Search

Abstract Background Pontocerebellar hypoplasia is an umbrella term describing a heterogeneous group of prenatal neurodegenerative disorders mostly affecting the pons and cerebellum, with 17 types associated with 25 genes. However, some types of PCH lack sufficient information, which highlights the importance of investigating and introducing more cases to further elucidate the clinical, radiological, and biochemical features of these disorders. The aim of this study is to provide an in-depth review of PCH and to identify disease genes and their inheritance patterns in 12 distinct Iranian families with clinically confirmed PCH. Methods Cases included in this study were selected based on their phenotypic and genetic information available at the Center for Comprehensive Genetic Services. Whole-exome sequencing (WES) was used to discover the underlying genetic etiology of participants' problems, and Sanger sequencing was utilized to confirm any suspected alterations. We also conducted a comprehensive molecular literature review to outline the genetic features of the various subtypes of PCH. Results This study classified and described the underlying etiology of PCH into three categories based on the genes involved. Twelve patients also were included, eleven of whom were from consanguineous parents. Ten different variations in 8 genes were found, all of which related to different types of PCH. Six novel variations were reported, including SEPSECS, TSEN2, TSEN54, AMPD2, TOE1, and CLP1. Almost all patients presented with developmental delay, hypotonia, seizure, and microcephaly being common features. Strabismus and elevation in lactate levels in MR spectroscopy were novel phenotypes for the first time in PCH types 7 and 9. Conclusions This study merges previously documented phenotypes and genotypes with unique novel ones. Due to the diversity in PCH, we provided guidance for detecting and diagnosing these heterogeneous groups of disorders. Moreover, since certain critical conditions, such as spinal muscular atrophy, can be a differential diagnosis, providing cases with novel variations and clinical findings could further expand the genetic and clinical spectrum of these diseases and help in better diagnosis. Therefore, six novel genetic variants and novel clinical and paraclinical findings have been reported for the first time. Further studies are needed to elucidate the underlying mechanisms and potential therapeutic targets for PCH.

Abstract Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Background and aims: The occurrence of thiamine metabolism dysfunction syndrome (THMD), a rare autosomal recessive condition, may be linked to various mutations found in the TPK1 and SLC19A3 genes. The disease chiefly manifests through ataxia, muscle hypotonia, abrupt or subacute onset encephalopathy, and a decline in developmental milestones achieved during the early stages of infancy. We present findings from an investigation that involved two individuals from Iran, both of whom experienced seizures along with ataxia and hypotonia. The underlying genetic causes were found with the use of next-generation sequencing (NGS) technology, which has facilitated the detection of causal changes in a variety of genetic disorders. Material and methods: The selection of cases for this study was based on the phenotypic and genetic information that was obtainable from the Center for Comprehensive Genetic Services. The genetic basis for the problems observed among the participants was determined through the application of whole-exome sequencing (WES). Subsequently, sanger sequencing was employed as a means of validating any identified variations suspected to be causative. Results: The first patient exhibited a homozygous mutation in the TPK1 gene, NM_022445.4:c.224 T > A:p.I75 N, resulting in the substitution of isoleucine for asparagine at position 75 (p.I75 N). In our investigation, patient 2 exhibited a homozygous variant, NM_025243.4:c.1385dupA:pY462X, within the SLC19A3 gene. Conclusions: Collectively, when presented with patients showcasing ataxia, encephalopathy, and basal ganglia necrosis, it is essential to account for thiamine deficiency in light of the potential advantages of prompt intervention. At times, it may be feasible to rectify this deficiency through the timely administration of thiamine dosages. Accordingly, based on the results of the current investigation, these variations may be useful for the diagnosis and management of patients with THMD.

