Search

Purpose: To describe the management and multimodal imaging of lattice corneal dystrophy type II (LCD-II) complicated by an infectious keratitis due to a bandage contact lens and to review current literature., Observation: A 50-year-old female was diagnosed with Meretoja's Syndrome by the triad of facial palsy, loose skin (cutix laxa), and stromal corneal dystrophy. At slit lamp, bilateral lattice corneal dystrophy (LCD) was characterized by multiple linear refractile lines and subepithelial fibrosis along with Neurotrophic keratitis Mackie grade I. Findings of anterior segment optical coherence tomography (AS-OCT) were epithelial irregularity, subepithelial fibrosis, hyperreflectivity on anterior stromal layer, lobulated stromal surface. In vivo confocal microscopy (IVCM) showed hyperreflected deposits on the basal and Bowman layers, visible keratocytes; fine lines and streaks between corneal lamella. The sub-basal nerve plexus and the stromal nerves were no longer visible. She presented in emergency with a left red eye. A severe bacterial keratitis was diagnosed as a complication of a bandage contact lens used to treat recurrent epithelial erosion. Corneal anesthesia was complete. Corneal neovascularization was evident 10 weeks later and topical bevacizumab (5 mg/ml) was introduced twice daily. Partial regression of deep stromal vessels was noticed at 3 months., Conclusion: In Meretoja's syndrome, neurotrophic keratopathy secondary to polyneuropathy due to systemic amyloid deposits is present in the advanced stages, promotes recurrent corneal erosions. Corneal sensitivity test, AS-OCT and IVCM are crucial in the diagnosis behind any recurrent corneal erosion. The use of bandage contact lens should be avoided in Meretoja's syndrome to prevent a possible infectious keratitis.

Objective: To analyze graft survival and the outcome of the corneal endothelium after corneal transplantation in a single model to predict the long-term prognosis of these grafts., Design: Cohort study. Data were recorded prospectively and then analyzed retrospectively., Participants: One thousand one hundred forty-four consecutive eyes of 1144 patients who underwent corneal transplantation between 1992 and 2006., Interventions: Penetrating keratoplasty and deep anterior lamellar keratoplasty., Main Outcome Measures: Slit-lamp examination and wide-field specular microscopy results. A joint analysis of endothelial cell loss and time to graft failure was undertaken. From midterm simultaneous analysis of graft survival and endothelial cell loss, long-term graft survival was predicted., Results: The observed 5- and 10-year graft survival estimates were, respectively, 74% and 64%. The average endothelial cell density (cell loss) was 2270 cells/mm(2) before surgery, 1058 cells/mm(2) (-53%) during the sixth postoperative year, and 865 cells/mm(2) (-61%) during the 10th postoperative year. Overall, the predicted graft survival estimate was 27% at 20 years and 2% at 30 years. Both observed and predicted graft survival were higher in patients who had undergone lamellar keratoplasty than in patients who had undergone penetrating keratoplasty and had normal recipient endothelium and higher in patients who had undergone penetrating keratoplasty and had normal recipient endothelium than in patients who had undergone penetrating keratoplasty and had impaired recipient endothelium., Conclusions: For corneal diseases involving the endothelium, penetrating keratoplasty seems to be a good therapeutic approach in elderly patients because the graft life-span may be similar to the patient life expectancy. Conversely, for younger patients, penetrating keratoplasty is only a midterm therapeutic approach. For corneal diseases not involving the endothelium, deep anterior lamellar keratoplasty seems to be a promising therapeutic approach with higher long-term expected survival.

Background: Diagnosis of bacterial endophthalmitis (BE) often fails due to: (1) insufficient volumes of vitreous fluid (VF) and aqueous humour (AH); (2) lack of sensitivity of culture; (3) antibiotic treatments; (4) polymerase chain reaction (PCR) cross-contamination; and (5) limitations on the interpretation of the real-time PCR melting curve. We developed a fast real-time (f-real-t) PCR to improve the performance of the laboratory diagnosis of BE., Methods: The following samples were processed after adding an internal control: phosphate buffered saline (PBS); VF, AH and cell suspensions spiked with Bacteria (Bac); VF and AH from patients with endophthalmitis; and VF and AH from non-infective patients. DNA was extracted (MagNA Pure) and added to four tubes containing selected primers and probes for the identification and quantification of all Bac and eight genera by f-real-t PCR. Diagnostic performances based on direct microscopic examination, culture and f-real-t PCR were compared., Results: The f-real-t PCR detected at least 0.01 colony-forming units (CFU) of Bac/microl with no cross-reactivity with fungi. Correlation with culture-positive results was 100%. Sixty per cent of BE samples tested culture-positive, but f-real-t PCR tested positive for 90%. Samples from non-infective cases were negative., Conclusion: The f-real-t PCR detected and quantified Bac, Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria in one run. Cultures required several hours to days (with a non-negligible number of false-negative results) and the f-real-t PCR was completed in 90 min. The f-real-t PCR is presented as a new tool for the diagnosis of BE: its usefulness requires validation with larger series of samples.

