Search

Background: Clinical Practice Guidelines recommend using peripheral blood pulse measuring as a screening test for Atrial Fibrillation. However, there is no adequate evidence supporting the efficacy of such procedure in primary care clinical practice. This paper describes a study protocol designed to verify whether early opportunistic screening for Atrial Fibrillation by measuring blood pulse is more effective than regular practice in subjects aged 65 years attending primary care centers., Methods/design: An cluster-randomized controlled trial conducted in Primary Care Centers of the Spanish National Health Service. A total of 269 physicians and nurses will be allocated to one of the two arms of the trial by stratified randomization with a 3:2 ratio (three practitioners will be assigned to the Control Group for every two practitioners assigned to the Experimental Group). As many as 12 870 patients aged 65 years or older and meeting eligibility criteria will be recruited (8 580 will be allocated to the Experimental Group and 4 290 to the Control Group). Randomization and allocation to trial groups will be carried out by a central computer system. The Experimental Group practitioners will conduct an opportunistic case finding for patients with Atrial Fibrillation, while the Control Group practitioners will follow the regular guidelines. The first step will be finding new Atrial Fibrillation cases. A descriptive inferential analysis will be performed (bivariate and multivariate by multilevel logistic regression analysis)., Discussion: If our hypothesis is confirmed, we expect Primary Care professionals to take a more proactive approach and adopt a new protocol when a patient meeting the established screening criteria is identified. Finally, we expect this measure to be incorporated into Clinical Practice Guidelines., Trial Registration: The study is registered as NCT01291953 (ClinicalTrials.gob).

Objective: To assess the dynamics of cognitive impairments (CI) in patients with Parkinson's disease (PD) during L-dopa therapy., Material and Methods: The randomized clinical study included 41 patients with a refined diagnosis of PD 2.5-3.5 stages by Hoehn-Yahr scale, mainly with akinetic-rigid and mixed forms, and with CI associated with PD. All patients were on levodopa therapy. The average duration of the disease was 5 years. The study participants were randomized into two groups according to the design. To assess the dynamics of CI, a neuropsychological study was carried out twice with an interval of 6 months: in group I - at the «peak and outcome» of L-DOPA therapy, and in group II - at the «outcome and peak» of levodopa therapy, respectively. Assessment of cognitive functions (CF) was carried out using Mini-Mental State Examination (MMSE), Montreal Cognitive Assessment (MoCA), Frontal Assessment Battery (FAB), Scales for Outcomes in Parkinson's Disease-Cognition (SCOPA-Cog), Geriatric Depression Scale (GDS)., Results: The statistically significant improvement of CF at the «peak» of levodopa drugs and the deterioration at the «outcome» of L-DOPA therapy in the form of an increase in CI ( p <0.05) was revealed., Conclusion: CI in PD, in a certain extent, may be dependent on L-DOPA therapy as well as motor manifestations. The most dependent on L-DOPA therapy CF were attention, speech, executive and visual-spatial functions.

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

To cause brain dopaminergic hyperactivity in rats, L-DOPA was injected in August and Wistar rats with different basic stress reactivity and motor activity in open field ecperiments during 14 days. L-DOPA was used in the form of the drug madopar in dosage of 25,5 mg/kg of body mass daily. The indices of activity of metabolism enzymes, neuromediators and proteins: aminopeptidase, glutamatedehydrogenase, monoaminoxidase (substrate triptamine) and acetylcholinesterase were studied in sensomotor cortex, caudate nucleus, nucleus accumbens and hippocampus region. The intra- and between-line features of L-DOPA influence on rat brain have been found, being mostly pronounced in the animals with low motor activity. In these rats, changes were observed in all structures and for all enzymes, but in the group with high activity they concerned only GDH in caudate nucleus and nucleus accumbens. Hippocampus was the structure reacting to L-DOPA most actively as shoun by cytochemical indices, with reactions relating mainly to serotonergic system in August rats and to acetylcholinergic and glutamatergic systems in Wistar rats. The results demonstrate an essential role of genetically determined reactivity and motor activity in individual prognosis of resistance to stress and extreme situations.