The present study aimed to determine the genetic diversity of isolates of Mycobacterium tuberculosis (Mtb) from presumed drug-resistant tuberculosis patients from several states of Brazil. The isolates had been submitted to conventional drug susceptibility testing for first- and second-line drugs. Multidrug-resistant (MDR-TB) (54.8%) was the most frequent phenotypic resistance profile, in addition to an important high frequency of pre-extensive resistance (p-XDR-TB) (9.2%). Using whole-genome sequencing (WGS), we characterized 298 Mtb isolates from Brazil. Besides the analysis of genotype distribution and possible correlations between molecular and clinical data, we determined the performance of an in-house WGS pipeline with other online pipelines for Mtb lineages and drug resistance profile definitions. Sub-lineage 4.3 (52%) was the most frequent genotype, and the genomic approach revealed a p-XDR-TB level of 22.5%. We detected twenty novel mutations in three resistance genes, and six of these were observed in eight phenotypically resistant isolates. A cluster analysis of 170 isolates showed that 43.5% of the TB patients belonged to 24 genomic clusters, suggesting considerable ongoing transmission of DR-TB, including two interstate transmissions. The in-house WGS pipeline showed the best overall performance in drug resistance prediction, presenting the best accuracy values for five of the nine drugs tested. Significant associations were observed between suffering from fatal disease and genotypic p-XDR-TB (p = 0.03) and either phenotypic (p = 0.006) or genotypic (p = 0.0007) ethambutol resistance. The use of WGS analysis improved our understanding of the population structure of MTBC in Brazil and the genetic and clinical data correlations and demonstrated its utility for surveillance efforts regarding the spread of DR-TB, hopefully helping to avoid the emergence of even more resistant strains and to reduce TB incidence and mortality rates.

Aim: 17 α-hydroxylase/17,20-lyase deficiency (17-OHD) is an extremely rare autosomal recessive disorder that typically causes hypertension, hypokalaemia, primary amenorrhoea, and the absence of secondary sex characteristics in 46,XX individuals. Partial 17-OHD is even rarer than complete 17-OHD and is prone to missed diagnosis due to its subtler symptoms. The aim of this study was to help early detection and diagnosis of partial 17-OHD. Methods: We present a case of a 41-year-old female (46,XX) patient with partial 17-OHD caused by a novel missense CYP17A1 mutation, c.391 A > C (p.T131P). This patient experienced hypertension, hypokalaemia and adrenal hyperplasia, but did not present with primary amenorrhoea or absence of secondary sex characteristics. Initially, she was misdiagnosed and underwent right and left adrenalectomy, but the procedures were ineffective. Afterward, she received a one-month treatment of 0.5 mg dexamethasone, which greatly relieved her symptoms. Additionally, we reviewed reports of thirteen other patients with partial 17-OHD in 46,XX individuals from the literature, totalling fourteen probands. Results: We found that primary amenorrhoea, hypertension, hypokalaemia, and ovarian cysts accounted for 15.4%, 42.9%, 38.5%, and 72.7% of these patients, respectively. In contrast, elevated serum progesterone was present in all patients. Conclusion: Based on our literature review, the absence of primary amenorrhoea, hypertension or hypokalaemia cannot rule out suspicion for 17-OHD in 46,XX individuals. However, an elevation in serum progesterone levels is a highly sensitive indicator for diagnosing 17-OHD.

Myotonia congenita (MC) is a rare genetic disease caused by mutations in the skeletal muscle chloride channel gene (CLCN1), encoding the voltage-gated chloride channel ClC-1 in skeletal muscle. Our study reported the clinical and molecular characteristics of six patients with MC and systematically review the literature on Chinese people. We retrospectively analyzed demographics, clinical features, family history, creatine kinase (CK), electromyography (EMG), treatment, and genotype data of our patients and reviewed the clinical data and CLCN1 mutations in literature. The median ages at examination and onset were 26.5 years (range 11–50 years) and 6.5 years (range 1.5–11 years), respectively, in our patients, and 21 years (range 3.5–65 years, n = 45) and 9 years (range 0.5–26 years, n = 50), respectively, in literature. Similar to previous reports, myotonia involved limb, lids, masticatory, and trunk muscles to varying degrees. Warm-up phenomenon (5/6), percussion myotonia (3/5), and grip myotonia (6/6) were common. Menstruation triggered myotonia in females, not observed in Chinese patients before. The proportion of abnormal CK levels (4/5) was higher than data from literature. Electromyography performed in six patients revealed myotonic changes (100%). Five novel CLCN1 mutations, including a splicing mutation (c.853 + 4A>G), a deletion mutation (c.2010_2014del), and three missense mutations (c.2527C>T, c.1727C>T, c.2017 G > C), were identified. The c.892 G > A (p.A298T) mutation was the most frequent mutation in the Chinese population. Our study expanded the clinical and genetic spectrum of patients with MC in the China. The MC phenotype in Chinese people is not different from that found in the West, while the genotype is different.