Background: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others)., Material and Methods: DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95 degrees C, 20 s and 45 cycles at 95 degrees C, 3 s and 30 s at 60 degrees C. DNA extraction yields were assessed in the same tube., Results: This test detects as few as 0.01 Equivalent PFU/microl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells., Conclusion: The new real-time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.

After uneventful phacoemulsification and in-the-bag implantation of an AcrySof SA60AT (Alcon) intraocular lens (IOL), a 52-year-old black man developed pigmentary glaucoma. Slitlamp examination, anterior segment optical coherence tomography, and ultrasound biomicroscopy showed that the posterior surface of the iris was being rubbed by the inferior haptic of the IOL, which was in the bag but deformed. Filtering surgery was needed to control the intraocular pressure. This type of IOL can cause IOL-induced pigmentary glaucoma.

Objective: To compare 3 techniques used for removing the recipient stroma during anterior lamellar keratoplasty (ALK): the "big-bubble" technique, manual dissection using a crescent blade and slitlamp operating microscope, and microkeratome lamellar cut., Design: Retrospective comparative cohort study of 69 consecutive ALKs and 69 consecutive penetrating keratoplasties (PKs). Manifest refraction, slitlamp examination, Goldmann tonometry, ultrasound pachymetry, specular microscopy, and confocal microscopy findings were recorded., Results: The 12-month graft survival estimate was 98.5% in the ALK group and 94.1% in the PK group (P = .19). Higher endothelial cell density was found after ALK (P < .001). At 12 months (before suture removal), 53% of eyes that underwent ALK and 44% of eyes that underwent PK had 20/40 or better spectacle-corrected visual acuity (P = .24). In keratoconic eyes, these values were 83% and 69%, respectively (P = .18). Significant differences in visual acuity, corneal central thickness, and keratocyte density among ALK subgroups were found, with the best results obtained using the big-bubble technique and the worst results obtained using the microkeratome. In eyes that underwent ALK, visual acuity increased with keratocyte density., Conclusions: Better results were obtained after ALK vs PK, and the big-bubble technique seemed to provide the best results.

Purpose: Axenfeld Rieger syndrome (ARS) is an autosomal dominant inherited disorder affecting development of the ocular anterior chamber, abdomen, teeth and facial structures. The PITX2 gene is a major gene encoding a major transcription factor associated with ARS., Methods: ARS patients were collected from six unrelated families. Patients and their families were ophthalmologically phenotyped and their blood was collected for DNA extraction. We screened the coding region of human PITX2 gene by direct sequencing. The consequences of the mutations described were investigated by generating crystallographic representations of the amino acid changes. In order to better understand the occurrence of glaucoma in ARS patients, we studied the PITX2 gene expression in human embryonic and fetal ocular tissue sections., Results: We identified four novel PITX2 genetic alterations in four unrelated families with ARS. These mutations included two nonsense mutations (E55X and Y121X), an eight nucleotides insertion (1251 ins CGACTCCT) and a substitution (F58L), in familial and sporadic cases of ARS. We also showed for the first time that PITX2 is expressed at early stages of the human embryonic and fetal periocular mesenchyme, as well as at later stages of human development in the fetal ciliary body, ciliary processes, irido corneal angle and corneal endothelium. The human fetal eye PITX2 gene expression pattern reported here for the first time provides a strong basis for explaining the frequent occurrence of glaucoma in patients affected by PITX2 gene mutations., Conclusions: Two mutations identified affect the homeodomain (E55X and F58L). The E55X nonsense mutation is likely to alter dramatically the DNA-binding capabilities of the PITX2 homeodomain. Furthermore, there is a complete loss of the carboxy-terminal part of the PITX2 protein beyond the site of the mutation. The phenylalanine F58 is known to contribute to the hydrophobic network of the homeodomain. The crystallographic representations of the mutation F58L show that this mutation may change the conformation of the helical core. The F58L mutation is very likely to modify the homeodomain conformation and probably alters the DNA binding properties of PITX2. The other mutations (Y121X and the eight-nucleotide insertion (1251 ins CGA CTC CT) CGA CTC CT, at position 224 in PITX2A) result in partial loss of the C-terminal domain of PITX2. Pitx2 synergistically transactivates the prolactin promoter in the presence of the POU homeodomain protein Pit-1. Pitx2 activity is regulated by its own C-terminal tail. This region contains a highly conserved 14-amino-acid element involved in protein-protein interactions. The C-terminal 39-amino-acid tail represses DNA binding activity and is required for Pitx2 interactions with other transcription factors, for Pitx2-Pit-1 interaction and Pit-1synergism. Pit-1 interaction with the Pitx2 C terminus masks the inhibitory effect and promotes increased DNA binding activity. Thus, the partial or complete loss of the C terminus tail can lead to decreased or absent DNA binding activity and trigger severe ARS phenotypes. Our in situ hybridization results obtained on human embryonic and fetal ocular tissue sections constitute the first molecular histological data providing an explanation for the occurrence of precocious glaucoma in human patients affected by ARS caused by PITX2 mutations. Further structural and biochemical studies are needed for understanding the wide spectrum of clinical phenotypes caused by the increasing number of new PITX2 mutations found in ARS affected patients.