Comparative analysis of behaviors of two rat strains, Wistar and WAG/Rij, was performed. No behavioral differences between Wistar and WAG/Rij were found in the emotional resonance test. Disulfiram injection produced similar effects in both rat strains. Animals of the first group (with slow acquisition of emotional resonance reaction) transformed into the animals of the second group (with fast acquisition). Passive avoidance conditioning was successfully reproduced in Wistar and was significantly impaired in WAG/Rij. A low dose of disulfiram injected before or immediately after conditioning substantially improved the reproduction to a greater extent in WAG/Rij than Wistar strains thus eliminating in interstrain differences. Active avoidance conditioning was more successful in WAG/Rij than in Wistar rats However, on the next day conditioning in WAG/Rij was substantially impaired. Administration of the low dose of disulfiram or L-DOPA prior to conditioning impaired the acquisition but improved the reproduction on the following day in both strains, but disulfiram injection after conditioning improved conditioning in WAG/Rij to a greater extent than in Wistar. Thus, the pharmacologic enhancement of the reward system substantially changed animal behavior and improved memory consolidation.

Preliminary peroral administration of mexidol into mice with (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine)-induced parkinsonism model prevented the formation of malonaldehyde in striatum. In combination with small doses of L-DOPA (2-mg/kg), mexidol decreased oligokinesia and muscular rigidity manifestations and increased the levels of dopamine and its metabolites--dioxyphenylacetic acid (DOPAC) and homovanillic acid (HVA) in striatum. The combined (mexidol + L-DOPA) drug administration produced a 3-5 h increase in the time of the parkinsonism syndrome inhibition as compared to that upon the administration of a greater L-DOPA dose (100 mg/kg) without mexidol. It is suggested that mexidol, possessing antioxidant properties, is capable of preventing the damage and loss of the nigrostriatial dopaminergic neurons.

The effect on the liver phospholipid composition of 1-methyl-4-phenyl -1,2,3,6-tetrahydropyridine (MPTP) and liposomes containing L-DOPA and those devoid of it was studied in experiments on C57B1/6 mice. The content of separate phospholipid fractions was expressed in percentage of lipid phosphorus, in nmol lipid phosphorus per 1 mg tissue, and in nmol lipid phosphorus per 1 mg protein. It was found that the content of phosphatidylinositide and phosphatidylethanolamine changed under the effect of MPTP. Injection of liposomes stabilized the level of these phospholipids. The concentration of phosphatidylethanolamine was not restored in animals injected liposomes devoid of L-DOPA. The main changes occurring under the effect of liposomes took place in the sphyngomyelin and phosphatidylcholine fractions.

In the white mice fetus 17-20 days old the motive activity organization is often represented by the single oscillations comprised 63% of the total quantity of motions. 36% of them group into the series, and the generalized activity registered as continuous oscillation complexes is observed only in the single cases. When female is injected subcutaneously with L-DOPA (100 mg/kg) the increase in series oscillations grouping as well as increase in quantity of the continuous activity complexes takes place. It is come to the conclusion that L-DOPA use leads to the revealing for the motive activity features which are characteristics for the older age.

Activities of enzymes of protein metabolism (aminopeptidase, acid phosphatase), of neurotransmitters (monoamine oxidase, acetylcholinesterase) and oxidative metabolism (glutamate- and glucose-6-phosphate dehydrogenases) were studied by quantitative cytochemical procedures in brain motor structures (sensomotor cortex, caudate nucleus) as well as in brain tissues not related directly to locomotory functions (n. accumbens, hippocampus) of rats exhibiting high and low locomotory activities after repeated L-DOPA administration within 14 days as well as within 14 days after drug discontinuation. That of L-dopa (madopare) caused alterations in the enzymatic activity in the brain motor structures of rats, mainly, with a high locomotory activity. It may be suggested that madopare withdrawal-induced decreases in MAO activity might be, to a certain extent, a cause of dyskinesias occurring after discontinuation of L-DOPA drugs.

In the course of a long-term L-DOPA administration (14 days) and 2 weeks after its cessation the activities of some protein enzymes (aminopeptidase, acid phosphatase), neuromediator (MAO, ACE) and oxidative (glutamate dehydrogenase, glucose-6-phosphate dehydrogenase) metabolism were studied by quantitative cytochemical methods in brain motor structures (sensorimotor cortex, caudate nucleus) and in structures not directly related to motor functions (hippocampus) of rats with high and low motor activity. After L-DOPA (madapar) cessation significant changes were revealed in the formation of motor system of the brain, primarily in the group of rats with low motor activity. It is suggested that a decrease in MAO activity after madapar cessation may be responsible for dyskinesia arising after cessation of L-DOPA preparations treatment.

