long-term health problems that can be mitigated with recommended survivorship care. However, many CCS do not have access to survivorship care nor receive recommended survivorship care. We reviewed the empirical evidence of disparities in survivorship care for CCS., Methods: This systematic review searched PubMed, CINAHL, and PsycINFO for studies on survivorship care for CCS (PROSPERO: CRD42021227965) and abstracted the reported presence or absence of disparities in care. We screened 7945 citations, and of those, we reviewed 2760 publications at full text., Results: A total of 22 studies reported in 61 publications met inclusion criteria. Potential disparities by cancer treatment (N = 14), diagnosis (N = 13), sex (N = 13), and current age (N = 13) were frequently studied. There was high quality of evidence (QOE) of survivorship care disparities associated with non-White race, Hispanic ethnicity, and being uninsured. Moderate QOE demonstrated disparities among CCS who were unemployed and older. Lower QOE was found for disparities based on cancer diagnosis, cancer treatment, age at diagnosis, time since diagnosis, sex, insurance type, income, educational attainment, and geographic area., Conclusions: We found strong empirical evidence of disparities in survivorship care for CCS associated with race, ethnicity, and insurance status. Multiple other disparate groups, such as those by employment, income, insurance type, education, cancer diagnosis, age at diagnosis, time since diagnosis, cancer treatment, geographic area, sex, and self-identified gender warrant further investigation. Prospective, multilevel research is needed to examine the role of other patient characteristics as potential disparities hindering adequate survivorship care in CCS., (© 2023 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.)

Background: Computer-assisted interpretation of single-lead ECG is the preliminary method for clinicians to flag and further evaluate an arrhythmia of clinical importance for acutely ill patients. Critical scrutiny of novel detection algorithms is lacking, particularly in external real-world data sets. This study's objective was to evaluate a hybrid machine learning model's ability to classify eight arrhythmias from a single-lead ECG signal from acutely ill patients., Methods: This cross-sectional external retrospective evaluation of a previously trained hybrid machine learning model against an ECG reading team in the setting of home hospital care (acute care delivered at home substituting for traditional hospital care) draws from patients admitted at two hospitals in Boston, Massachusetts, USA between 12 June 2017 and 23 November 2019. We calculated classifier statistics for each arrhythmia, all arrhythmias and strips where the model identified normal sinus rhythm., Results: The model analysed 2 680 162 min of single-lead ECG data from 423 patients and identified 691 478 arrhythmias. Patients had a mean age of 70 years (SD, 18), 60% were female and 45% were white. For any arrhythmia, the model had a sensitivity of 98%, a specificity of 100%, an accuracy of 98%, a positive predictive value of 100%, a negative predictive value of 93% and an F 1 Score of 99%. Performance was best for pause (F 1 Score, 99%) and worst for paroxysmal supraventricular tachycardia (F 1 Score, 92%). The model's false positive rate for any arrhythmia was 0.2%, ranging from 0.4% for pause to 7.2% for paroxysmal supraventricular tachycardia. The false negative rate for any arrhythmia was 1.9%., Conclusions: A hybrid machine learning model was effective at classifying common cardiac arrhythmias from a single-lead ECG in real-world data., Competing Interests: Competing interests: DML and SRL receive grant support from Biofourmis and IBM., (© Author(s) (or their employer(s)) 2023. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.)

This is the first British Association of Sexual Health and HIV (BASHH) national guideline for the management of sexually transmitted enteric infections (STEI). This guideline is primarily aimed for level 3 sexual health clinics; however, it may also be applicable to other settings such as primary care or other hospital departments where individuals with STEI may present. This guideline makes recommendations on testing, management, partner notification and public health control of STEI.