Epithelial basement membrane corneal dystrophy (EBMD), also known as Cogan microcystic epithelial dystrophy or map-dot-fingerprint dystrophy, is a common bilateral epithelial dystrophy. Usually, this disease is not considered to be inherited although several families with autosomal dominant inheritance have been described. We report the analysis of two families with an autosomal dominant pattern of inheritance as well as the analysis of single affected individuals; we identified two different point mutations in the TGFBI/BIGH3 genes, genes known to be associated with other corneal dystrophies. This is the first report of a molecular mutation in individuals with EBMD and it increases the spectrum of mutations in the TGFBI/BIGH3 gene. Based on our screening, up to 10% of EBMD patients could have a mutation in this gene., (Copyright 2006 Wiley-Liss, Inc.)

A 70-year-old man was referred to us with a 2-year, progressive, painless decrease in visual acuity in the right eye. Ocular history included extraction of a traumatic cataract with a transclerally fixated posterior chamber intraocular lens. Slitlamp examination showed a raised, white, vascularized mass covering the cornea. The lesion was removed by superficial lamellar keratectomy. Light microscopy examination confirmed the diagnosis of corneal keloid. These uncommon lesions usually develop in adults after corneal traumas, surgery, or inflammatory processes. They have also been described in children with Lowe's syndrome, Rubinstein-Taybi syndrome, and other ocular developmental disorders.

Ocular albinism type 1 (OA1) is an X-linked disorder, mainly characterized by a severe reduction in visual acuity, foveal hypoplasia, nystagmus, hypopigmentation of the retina, the presence of macromelanosomes in the skin and eyes, and the misrouting of optic pathways, resulting in the loss of stereoscopic vision. We screened the OA1 gene for mutations in three unrelated Canadian and French families and in two isolated patients with OA1. We found three different missense mutations and two different nonsense mutations, three of which were novel. To date, 41 mutations (including missense mutations, insertions, and deletions) have been reported in the OA1 gene. Mutation and polymorphism data for this gene are available from the international albinism center albinism database website: http://www.cbc.umn.edu/tad/oa1map.htm.

Type I oculocutaneous albinism (OCA) is an autosomal recessive disorder caused by the reduction or the absence of tyrosinase (TYR) activity in melanocytes of the skin, hair and eyes. Here we report an analysis of 45 patients with OCA. We found five novel mutations in the tyrosinase gene involved in the pathogenesis of oculocutaneous albinism type IA or type IB (OCA-1A/B) in five unrelated patients. Three mutations are missense mutations (G109R, P205T and H256Y) and two are nucleotide deletions (336-337delCA and 678-680delAGG). One patient is homozygous for the previously known V275F mutation but has an extremely mild OCA phenotype and has no eye features typical of OCA. In several patients we discovered only one or even no mutation in the coding sequence of the TYR gene. Thus, this disease may also result from mutations in non coding regions of the gene or in another gene involved in the biosynthesis of melanin. Hum Mutat 17:352, 2001., (Copyright 2001 Wiley-Liss, Inc.)

ABSTRACT We report five novel VMD2 mutations in Best's macular dystrophy patients (S16F, I73N, R92H, V235L, and N296S). An SSCP analysis of the VMD2 11 exons revealed electrophoretic mobility shifts exclusively in exons 2, 3, 4, 6 and 8. Direct sequencing indicated that these shifts are caused by mono-allelic transition in exons 2, 4, 6, 8 and transversion in exons 3 and 6. Five novel "silent" polymorphisms are also reported: 213T>C, 323C>A, 1514A>G, 1661C>T, and 1712T>C. Hum Mutat 17:235, 2001., (Copyright 2001 Wiley-Liss, Inc.)