The administration to rats surviving reflectory renal dystrophy of L-DOPA causing the disturbance in the function of mineralocorticoid receptors was demonstrated to be accompanied by an increase of cAMP concentration in the kidneys whereas 6-oxidopamine alleviating the damage of these receptors led to a reduction of cAMP content in the organ. It is assumed that catecholamine-activated adenylate-cyclase system and the processes initiated thereby which determine protein metabolism in renal tubule cells, among them protein subunits of mineralocorticoid receptors may take part in the mechanisms of functional disorders of mineralocorticoid receptors of the kidneys with impaired neurotrophic supply and in the mechanisms of normalization of this function.

Clinical and experimental studies showed a high therapeutic activity of L-DOPA in combination with traditional methods of infarction treatment. L-DOPA promoted a rapid disappearance of heart failure symptoms and accelerated reparative processes by restoring the activity of the sympathetic nervous system. Correctness of the experimentally developed basically new scheme for administration of neurotropic drugs to patients with infarction depending on the disease stage has been validated.

A morphometrical and cytological study of the iliac lymph nodes was carried out in 5-month-old rats of the NISAG strain (40 animals) given injections of distilled water and drugs L-dopa and Nakom increasing synthesis of catecholamines. Injections to rat-cubs of distilled water which was used for preparing suspensions of the drug resulted in lessening the mass of the lymph nodes in adult animals by 74% as compared with intact rats. The presence of L-dopa returned this index to the level characteristic of intact animals, and administration of Nakom gave its 62% elevation. In all the animals injected water the section area of the cortical substance was decreased while the relative square area of the medullary substance increased. The cortico-medullary index dropped by 53% which suggested a change of the lymph node type. Under the influence of L-dopa and Nakom an inclination to a one-direction reaction was noted: dilatation of marginal sinuses containing great amount of cells; change of the ratio of the medullary and cortical substance at the expense of growing paracortical zone; narrowing of the cortical plateau at the expense of newly formed secondary lymph nodules with a rather typical 2-3 raw arrangement of them. The changes were more pronounced after the administration of Nakom, greater amount of cells of the lymphoid and plasmacytic raw in all zones except the paracortical one where the portion of blasts, middle-size lymphocytes, macrophages, reticular and mitotically dividing cells became less.(ABSTRACT TRUNCATED AT 250 WORDS)

The authors studied the peculiarities of the course taken by experimental gastric ulcer in rabbits under the effect of the norepinephrine precursor 1-dioxyphenylalanine (L-DOPA) injected parenterally in a dose of 10 mg/kg twice a day for 14 days. As compared to the controls (nontreated ulcer), L-DOPA restored significantly more rapidly the bioenergetic processes in the gastric mucosa which were disturbed as the result of ulcerogenesis, provided for stimulation of reparative regeneration, and reduced the terms of ulcer cicatrization.

The paper presents the results of examining the levels of dopamine, norepinephrine, epinephrine and precursors of their DOPA biosynthesis in the hypothalamus, hypophysis, medulla oblongata, adrenals and heart in miniature pigs exposed to acute stress. The acute emotional stress was shown to be characterized by a significant increase in the activity of the brain hypothalamic region, adrenals, peripheral portion of the sympathoadrenal system, as evidenced by higher norepinephrine release and hence lower neurotransmitter levels in the above structures. This resulted in abnormal physiological norepinephrine/epinephrine ratios in the central nervous system and heart, predisposing to myocardial metabolic and electric instability.

In experiments on 5--7- and 16-day rat puppies with acute lesion of the spinal cord, by means of monosynaptic tests, studies have been made of the effect of DOPA on reciprocal inhibition of antagonist muscles. Test stimuli were applied to n. tibialis, conditioned ones--to n. peroneus. It was shown that the pattern of the effects depends on the action of the drug on the magnitude of the initial monosynaptic reflex used as a test. It the latter was initially inhibited, the conditioned stimulation resulted within the first 1-8 msec not in the development of postsynaptic inhibition, but in evident facilitation, which was longer in 5--7-day animals. The level of presynaptic inhibition was somewhat lower than the initial one, but exhibited longer duration. In case of facilitation of a control test after DOPA injection, configuration of reciprocal inhibition curves did not significantly differ from that obtained before administration of the drug.