IntroductionWilson's disease is an autosomal recessive disorder caused by ATP7B pathogenic mutations. The hallmark of this disorder mainly consists of liver involvement, neurologic dysfunction and psychiatric features. In addition, the kidneys can also be affected by excessive copper deposition.MethodsA total of 34 patients clinically diagnosed with WD were recruited. They underwent ATP7B gene sequencing and clinical data of symptoms, examination, and treatment were collected. Moreover, renal pathology information was also investigated.ResultsWe identified 25 potentially pathogenic ATP7B variants (16 missense, 5 frameshift, 3 splicing variants and 1 large deletion mutation) in these 34 WD patients, 5 of which were novel. In our cases, the most frequent variant was c.2333G>T (R778L, 39.06%, exon 8), followed by c.2621C>T (A874V, 10.94%, exon 11) and c.3316G>A (V1106I, 7.81%, exon 11). Furthermore, we described the thinning of the glomerular basement membrane as a rare pathologically damaging feature of Wilson's disease for the first time. Additionally, two patients who received liver transplant were observed with good prognosis in present study.DiscussionOur work expanded the spectrum of ATP7B variants and presented rare renal pathological feature in WD patients, which may facilitate the development of early diagnosis, counseling, treatment regimens of WD.

Cleidocranial dysplasia (CCD) is an autosomal dominant skeletal dysplasia characterized by persistent open skull sutures with bulging calvaria, hypoplasia, or aplasia of clavicles permitting abnormal opposition of the shoulders; wide public symphysis; short middle phalanx of the fifth fingers; and vertebral, craniofacial, and dental anomalies. It is a rare disease, with a prevalence of 1–9/1,000,000, high penetrance, and variable expression. The gene responsible for CCD is the Runt-related transcription factor 2 (RUNX2) gene. We characterize the clinical, genetic, and bioinformatic results of four CCD cases: two cases within Mexican families with six affected members, nine asymptomatic individuals, and two sporadic cases with CCD, with one hundred healthy controls. Genomic DNA analyses of the RUNX2 gene were performed for Sanger sequencing. Bioinformatics tools were used to predict the function, stability, and structural changes of the mutated RUNX2 proteins. Three novel heterozygous mutations (c.651_652delTA; c.538_539delinsCA; c.662T>A) and a previously reported mutation (c.674G>A) were detected. In silico analysis showed that all mutations had functional, stability-related, and structural alterations in the RUNX2 protein. Our results show novel mutations that enrich the pool of RUNX2 gene mutations with CCD. Moreover, the proband 1 presented clinical data not previously reported that could represent an expanded phenotype of severe expression.

The fall armyworm (FAW), Spodoptera frugiperda, is a worldwide agricultural pest that invaded China in 2018, and has developed resistance to multiple insecticides. The evolution of insecticide resistance is facilitated by mutations of target genes responsible for conferring resistance. In this study, amplicon sequencing analyzed 21 sites in six resistance genes. In addition to known mutations, unknown variants were also found, including novel variants: F290C (ace-1 gene, 0.1% frequency), I1040T/V (CHSA gene, 0.1% frequency), A309T (GluCl gene, 0.1% frequency), and I4790T/V (RyR gene, 0.1% frequency). Additionally, molecular docking was employed to investigate the impact of the aforementioned new mutations on insecticide binding to proteins. The analyses indicated that the binding abilities were reduced, similar to the resistance mutations that were reported, implying these novel mutations may confer transitional resistance. This study may provide a foundation for understanding the functions of these novel mutations in the evolutionary processes that drive the emergence of insecticide resistance in this invasive species.

BackgroundNeonatal sclerosing cholangitis (NSC) is a rare and severe autosomal recessive inherited liver disease with mutations in DCDC2, commonly requiring liver transplantation (LT) for decompensated biliary cirrhosis in childhood.MethodsThe information of four Chinese patients with NSC caused by mutations in DCDC2 from Children's Hospital of Fudan University were gathered. The four patients' clinicopathological and molecular features were summarized by clinical data, liver biopsy, immunohistochemical, and molecular genetic analysis.ResultsAll patients presented with jaundice, hepatosplenomegaly, hyperbilirubinemia and bile embolism, and high serum γ-glutamyl transferase activity (GGT). Liver biopsies revealed varying degrees of bile duct hyperplasia, portal-tract inflammation, and/or fibrosis. Whole-exome sequencing (WES) found novel heterozygous variants of c.1024-1G > T /p.? and c.544G > A /p. Gly182Arg in the DCDC2.ConclusionThis study expands the genetic spectrum of DCDC2 in NSC.