Low oral absorption and extensive first pass metabolism of progesterone is reported for many oral formulations which warrants investigation into other routes of administration. It is the aim of this study to investigate the generation of inhaled formulations of progesterone though a spray drying approach with a focus on how spray drying impacts the physicochemical properties of progesterone. Formulations of progesterone with L-leucine and hydroxypropyl methylcellulose acetate succinate (HPMCAS) are reported to this aim. X-ray diffraction, spectroscopy and thermal analysis were used to characterise these formulations and confirmed that progesterone crystallises as the Form II polymorph during spray drying regardless of the solvent used. The resultant formulations showed higher aqueous solubility than progesterone Form I starting material and the addition of HPMCAS was shown to temporarily enable a supersaturated state. Thermal analysis was used to show that the Form II polymorph was sensitive to transformation to Form I during heating. The addition of L-leucine to the formulations reduced the temperature for the polymorphic transformation by ∼ 10 °C. However, when HPMCAS was added to the formulation, the Form II polymorph was prevented from transforming to the Form I polymorph. Cascade impaction was used to determine the aerosol performance of the spray dried powders and showed promising lung deposition profiles (mass median aerodynamic diameter 5 µm) with significant variation depending on the organic solvent used and the ratio of organic to aqueous phase in the feedstock. However, further optimisation of formulations was required to direct more progesterone into the alveolar regions. The addition of HPMCAS was seen to increase the alveolar deposition and therefore formed a formulation with a lower fine particle fraction and mass median aerodynamic diameter. The most suitable formulation for inhalation was formed from a 50:50 acetone:water mixture and showed an ED, FPF and FPD of 81.7%, 44.5% and 7.3 mg respectively. Therefore, HPMCAS is suggested as a suitable excipient to increase solubility, prevent polymorphic transformation and improve inhalation properties of spray dried progesterone formulations. This study highlights the use of spray drying to form inhalable progesterone powders with higher solubility which may broaden the application of this medicine., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 The Author(s). Published by Elsevier B.V. All rights reserved.)

Competing Interests: Competing interests: None declared.

Background: The COVID-19 pandemic was managed in Aotearoa New Zealand (NZ) by a COVID-19 elimination policy, involving border closure and an initial national lockdown. This was different to most other countries including Northern Ireland (NI) and the Netherlands (NED). We quantify the effect of these policies on the diagnosis of three major cancers, comparing NZ with these two European countries., Method: Data from NED, NZ and NI population-based cancer registries were used to assess trends in all pathologically diagnosed (PD) lung, breast, and colorectal cancers from March to December 2020 (pandemic period) and compared to the similar pre-pandemic period (2017-2019). Trend data were also collated on COVID-19 cases and deaths per 100,000 in each population., Results: Comparing the pre-pandemic period to the pandemic period there were statistically significant reductions in numbers of lung (↓23%) and colorectal (↓15%) PD cancers in NI and numbers of breast (↓18%) and colorectal cancer (↓18.5%) diagnosed in the NED. In NZ there was no significant change in the number of lung (↑10%) or breast cancers (↑0.2%) but a statistically significant increase in numbers of colorectal cancer diagnosed (↑5%)., Conclusion: The impact of COVID-19 on cancer services was mitigated in NZ as services continued as usual reflecting minimal healthcare disruption and protected cancer services linked with the elimination approach adopted. The reduction in PD cases diagnosed in NED and NI were linked with higher COVID-19 rates and reflect societal restrictions which resulted in delayed patient presentation to primary and secondary care, disruption to screening and healthcare services as a result of COVID-19 infections on staff and the need to shift intensive care to COVID-19 patients. Reductions in PD cancers in NI and the NED and in particularly lung cancers in NI, highlight the need for targeted public health campaigns to identify and treat 'missing' patients. Protecting cancer services should be a priority in any future pandemic or systemic healthcare system disruption., (© 2023. The Author(s).)