In acute experiments on spinal 5-30-day rat puppies, studies have been made of the effect of DOPA (100 mg/kg intraperitoneally) on monosynaptic reflex in extensors (evaluated by parameters of H-reflex) as well as on polysynaptic segmentary reflexes. In 5-7-day animals, mainly the inhibitory effect was observed with a short phase of facilitation of monosynaptic reflex. From the 10th day, facilitatory effect of DOPA becomes a predominant one reaching maximum to the 16th day. Within first 16 days of postnatal life, DOPA exhibits facilitatory effect on short-latent polysynaptic reflexes and inhibits long-latent ones. To the 30th day, reactions which are typical of adult animals are observed: inhibition of short-latent and facilitation of long-latent polysynaptic discharges. The data obtained indicate that in early postnatal development the effect of DOPA on mono- and polysynaptic reflexes qualitatively differs from that in adult animals.

Effect of bath application of L-DOPA, dopamine (DA), noradrenaline (NA) on the spontaneous activity--cyclical oscillations of electrotonic potentials in dorsal and ventral roots (DR and VR, respectively) generated by isolated spinal cord of 16-20-day-old chick embryo was studied. L-DOPA in low concentration (30-150 mumol/l) activated spinal generator: suprathreshold rhythms appeared (i.e., spike activity in DR and VR). High concentration (200-1000 mumol/l) of L-DOPA depressed generator activity, but in the course of washing of the spinal cord spontaneous activity was enhanced and suprathreshold rhythms appeared. DA and NA (50 mumol/l) did not influence the activity but in concentration 100 mumol/l they depressed spontaneous activity in DR and VR. Bath application of 2-amino-5-phosphonovaleric acid (20 mumol/l) blocked activity induced by small concentration of L-DOPA. Activity generated by the neuronal network of the isolated dorsal horn was intensified after bath-application of L-DOPA in small concentration. Rhythmic activity in the isolated ventral horn did not appear after bath-application of L-DOPA. It is concluded that excitatory action of L-DOPA on the neuronal network of dorsal horn chick embryo was direct (i.e., did not depend on catecholamines).

Identification and quantitative fluorimetric assay have been made on the content of DOPA, dopamine, noradrenaline and adrenaline in the amniotic fluid and amnion of the developing chick embryos. Significant increase in the content of DOPA, noradrenaline and adrenaline in the amniotic fluid was observed between the 6th and the 13th days of incubation; dopamine content sharply decreases at the 13th day. The content on amines in the amnion tissue remained essentially constant throughout the investigated period. The role of catecholamine in amniotic fluid in regulation of contractile activity of amniotic membrane in the developing chick embryo is discussed.

In experiments on 5-30-day rat puppies, under slight urethane narcosis, studies have been made on the late prolonged discharges in extensor muscles evoked by stimulation of contralateral tibial nerve before and after injection of DOPA. Within the first 16 days, the drug completely abolished or significantly reduced late discharges, increasing the spontaneous motor activity. Beginning from the 16th day, periods of potentiation of late discharges were observed. The data obtained are discussed in relation to the development of mechanisms of control of the activity of spinal generators which are responsible for late discharges and spontaneous motor activity.

Different combinations and doses of neurotropic drugs of the central action (spasmolytine, midantane, L-DOPA) coupled with the surgical removal of the lung Lewis carcinoma were studied for their effect on the metastatic spreading in C57BL/6 mice. It has been established that the long-term use of spasmolytine and midantane before and after the operation inhibits the metastatic process, that is expressed in the total volume reduction of lung metastases, lack of metastases in a number of mice and augmentation of the average life. Such method of drug application is more effective in the metastatic growth inhibition as against their application only in the pre- or postoperation periods as well as with the use of the other neurotropic drug combinations.

In two groups of Wistar rats differing in horizontal motor activity in an open field, there was a dramatic lowering of that parameter after 2 weeks of administration of L-DOPA in the daily dose 50 mg/kg bw. The lowering in each group turned out different. Interferometric and cytophotometric studies of layers III and IV neurons of the sensorimotor cortex, n. caudatus and n. accumbens, made it possible to detect changes in the area of cytoplasm and neuronal nuclei, in their protein content, in aminopeptidase, glutamate dehydrogenase and glucose 6-phosphate dehydrogenase activity. The intensity and tendencies of the changes varied in both groups animals. It is concluded that excess dopamine produces an effect on the plastic and oxidative types of neuronal metabolism in the indicated structures.