BackgroundIn this study, we evaluated the clinical characteristics, prognosis, and gene mutations of five children with citrullinemia type I (CTLN1) diagnosed in our department and identified two novel ASS1 gene mutations.MethodsWe examined the clinical characteristics, prognosis, and gene mutations of the five children through data collection, tandem mass spectrometry, and whole-exon sequencing. MutationTaster, regSNP-intron, and SWISS-MODEL were used for bioinformatic analysis to evaluate the two novel gene mutations. We analyzed differences in blood ammonia and citrulline levels based on clinical phenotypes. Finally, we reviewed the medical literature describing Chinese children with CTLN1.ResultsASS1 C773 + 6T > G and c.848 delA as well as c.952_953 del insTT and c.133G > A have not been previously reported in the Human Gene Mutation Database. Using MutationTaster and regSNP-intron, we predicted that these mutations affected protein function. The 3D structure obtained using SWISS-MODEL supported this prediction. Through comparative analysis showed that the ammonia level of the neonatal type was markedly higher than that of other types, whereas citrulline levels did not differ between groups.ConclusionWe identified two novel mutations that cause disease. The blood ammonia level of neonatal form citrullinemia was markedly higher than that of other types. The genotype-phenotype association in Chinese patients remains unclear and should be further evaluated in genetic studies of larger sample sizes.

Abstract Background Next‐generation sequencing (NGS)‐based method is being used broadly for genetic testing especially for clinically and genetically heterogeneous disorders, such as inherited retinal degenerations (IRDs) but still not routinely used for molecular diagnostics in Bulgaria. Consequently, the purpose of this study was to evaluate the effectiveness of a molecular diagnostic approach, based on targeted NGS for the identification of the disease‐causing mutations in 16 Bulgarian patients with different IRDs. Methods We applied a customized NGS panel, including 125 genes associated with retinal and other eye diseases to the patients with hereditary retinopathies. Results Systematic filtering approach coupled with copy number variation analysis and segregation study lead to the identification of 16 pathogenic and likely pathogenic variants in 12/16 (75%) of IRD patients, 2 of which novel (12.5%): ABCA4‐c.668delA (p.K223Rfs18) and RР1‐c.2015dupA (p.K673Efs*25). Mutations in the ABCA4, PRPH2, USH2A, BEST1, RР1, CDHR1, and RHO genes were detected reaching a diagnostic yield between 42.9% for Retinitis pigmentosa cases and 100% for macular degeneration, Usher syndrome, and cone‐rod dystrophy patients. Conclusion Our results confirm the usefulness of targeted NGS approach based on frequently mutated genes as a comprehensive and successful genetic diagnostic tool for IRDs with significant impact on patients counseling.

Background: Intrahepatic cholestasis of pregnancy (ICP) is associated with a high incidence of fetal morbidity and mortality. Therefore, revealing the mechanisms involved in ICP and its association with fetal complications is very important.Methods: Here, we used a whole-exome sequencing (WES) approach to detect novel mutations of organic anion transporting polypeptide (OTAP) genes, ATP-binding cassette transporter (ABC) genes, and receptor genes associated with ICP in 249 individuals and 1,029 local control individuals. Two available tools, SIFT and PolyPhen-2, were used to predict protein damage. Protein structuremodeling and comparison between the reference and modified protein structures were conducted by SWISS-MODEL and Chimera 1.14rc software, respectively.Results: A total of 5,583 mutations were identified in 82 genes related to bile acid transporters and receptors, of which 62 were novel mutations. These novel mutations were absent in the 1,029 control individuals and three databases, including the 1,000 Genome Project (1000G_ALL), Exome Aggregation Consortium (ExAC), and Single-Nucleotide Polymorphism Database (dbSNP). We classified the 62 novel loci into two groups (damaging and probably damaging) according to the results of SIFT and PolyPhen-2. Out of the 62 novel mutations, 24 were detected in the damaging group. Of these, five novel possibly pathogenic variants were identified that were located in known functional genes, including ABCB4 (Ile377Asn), ABCB11 (Ala588Pro), ABCC2 (Ile681Lys and Met688Thr), and NR1H4 (Tyr149Ter). Moreover, compared to the wild-type protein structure, ABCC2 Ile681Lys and Met688Thr protein structures showed a slight change in the chemical bond lengths of ATP-ligand binding amino acid side chains. The combined 32 clinical data points indicate that the mutation group had a significantly (p = 0.04) lower level of Cl ions than the wild-type group. Particularly, patients with the 24 novel mutations had higher average values of alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), total bile acids (TBA), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) than patients with the 38 novel mutations in the probably damaging group and the local control individuals.Conclusion: The present study provides new insights into the genetic architecture of ICP involving these novel mutations.