Objectives: Teachers are an important occupational group to consider when addressing vaccine confidence and uptake for school-aged children due to their proximate role within school-based immunization programs. The objectives of this study were to characterize and identify sociodemographic factors associated with vaccine confidence and describe teachers' knowledge of and perceived role in the school-based immunization program, with the aim of informing public health policy and identifying opportunities for supporting teachers in their role in school-based immunization programs., Methods: A cross-sectional survey of elementary and secondary public-school teachers in British Columbia was completed from August to November 2020. Respondents provided sociodemographic information, as well as past vaccination experience, vaccine knowledge, and perceived role in the school-based immunization program. Vaccine confidence was measured using the Vaccine Hesitancy Scale (VHS). Characteristics associated with the VHS sub-scales 'lack of confidence in vaccines' and 'perceived risk of vaccines', were explored using ANOVA. Descriptive analysis was completed for teachers' perceived role in the immunization program., Results: 5,095 surveys were included in this analysis. Overall vaccine confidence was high, with vaccine hesitancy being related to the perceived risk of vaccines rather than a lack of confidence in the effectiveness of vaccines. ANOVA found significant differences for both VHS-sub-scales based on sociodemographic factors, however, the strength of the association was generally small. High general vaccine knowledge and never having delayed or refused a vaccine in the past were associated with higher vaccine confidence. Overall, teachers reported a lack of clarity in their role within the school-based immunization program., Conclusions: This large population-based observational study of teachers highlights a number of key engagement opportunities between public health and the education sector. Using a validated scale, we found that overall, teachers are highly accepting of vaccines, and well situated as potential partners with public health to address vaccine hesitancy., Competing Interests: MS has been an investigator on projects funded by GlaxoSmithKline, Merck, Pfizer, Sanofi-Pasteur, Seqirus, Symvivo and VBI Vaccines. All funds have been paid to his institute, and he has not received any personal payments. MS is supported via salary awards from the BC Children’s Hospital Foundation, the Canadian Child Health Clinician Scientist Program and the Michael Smith Foundation for Health Research. HM has been a co-investigator on projects funded by GlaxoSmithKline, Moderna, Pfizer, Sanofi-Pasteur. CSR is funded by a fellowship from the Michael Smith Foundation for Health Research. RD has received fellowships from the Michael Smith Foundation for Health Research and the Canadian Immunization Research Network. This does not alter our adherence to PLOS ONE policies on sharing data and materials. Other authors have declared that no competing interests exist., (Copyright: © 2023 Racey et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

Objective: The COVID-19 public health emergency (PHE) has important implications for health care service delivery. Little is understood about how the PHE impacted community-based hospice providers and service delivery to hospice-eligible beneficiaries. The aim of this study was to describe hospice response to the PHE and correlated impacts on beneficiary receipt of hospice support services delivered to hospice-eligible beneficiaries participating in the Centers for Medicare & Medicaid Services (CMS) Medicare Care Choices Model (MCCM), a national model testing the provision of certain hospice-like supportive services with concurrent usual care among seriously ill, community-residing Medicare beneficiaries that have not elected to receive hospice care., Methods: We employed descriptive analysis using concurrent qualitative and quantitative data sources, consisting of provider surveys, beneficiary-level encounter data submitted by hospices, and Medicare administrative claims describing beneficiary service utilization. The sample included both hospice providers (N = 82) and beneficiaries (N = 2294) voluntarily participating in MCCM., Results: Nearly all participating MCCM hospices adopted operational changes to address their staff and beneficiaries' safety during the COVID-19 PHE. We report changes to service delivery, including declines in total encounters as well as service modality, and the types of services provided., Conclusions: While the analyses reported indicate that seriously ill Medicare beneficiaries participating in MCCM were directly impacted by the PHE, we are still unclear whether changes in the service modality and encounters by provider type and the decline in average service counts per beneficiary are driven more by hospices or by beneficiary decisions to minimize exposure. Future research should attempt to disentangle these factors.

Background: Controversy persists regarding the optimal treatment for large abdominal aortic aneurysm (AAA), highlighted by the publication of the National Institute for Health and Care Excellence (NICE) guideline (NG156) on March 2020. The pendulum of opinion swings once more from endovascular to open surgical treatment. We report our experience over the last 15 years in treating consecutive AAA by open surgery., Methods: A retrospective review of a prospectively collected vascular database of all patients undergoing infra-renal open abdominal aortic aneurysm repair (OR) repair from 2004 to 2019 at the largest aneurysm centre in the United Kingdom. OR for elective and emergency (ruptured and symptomatic) outcomes included early morbidity and 30-day mortality, and long-term survival., Results: 1017 patients underwent OR between 2004-2019, on application of our inclusion-criteria 994 patients formed our cohort for analysis (81.2% male) with a mean age 73.6 ± 7.8 years treated by OR for AAA. In that group 672 were elective and 308 were emergency (for ruptured or symptomatic). Overall 30 day mortality was 11.3%, elective 30 day mortality was 2.5%, and emergency 30 day mortality was 29.9%. 30 day re-intervention rate was 9.5%, (elective 7.0%, emergency 15.9%). Survival at 1000 days for elective repair was 72 v 46.7% for emergency and at 2000 days was 43.4% for elective v 25% for emergency., Conclusion: Our data confirm that open surgery for AAA can be performed in large volume centres quite safely. Elective and Emergency surgery does affect early 30 day mortality but does not influence long-term outcome.