As many as 59 patients aged 35 to 74 years suffering from mitral valvular disease (MVD) were examined for excretion of dopamine (DA), noradrenaline (NA) and adrenaline, parameters indicating the activity of the sympathoadrenal system. Administration of L-DOPA brought about a significant increase of excretion of all catecholamines in all the patients under 59 years and in those aged 60 to 74 years. In patients with stage I and IIA heart failure, DA excretion rose 50-fold in response to L-DOPA administration, in those with stage IIB and III, 17-fold (p less than 0.001). In patients suffering from MVD, no age-associated differences were revealed in the levels of catecholamines and ICM. In patients suffering from MVD with the predominance of stenosis and in those with stage I and IIA heart failure, background excretion of NA was significantly higher than in patients suffering from MVD with the predominance of heart failure (p less than 0.01). Administration of L-DOPA was followed by an appreciable increment of NA exactly in patients suffering from MVD with the predominance of stenosis (p less than 0.001). In the majority of patients with stage III heart failure refractory to multimodality treatment, the L-DOPA test revealed the smallest increment of DA; its excretion rose only 12-fold. Therefore, the progress of heart failure entails a decrease of the reserve potentialities of the sympathoadrenal system, marked by less output of its mediators.

A study was made of the effect of L-DOPA on the dynamics of changes in lipid peroxidation products (LPP) and the content of various types of SH groups in certain brain structures (oblongata, cerebellum, visual and sensorimotor cortex) and their synaptosomal fractions upon irradiation. The preadministration of L-DOPA to irradiated rats inhibited LPP accumulation, prevented the decrease in the content of various types of thiols and thus exerted an antioxidant effect.

A 30-fold increase in excretion of L-DOPA, distinct elevation in synthesis of dopamine and noradrenaline as well as inhibition of adrenaline synthesis occurred in schizophrenic patients at an acute period after administration of 0.1 g of L-DOPA per os (L-DOPA test). As shown by the L-DOPA test, excretion of L-DOPA was distinctly decreased in the patients with the remittence step as compared with the acute period. At the same time, in the remission synthesis of dopamine occurred mainly in the night time, synthesis of noradrenaline was decreased as compared with the acute period. synthesis of dopamine was increased 8-fold both in the patients at the acute period (mainly in the day-time) and within the remittence period (in the night-time) of the disease. The variations in excretion of L-DOPA, dopamine and noradrenaline, found in schizophrenic patients, were markedly distinct from dynamics of these patterns in healthy adult persons but were more similar to the parameters characteristic for persons in old and senile age. The L-DOPA test developed might be used for diagnosis of schizophrenia and of its periods (acute period and remission).

Cross immunoelectrophoresis was used to study the effect of administering the noradrenaline precursor D,L-DOPA on the content of water-soluble antigens in the hypothalamus, cerebellum and frontal cortex of rats. The content of 3 out of the 10 antigens under study significantly increased in the hypothalamus and that of 2 in the cerebellum after intraperitoneal injection of D,L-DOPA. The content of these antigens was greater in the structures with a high noradrenaline level.

The monitoring of the use of anabolic hormones in patients with progressive Duchenne's muscular dystrophy was shown to be possible with the help of the clinical analysis of the patients' motor possibilities, electroneuromyographic examination and determination of the time-course of the urinary excretion of catecholamines and DOPA.

Tests conducted on anesthetized rats with experimental renal hypertension demonstrated that octadine, reserpine and methyl-DOPA with their one-time administration produce at the onset of the maximal hypotensine effect of fall of the arterial pressure at the expense of the lowered total peripheral resistance. Most characteristic of the action exercised by these drugs is an increased fraction of the cardiac ejection going to the gestro-intestinal tract. In hypertension all the substances under study reduce the coronary and splenic fractions of the cardiac ejection. Reserpine and methyl-DOPA do not change, while octadine reduces the fraction of the cardiac ejection that goes to the kidney.

Electrolytic injury to dopaminergic neurons of the mesencephalic tegmentum in cats produced a steady experimental torticollis (ET) with contralateral turning of the head and body. DOPA potentiated and haloperidol mostly reduced ET. Analogous changes were induced by electrical stimulation of the ipsi- and contralateral caudate nucleus, respectively. Stimulation of the contralateral nucleus coupled with haloperidol administration led to a more pronounced restriction of ET. Unexpectedly, the same result was obtained after DOPA administration coupled with stimulation of the ipsi-lateral caudate nucleus. It is suggested that pharmacological treatment of torsion diseases should be combined with physical treatment methods.