Abstract Background Lymphatic malformations (LMs) are benign congenital malformations that stem from the abnormal development of the lymphatic vessels during early embryogenesis. Somatic PIK3CA gene mutations are conventional cause leading to LMs. Both macrocystic and microcystic LMs arise due to lymphatic endothelial cell-autonomous defects, depending on the time in development at which PIK3CA gene mutation occurs. Recent study finds a PIK3CA mutation in 79% of LMs. However, discovering new genetic events in this disease is crucial to identify the molecular mechanism of the pathogenesis and further develop new targeted therapies. Results Here, we initially performed whole-exome sequencing in six children with LMs to find a new causal gene. Somatic mutations in PIK3CA (c.1633G > A [p. E545K] and PIK3CD (c.1997T > C [p.L666P]) were discovered in two different individuals. In vitro functional studies were conducted to demonstrate the pathogenicity of the novel mutation c.1997T > C in PIK3CD. We found that L666P promoted the cell proliferation and migration of human umbilical vein endothelial cells (HUVECs) and induced hyperactivation of the mTOR pathway. These findings indicate that the PIK3CD mutation affects downstream signalling in endothelial cells, which may impair normal lymphangiogenesis. Conclusions This study reveals a novel candidate gene associated with the development of LMs, which is consistent with previous researches. These findings in our study may offer a novel gene target for developing therapies, which acts in tight interaction with the previously known PIK3CA.

Abstract Background Hereditary retinopathy is a significant cause of blindness worldwide. Despite the discovery of many mutations in various retinopathies, a large number of patients remain genetically undiagnosed. Targeted next-generation sequencing of the human genome is a suitable approach for the molecular diagnosis of retinopathy. Methods We describe a cohort of 211 families from central China with various forms of retinopathy; 95 patients were investigated using multigene panel sequencing, and the other 116 with suspected Leber hereditary optic neuropathy (LHON) were tested by Sanger sequencing. The detected variation of targeted sequencing was verified by PCR-based Sanger sequencing. We performed a comprehensive analysis of the cases using sequencing data and ophthalmologic examination information. Results Potential causal mutations were identified in the majority of families with retinopathy (57.9% of 95 families) and suspected LHON (21.6% of 116 families). There were 68 variants of a certain significance distributed in 31 known disease-causing genes in the 95 families; 37 of the variants are novel and have not been reported to be related to hereditary retinopathy. The NGS panel solution provided a 45.3% potential diagnostic rate for retinopathy families, with candidate gene mutations of undefined pathogenicity revealed in another 12.6%of the families. Conclusion Our study uncovered novel mutations and phenotypic aspects of retinopathy and demonstrated the genetic and clinical heterogeneity of related conditions. The findings show the detection rate of pathogenic variants in patients with hereditary retinopathy in central China as well as the diversity and gene distribution of these variants. The significance of molecular genetic testing for patients with hereditary retinopathy is also highlighted.

Abstract Background Fluoroquinolone agents, such as enrofloxacin and marbofloxacin, are commonly used for pseudomonal infection in veterinary medicine. However, the rate of resistance to fluoroquinolones is rapidly increasing, according to multiple studies in various countries. Point mutations in the quinolone resistance-determining region (QRDR) are closely related to the increased fluoroquinolone resistance of Pseudomonas aeruginosa. The aim of this study was to investigate current antimicrobial susceptibility and fluoroquinolone resistance in P. aeruginosa strains isolated from dogs. The presence of point mutations in the QRDR was confirmed by gyrA and parC polymerase chain reaction and nucleotide sequencing analysis. Results A total of 84 nonduplicated P. aeruginosa strains were obtained from 228 healthy dogs (healthy group) and 260 dogs with clinical signs (infected group). Among these isolates, 38 strains from the healthy group were detected in several sample types, whereas 46 strains from the infected group were obtained mostly from dogs’ ears with otitis externa (41/260, 15.8%). All strains were resistant to nalidixic acid, while some were also resistant to enrofloxacin (23/84, 27.4%), marbofloxacin (17/84, 20.2%), levofloxacin (12/84, 14.3%), or ciprofloxacin (11/84, 13.1%). Enrofloxacin resistance was significantly higher in strains from the infected group than in those from the healthy group (p