Source-to-sink carbon (C) allocation driven by the sink strength, i.e., the ability of a sink organ to import C, plays a central role in tissue growth and biomass productivity. However, molecular drivers of sink strength have not been thoroughly characterized in trees. Auxin, as a major plant phytohormone, regulates the mobilization of photoassimilates in source tissues and elevates the translocation of carbohydrates toward sink organs, including roots. In this study, we used an 'auxin-stimulated carbon sink' approach to understand the molecular processes involved in the long-distance source-sink C allocation in poplar. Poplar cuttings were foliar sprayed with polar auxin transport modulators, including auxin enhancers (AE) (i.e., IBA and IAA) and auxin inhibitor (AI) (i.e., NPA), followed by a comprehensive analysis of leaf, stem, and root tissues using biomass evaluation, phenotyping, C isotope labeling, metabolomics, and transcriptomics approaches. Auxin modulators altered root dry weight and branching pattern, and AE increased photosynthetically fixed C allocation from leaf to root tissues. The transcriptome analysis identified highly expressed genes in root tissue under AE condition including transcripts encoding polygalacturonase and β-amylase that could increase the sink size and activity. Metabolic analyses showed a shift in overall metabolism including an altered relative abundance levels of galactinol, and an opposite trend in citrate levels in root tissue under AE and AI conditions. In conclusion, we postulate a model suggesting that the source-sink C relationships in poplar could be fueled by mobile sugar alcohols, starch metabolism-derived sugars, and TCA-cycle intermediates as key molecular drivers of sink strength., (© The Author(s) 2023. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

Background: Candidemia represents a significant cause of morbidity and mortality in children. We examined the epidemiology and associated risk factors of candidemia at a Canadian tertiary care paediatric hospital over an 11-year period., Methods: A retrospective chart review was conducted on children with positive blood culture for Candida species between January 1, 2007 and December 31, 2018. Patient demographics, previously described candidemia risk factors, Candida species, follow-up investigations, interventions, and outcome data were included in the analysis., Results: Sixty-one candidemia episodes were reported with an overall incidence rate of 5.1 cases per 10,000 patient admissions. Of the 66 species identified, the most common was Candida albicans (53%, 35), followed by Candida parapsilosis (18%, 12), and Candida glabrata (8%, 5). Mixed candidemia was noted in 8% (5/61) of episodes. The most common risk factors included presence of central venous catheter (95%, 58/61) and receipt of antibiotics in the last 30 days (92%, 56/61). Majority of patients received abdominal imaging (89%, 54/61), ophthalmology consult (84%, 51/61), and echocardiogram (70%, 43/61), regardless of age. Line removal was performed in 81% (47/58) of cases. Evidence of disseminated fungal disease on abdominal imaging was observed in 11% (6/54) of patients, all in non-neonates but with risk factors including immunosuppression and gastrointestinal abnormalities. The overall 30-day case fatality rate was 8% (5/61)., Conclusions: C. albicans was the most commonly isolated species. Disseminated candidiasis was demonstrated mainly on abdominal imaging in patients with relevant risk factors, including immunosuppression and gastrointestinal abnormalities., Competing Interests: The authors have nothing to disclose., (© Association of Medical Microbiology and Infectious Disease Canada (AMMI Canada), 2023.)

Objectives: HTLV-1 is predominantly a sexually-transmitted infection but testing is not mentioned in HIV-PrEP guidelines. We ascertained HTLV-1/HTLV-2 seroprevalence amongst HIV-PrEP users in England., Methods: An unlinked anonymous seroprevalence study., Results: Amongst 2015 HIV-PrEP users, 95% were men, 76% of white ethnicity and 83% had been born in Europe. There were no HTLV-1/HTLV-2 seropositive cases (95% confidence interval 0% - 0.18%)., Conclusions: There were no HTLV positive cases, likely reflecting the demographic of mostly white and European-born individuals. Similar studies are needed worldwide to inform public health recommendations for HIV-PrEP using populations, particularly in HTLV-endemic settings., Competing Interests: Declaration of Competing Interest None, (Copyright © 2023. Published by Elsevier Ltd.)