It was shown on albino mice that when DOPA-3H (20 muCi/mouse) was administered before nonradioactive DOPA (1 mg/mouse) tritium accumulation in the tissue of Harding-Passi's melanoma of these mice proved to increase. Melanoma radioactivity in this experimental group was double that in the tumour tissue of the animals to which DOPA-3H alone was administered. Examination of the adenylate cyclase, phosphodiesterase activity and of the level of cAMP in melanoma of mice 2 hours after DOPA administration (1 mg/mouse) showed accumulation of cAMP and an increase in the phosphodiesterase activity; as to adenylate cyclase activity--it fell. It is suggested that DOPA realizes its effect not only as melanin precursor, but also through the cAMP system, influencing the melanogenesis enzymes activity.

Experiments on conscious cats have demonstrated that L-DOPA (25-50 mg/kg) does not change behavioral reactions evoked by dental pulp stimulation. L-DOPA (50 mg/kg) causes bradycardia accompanied by the increase in the cardiochronotropic baroreceptor reflex, inhibits the pressor and enhances heart rate nociceptive reactions. The effect of L-DOPA on the heart rate and baroreceptor reflexes is reversed by preliminary inhibition of peripheral DOPA-decarboxylase with benserazide (30 mg/kg).

The action of sodium oxybutyrate, phenamine transamine and L-DOPA on the processes of re-establishing the mental and physical performance capacity after fatigue was studied in experiments with rats. The activating effect of sodium oxybutyrate on the resotration of performance capacity in these conditions is shown not to be inferior to an analogous action of phenamine. Complete re-establishment of performance capacity is recorded against the background of the action produced by a monoaminoxidase inhibitor-transamine, as well as combinations of sodium oxybutyrate and L-DOPA.

Clinico-biochemical examinations of 55 patients suffering from various clinical forms of deforming myodystonia were performed. L-DOPA was used in 47 cases. A correlation between the therapeutic effect and the level of phenylacetylglutamine excretion was revealed. The increase of the phenylacetylglutamine excretion was an evidence of a positive result of the treatment that was noted in 36 patients (77%). A resistance to the drug was observed in cases when the phenylacetylglutamine excretion did not exceed its normal level. The quantitative determination of phenylacetylglutamine in the daily portion of the urine can be used as a prognostic test of the therapeutic efficacy of L-DOPA in patients with deforming myodystonia.

Experimental neurogenous ulcer is accompanied by changes in the content of dopamin (DA) and dioxypyhenylalanine (DOPA) in the tissues of different functional regions of the stomach. Two hours following injury to the pyloroduodenal region, the content of DA rises, while that of DOPA declines. After 24 hours the content of the monoamine and especially that of the amino acid decreases along with emergence and development of morphological changes (hemorrhages, erosions, ulcers) in the gastric wall. The cholinolytic quateron administered prior to the injury prevents reliably the affection of the gastric mucosa and blocks to a certain measure DOPA depletion which is recorded 24 hours following exposure to the pathogenetic agent. The utiulcerous effect of quateron is potentiated by DOPA administration (100 mg/kg).

L-DOPA, which is a metabolic precursor of catecholamines, reduced the manifestations of hyperlipidemia developed in animals after administration of Triton WR-1339, dexametasone or cholesterol. At the same time, L-DOPA decreased the rate of lipolysis, induced by adrenaline injection, as well as the content of 11-hydrocorticosteroids in blood plasma.

Excretion of catecholamines and DOPA was impaired in patients with metabolic-alimentary obesity, with ischemic disease of heart, with atherosclerosis and excessive weight. Distinct decrease in content of adrenaline, noradrenaline and DOPA was observed in patients with obesity; the phenomenon was less pronounced in ischemic disease of heart, mainly in aged patients. Correlation was found between the rate of excretion of catecholamines and DOPA and the extent of hyperlipidemia. Dietetics did not normalize completely the impairments studied. Additional administration of pyridoxine caused a favorable effect.

The results of the study on urine excretion of catecholamines such as adrenaline, noradrenaline, dopamine and their precursor DOPA in 59 patients with active tuberculosis of the lung and varying tolerance of the chemotherapeutics are presented. After adverse reactions have developed to the drugs, there are changes in monoamine excretion, which remained for long periods after elimination of clinical signs of intoxication. The changes were indicative of overstrain of the sympathetic-adrenal system which might be the cause of drug intolerance relapsing after a new start of the chemotherapy. Such patients should be registered in risk groups. They require long-term nonspecific hyposensitization.