Introduction: Juvenile polyposis syndrome (JPS), a rare polyposis syndrome in childhood, is characterized by multiple diffuse hamartomatous polyps in the gastrointestinal tract (GI) with an estimated incidence of one in 50,000 to 100,000 live births. Although a juvenile polyp is a non-cancerous lesion, affected individuals have an increased risk of GI malignancy. JPS is a disease related to loss-of-function mutations in BMPR1A and SMAD4 involved in the biological maintenance of cellular growth. Pathogenic mutations in those genes have been identified in approximately 50–60% of JPS cases. Presentation: Our report describes two JPS cases with loss-of-function mutations of BMPR1A identified by a high-throughput nucleotide sequencing. Both cases had a similar clinical manifestation, symptomatic lower GI bleeding. Both patients underwent a total colectomy after histological confirmation. Consequently, Family members who had had genetic confirmation of these mutations were invited to be screened by enteroscopy. Conclusion: JPS is a hereditary disease caused by dominantly inherited loss-of-function of the BMPR1A and SMAD4 genes. Identifying loss-of-function mutations in particular genes allows early screening, diagnosis, and prevention of malignancy among the index cases and their families. High-throughput genome sequencing is a current molecular approach for improving the precision of mutation detection and minimizing time to diagnosis.

Introduction: Van der Woude syndrome (VWS) is characterized by cleft palate, cleft lip, and lower-lip pits. Interferon regulatory factor 6 (IRF6) gene mutations have been reported as the cause of VWS. Subjects and Methods: Full stories of the affected individuals were obtained, and a pedigree analysis that goes back three-generation pedigree was performed. The IRF6 gene Sanger sequence analysis was performed on 43 affected individuals with ages ranging between 1 month and 84 years. Results: Our report comprises the molecular diagnosis of 43 patients with VWS in six different families. The c.841-2A>C mutation and the c.881T>A mutation are novel and have not been reported before. These novel mutations affect exon 7 of the IRF6 gene. Conclusion: The c.841-2A>C mutation is a splice site mutation, which is less common in the IRF6 gene and helps us understand the genomic structure better. A novel c.881T>A mutation was identified in exon 7. Due to variable expression, the same mutation can present itself in different clinical manifestations. However, different mutations in the same gene can also be observed through different phenotypes. Therefore, the clinical manifestations of new mutations can lead us to a better understanding of the causes of the disease. In addition, knowing the molecular cause of the disease is also useful for the surgical interventions.

Abstract Background Limb-girdle muscular dystrophies are a group of genetically heterogeneous diseases that are inherited in both autosomal dominant (LGMDD) and autosomal recessive forms (LGMDR), the latter is more common especially in populations with high consanguineous marriages like Iran. In the present study, we aimed to investigate the genetic basis of patients who are suspicious of being affected by LGMDR. DNA samples of 60 families suspected of LGMD were extracted from their whole blood. Four short tandem repeat (STR) markers for each candidate genes related to LGMD R1 (calpain3 related)- R6 (δ-sarcoglycan-related) were selected, and all these 24 STRs were applied in two sets of multiplex PCR. After autozygosity mapping, Sanger sequencing and variant analysis were done. Predicting identified variants’ effect was performed using in-silico tools, and they were interpreted according to the American College of Medical Genomics and Genetics (ACMG) guideline. MLPA was used for those patients who had large deletions. Fresh muscle specimens were taken from subjects and were evaluated using the conventional panel of histochemical stains. Results forty out of sixty families showed homozygote haplotypes in CAPN3, DYSF, SGCA, and SGCB genes. The exons and intron-exon boundaries of the relevant genes were sequenced and totally 38 mutations including CAPN3 (n = 15), DYSF (n = 9), SGCB (n = 11), and SGCA (n = 3) were identified. Five out of them were novel. The most prevalent form of LGMDs in our study was calpainopathy followed by sarcoglycanopathy in which beta-sarcoglycanopathy was the most common form amongst them. Exon 2 deletion in the SGCB gene was the most frequent mutation in this study. We also reported evidence of a possible founder effect in families with mutations in DYSF and SGCB genes. We also detected a large consanguineous family suffered from calpainopathy who showed allelic heterogeneity. Conclusions This study can expand our knowledge about the genetic spectrum of LGMD in Iran, and also suggest the probable founder effects in some Iranian subpopulations which confirming it with more sample size can facilitate our genetic diagnosis and genetic counseling.