Background: Blocking the transmission of parasites from humans to mosquitoes is a key component of malaria control. Tafenoquine exhibits activity against all stages of the malaria parasite and may have utility as a transmission blocking agent. We aimed to characterize the transmission blocking activity of low-dose tafenoquine., Methods: Healthy adults were inoculated with Plasmodium falciparum 3D7-infected erythrocytes on day 0. Piperaquine was administered on days 9 and 11 to clear asexual parasitemia while allowing gametocyte development. A single 50-mg oral dose of tafenoquine was administered on day 25. Transmission was determined by enriched membrane feeding assays predose and at 1, 4, and 7 days postdose. Artemether-lumefantrine was administered following the final assay. Outcomes were the reduction in mosquito infection and gametocytemia after tafenoquine and safety parameters., Results: Six participants were enrolled, and all were infective to mosquitoes before tafenoquine, with a median 86% (range, 22-98) of mosquitoes positive for oocysts and 57% (range, 4-92) positive for sporozoites. By day 4 after tafenoquine, the oocyst and sporozoite positivity rate had reduced by a median 35% (interquartile range [IQR]: 16-46) and 52% (IQR: 40-62), respectively, and by day 7, 81% (IQR 36-92) and 77% (IQR 52-98), respectively. The decline in gametocyte density after tafenoquine was not significant. No significant participant safety concerns were identified., Conclusions: Low-dose tafenoquine (50 mg) reduces P. falciparum transmission to mosquitoes, with a delay in effect., Competing Interests: Potential conflicts of interest . B. E. B. declares receipt of funding support from the Bill and Melinda Gates Foundation and Medicines for Malaria Venture (MMV) and receipt of equipment (piperaquine) for clinical trial from Medicines for Malaria Venture. J. S. M. declares grant support from MMV to undertake this study. G. D. S. declares participation on an Expert Scientific Advisory Committee for MMV and participation on Data Safety Monitoring Boards for multiple MMV-sponsored clinical chemotherapy trials done at QIMR. All other authors report no potential conflicts. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been disclosed., (© The Author(s) 2022. Published by Oxford University Press on behalf of Infectious Diseases Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

This paper introduces a protocol for the verification of multi-physics wildfire evacuation models, including a set of tests used to ensure that the conceptual modelling representation of each modelling layer is accurately implemented, as well as the interactions between different modelling layers and sub-models (wildfire spread, pedestrian movement, traffic evacuation, and trigger buffers). This work presents a total of 24 verification tests, including (1) 4 tests related to pedestrians, (2) 15 tests for traffic evacuation, (3) 5 tests concerning the interaction between different modelling layers, along with 5 tests for wildfire spread and trigger buffers. The evacuation tests are organized in accordance with different core components related to evacuation modelling, namely Population, Pre-evacuation, Movement, Route/destination selection, Flow constraints, Events, Wildfire spread and Trigger buffers. A reporting template has also been developed to facilitate the application of the verification testing protocol. An example application of the testing protocol has been performed using an open wildfire evacuation modelling platform called WUI-NITY and its associated trigger buffer model k-PERIL. The verification testing protocol is deemed to improve the credibility of wildfire evacuation model results and stimulate future modelling efforts in this domain., Supplementary Information: The online version contains supplementary material available at 10.1007/s11069-023-05913-2., Competing Interests: Conflict of interestThe authors have no relevant financial or non-financial interests to disclose., (© The Author(s) 2023.)