HM Adnan Hameed, 1, 2,* Yaoju Tan, 3,* Md Mahmudul Islam, 1, 2 Zhili Lu, 1 Chiranjibi Chhotaray, 1, 2 Shuai Wang, 1, 2 Zhiyong Liu, 1 Cuiting Fang, 1, 2 Shouyong Tan, 3 Wing Wai Yew, 4 Nanshan Zhong, 5 Jianxiong Liu, 3 Tianyu Zhang 1, 2, 5 1State Key Laboratory of Respiratory Disease, Guangzhou Institutes of Biomedicine and Health (GIBH), Chinese Academy of Sciences (CAS), Guangzhou, People’s Republic of China; 2University of Chinese Academy of Sciences (UCAS), Beijing, People’s Republic of China; 3State Key Laboratory of Respiratory Disease, Guangzhou Chest Hospital, Guangzhou, People’s Republic of China; 4Stanley Ho Centre for Emerging Infectious Diseases, The Chinese University of Hong Kong, Hong Kong, People’s Republic of China; 5National Clinical Research Center for Respiratory Disease, The First Affiliated Hospital of Guangzhou Medical University, Guangzhou, People’s Republic of China*These authors contributed equally to this workCorrespondence: Tianyu ZhangGuangzhou Institutes of Biomedicine and Health (GIBH), Chinese Academy of Sciences (CAS), Room A132, 190 Kaiyuan Ave, Science Park, Huangpu District, Guangzhou 510530, People’s Republic of ChinaTel +86-2032015270Email zhang_tianyu@gibh.ac.cnJianxiong LiuGuangzhou Chest Hospital, 62 Hengzhigang Road, Yuexiu District, Guangzhou 510095, People’s Republic of ChinaTel +86-2083595977Email ljxer64@qq.comObjective: Pyrazinamide (PZA) is a cornerstone of modern tuberculosis regimens. This study aimed to investigate the performance of genotypic testing of pncA+ upstream region, rpsA, panD, Rv2783c, and clpC1 genes to add insights for more accurate molecular diagnosis of PZA-resistant (R) Mycobacterium tuberculosis.Methods: Drug susceptibility testing, sequencing analysis of PZA-related genes including the entire operon of pncA (Rv2044c-pncA-Rv2042c) and PZase assay were performed for 448 M. tuberculosis clinical isolates.Results: Our data showed that among 448 M. tuberculosis clinical isolates, 113 were MDR, 195 pre-XDR and 70 XDR TB, while the remaining 70 strains had other combinations of drug-resistance. A total of 60.04% (269/448) M. tuberculosis clinical isolates were resistant to PZA, of which 78/113 were MDR, 119/195 pre-XDR and 29/70 XDR TB strains. PZAR isolates have predominance (83.3%) of Beijing genotype. Genotypic characterization of Rv2044c-pncA-Rv2042c revealed novel nonsynonymous mutations in Rv2044c with negative PZase activity which led to confer PZAR. Compared with phenotypic data, 84.38% (227/269) PZAR strains with mutations in pncA+ upstream region exhibited 83.64% sensitivity but the combined evaluation of the mutations in rpsA 2.60% (7/269), panD 1.48% (4/269), Rv2783c 1.11% (3/269) and Rv2044c 0.74% (2/269) increased the sensitivity to 89.59%. Fifty-seven novel mutations were identified in this study. Interestingly, a frameshift deletion (C− 114del) in upstream of pncAwt nullified the effect of A− 11G mutation and induced positive PZase activity, divergent from five PZase negative A− 11G PZAR mutants. Twenty-six PZAR strains having wild-type-sequenced genes with positive or negative PZase suggest the existence of unknown resistance mechanisms.Conclusion: Our study revealed that PZAR rate in MDR and pre-XDR TB was markedly higher in southern China. The concomitant evaluation of pncA+ UFR, rpsA, panD, Rv2783c, and Rv2044c provides more dependable genotypic results of PZA resistance. Fifty-seven novel mutations/indels in this study may play a vital role as diagnostic markers. The upstream region of pncA and PZase regulation are valuable to explore the unknown mechanism of PZA-resistance.Keywords: tuberculosis, pyrazinamidase, drug resistance, molecular diagnosis, novel mutations, frameshift deletion