Objective: Prospectively validate prognostication scores, SOARS and 4C Mortality Score, derived from the COVID-19 first wave, for mortality and safe early discharge in the evolving pandemic with SARS-CoV-2 variants (B.1.1.7 replacing D614) and healthcare responses altering patient demographic and mortality., Design: Protocol-based prospective observational cohort study., Setting: Single site PREDICT and multisite ISARIC (International Severe Acute Respiratory and Emerging Infections Consortium) cohorts in UK COVID-19 second wave, October 2020 to January 2021., Participants: 1383 PREDICT and 20 595 ISARIC SARS-CoV-2 patients., Primary Outcome Measures: Relevance of SOARS and 4C Mortality Score determining in-hospital mortality and safe early discharge in the evolving UK COVID-19 second wave., Results: 1383 (median age 67 years, IQR 52-82; mortality 24.7%) PREDICT and 20 595 (mortality 19.4%) ISARIC patient cohorts showed SOARS had area under the curve (AUC) of 0.8 and 0.74, while 4C Mortality Score had AUC of 0.83 and 0.91 for hospital mortality, in the PREDICT and ISARIC cohorts respectively, therefore, effective in evaluating safe discharge and in-hospital mortality. 19.3% (231/1195, PREDICT cohort) and 16.7% (2550/14992, ISARIC cohort) with SOARS of 0-1 were candidates for safe discharge to a virtual hospital (VH) model. SOARS implementation in the VH pathway resulted in low readmission, 11.8% (27/229) and low mortality, 0.9% (2/229). Use to prevent admission is still suboptimal, as 8.1% in the PREDICT cohort and 9.5% in the ISARIC cohort were admitted despite SOARS score of 0-1., Conclusions: SOARS and 4C Mortality Score remains valid, transforming complex clinical presentations into tangible numbers, aiding objective decision making, despite SARS-CoV-2 variants and healthcare responses altering patient demographic and mortality. Both scores, easily implemented within urgent care pathways for safe early discharge, allocate hospital resources appropriately to the pandemic's needs while enabling normal healthcare services resumption., Competing Interests: Competing interests: None declared., (© Author(s) (or their employer(s)) 2022. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.)

Objective: To report the diagnostic test accuracy of dipstick urinalysis for the detection of urinary tract infections (UTIs) in febrile infants aged 90 days or less attending the emergency department (ED)., Design: Retrospective cohort study., Patients: Febrile infants aged 90 days or less attending between 31 August 2018 and 1 September 2019., Main Outcome Measures: The sensitivity, specificity and predictive values of dipstick urinalysis in detecting UTIs defined as growth of ≥100 000 cfu/mL of a single organism and the presence of pyuria (>5 white blood cells per high-power field)., Setting: Eight paediatric EDs in the UK/Ireland., Results: A total of 275 were included in the final analysis. There were 252 (92%) clean-catch urine samples and 23 (8%) were transurethral bladder catheter samples. The median age was 51 days (IQR 35-68.5, range 1-90), and there were 151/275 male participants (54.9%). In total, 38 (13.8%) participants had a confirmed UTI. The most sensitive individual dipstick test for UTI was the presence of leucocytes. Including 'trace' as positive resulted in a sensitivity of 0.87 (95% CI 0.69 to 0.94) and a specificity of 0.73 (95% CI 0.67 to 0.79). The most specific individual dipstick test for UTI was the presence of nitrites. Including trace as positive resulted in a specificity of 0.91 (95% CI 0.86 to 0.94) and a sensitivity of 0.42 (95% CI 0.26 to 0.59)., Conclusion: Point-of-care urinalysis is moderately sensitive and highly specific for diagnosing UTI in febrile infants. The optimum cut-point to for excluding UTI was leucocytes (1+), and the optimum cut-point for confirming UTI was nitrites (trace)., Trial Registration Number: NCT04196192., Competing Interests: Competing interests: None declared., (© Author(s) (or their employer(s)) 2022. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.)

A recent study found high levels (43%) of moderate to severe symptoms of depression among patients diagnosed with endometriosis in South Africa (SA) and identified several psychosocial predictors of these symptoms of depression. However, there is limited research on predictors of symptoms of depression in other settings. Considering the contextual differences between SA and the United Kingdom (UK) and their vastly different healthcare settings, we conducted a replication study in the UK and improved on the methodology by adding an established measure of sexual dysfunction to the model and obtaining a larger sample. The study comprised of a secondary analysis of cross-sectional data collected among patients with endometriosis. Study particulars were advertised by a national endometriosis association and data were collected online using Qualtrics. The sample consisted of 598 adults with self-reported endometriosis who completed measures assessing symptoms of depression, physical functioning, menstrual characteristics, sexual functioning, feelings about the medical profession, feelings about infertility, and sexual relationships. Seventy-one percent of participants reported moderate to severe levels of symptoms of depression. In addition, physical functioning, concerns about menstrual characteristics, sexual dysfunction, feelings about infertility and feelings about the medical profession were identified as significant predictors of symptoms of depression. It is important that healthcare professionals recognize that patients with endometriosis may be at risk of depression and that psychological referral should be considered.

Background: Nosocomial acquisition of influenza is known to occur but the risk after exposure to a known case and the outcomes after acquisition are poorly defined., Methods: Prospective observational study of patients exposed to influenza from another patient in a multi-site healthcare organisation, with follow-up of 7 days or until discharge, and PCR-confirmation of symptomatic disease. Multivariable analysis was used to investigate association of influenza acquisition with high dependency unit/intensive care unit (HDU/ITU) admission and in-hospital mortality., Results: 23/298 (7.7%) contacts of 11 cases were subsequently symptomatic and tested influenza-positive during follow-up. HDU/ITU admission was significantly higher in these secondary cases (6/23, 26%) compared to flu-negative contacts (20/275, 7.2%; p = 0.002). In-hospital mortality was significantly higher in secondary cases (5/23, 21.7%) compared to flu-negative contacts (11/275, 4%; p < 0.001). In multivariable analysis, age (OR 1.25 95% CI: 1.01-1.54, p = 0.02) and being a secondary case (OR 4.77, 95% CI: 1.63-13.9, p = 0.008) were significantly associated with HDU/ITU admission in contacts. Age (OR 1.00, 95% CI: 0.93-1.00, p = 0.02), being a secondary case after exposure to influenza (OR 3.81, 95% CI 1.09-13.3, p = 0.049) and co-morbidity (OR 1.29 per unit increment in the Charlson score, 95% CI 1.02-1.61, p = 0.03) were significantly associated with in-hospital mortality in contacts., Conclusions: Nosocomial acquisition of influenza was significantly associated with increased risk of HDU/ITU admission and in-hospital mortality., Competing Interests: Conflicts of interest None., (Copyright © 2022 The Authors. Published by Elsevier Ltd.. All rights reserved.)

The EU has many plans to foster equity and spatial justice. However, each has separate reference points, and it is difficult to find an overall vision. To demonstrate, we analyse two sectoral strategies to identify their implications for spatial justice strategies. Education focuses on early investment and public service reform. Health prioritises intersectoral action to address the 'social determinants' beyond the control of health services. Both warn against equating territorial cohesion or spatial justice with equal access to public services. These findings could inform European Commission strategy, but it tends to respond with renewed rhetoric rather than reconsidering its approach., (© 2021 The Authors. Regional Science Policy & Practice published by John Wiley & Sons Ltd on behalf of Regional Science Association International.)

Adolescence presents a key opportunity to build vaccine-related health literacy and promote vaccine confidence and uptake. Although adolescents are central to vaccination programs, their views around vaccines are frequently underrepresented in qualitative literature. We reviewed qualitative studies to systematically identify and summarize existing evidence on adolescents' own understanding of vaccines and experiences with vaccine decision-making, including self-consent when applicable. CINAHL; Embase; Ovid Medline; and Psych Info database searches were last updated on May 28, 2022. Data pertaining to general study characteristics, participant demographics, and qualitative content were extracted independently by two reviewers and analyzed using textual narrative synthesis. Out of 3559 individual records, 59 studies were included. The majority of the studies were conducted in high-income countries and 75% focused on human papilloma virus vaccines, with the remaining studies looking at COVID-19, meningococcal, hepatitis B and influenza vaccines or adolescent experiences with vaccines in general. Adolescent self-consent was explored in 7 studies. Perspectives from sexual and gender minorities were lacking across studies. Adolescents often had limited understanding of different vaccines and commonly perceived vaccine information to be directed towards their parents rather than themselves. Many adolescents felt school-based vaccine education and information available through healthcare providers were insufficient to make informed decisions about vaccines. While adolescents described obtaining vaccine information from traditional and online media, face-to-face interactions and opinions from trusted adults remained important. Adolescents generally relied on their parents for vaccine-decision making, even when self-consent was an option. A notable exception to this included marginalized adolescents who could not rely on parents for health-related advice. Qualitative literature about adolescent vaccines would be enriched by studies examining vaccines other than the HPV vaccine, studies examining adolescent vaccine programs in low and middle-income countries, and by deliberately eliciting vaccine experiences of adolescent with diverse sexual orientation and gender identities., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2022 Mitchell et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)