Objective:Non syndromic monogenic obesity is a rare cause of early onset severe obesity in the childhood period. This form may not be distinguishable from other forms of severe obesity without genetic analysis, particularly if patients do not exibit any physical abnormalities or developmental delay. The aim of this study was to screen 41 different obesity-related genes in children with non-syndromic early onset severe obesity.Methods:Children with severe (body mass index-standard deviation score >3) and early onset (

Background: Leukodystrophies (LDs) are inherited heterogeneous conditions that affect the central nervous system with or without peripheral nerve involvement. They are individually rare, but collectively, they are common. Thirty disorders were included by the Global Leukodystrophy Initiative Consortium (GLIA) as LDs.Methods: We conducted a retrospective chart review of a consecutive series of patients diagnosed with different types of LD from four large tertiary referral centers in Riyadh, Saudi Arabia. Only those 30 disorders defined by GLIA as LDs were included.Results: In total, 83 children from 61 families were identified and recruited for this study. The male-to-female ratio was 1.5:1, and a consanguinity rate of 58.5% was observed. An estimated prevalence of 1:48,780 or 2.05/100,000 was observed based on the clinical cohort, whereas a minimum of 1:32,857 or 3.04/100,000 was observed based on the local genetic database. The central region of the country exhibited the highest prevalence of LDs (48.5%). The most common LD was metachromatic leukodystrophy (MLD), and it accounted for 25.3%. The most common disorder based on carrier frequency was AGS. Novel variants were discovered in 51% of the cases, but 49% possessed previously reported variants. Missense variants were high in number and accounted for 73% of all cases. Compared with other disorders, MLD due to saposin b deficiency was more common than expected, Pelizaeus-Merzbacher-like disease was more prevalent than Pelizaeus-Merzbacher disease, and X-linked adrenoleukodystrophy was less common than expected. The mortality rate among our patients with LD was 24%.Conclusion: To the best of our knowledge, this is the largest cohort of patients with LD from Saudi Arabia. We present epidemiological, clinical, radiological, and genetic data. Furthermore, we report 18 variants that have not been reported previously. These findings are of great clinical and molecular utility for diagnosing and managing patients with LD.

Abstract Background Familial hypomagnesemia with hypercalciuria and nephrocalcinosis (FHHNC) is an autosomal recessive tubulopathy characterized by excessive urinary wasting of magnesium and calcium, bilateral nephrocalcinosis, and progressive chronic renal failure in childhood or adolescence. FHHNC is caused by mutations in CLDN16 and CLDN19, which encode the tight‐junction proteins claudin‐16 and claudin‐19, respectively. Most of these mutations are missense mutations and large deletions are rare. Methods We examined the clinical and biochemical features of a Spanish boy with early onset of FHHNC symptoms. Exons and flanking intronic segments of CLDN16 and CLDN19 were analyzed by direct sequencing. We developed a new assay based on Quantitative Multiplex PCR of Short Fluorescent Fragments (QMPSF) to investigate large CLDN16 deletions. Results Genetic analysis revealed two novel compound heterozygous mutations of CLDN16, comprising a missense mutation, c.277G>A; p.(Ala93Thr), in one allele, and a gross deletion that lacked exons 4 and 5,c.(840+25_?)del, in the other allele. The patient inherited these variants from his mother and father, respectively. Conclusions Using direct sequencing and our QMPSF assay, we identified the genetic cause of FHHNC in our patient. This QMPSF assay should facilitate the genetic diagnosis of FHHNC. Our study provided additional data on the genotypic spectrum of the CLDN16 gene.

Abstract Background No formal diagnostic criteria for progressive pseudo‐rheumatoid dysplasia (PPD) are available because of insufficient clinical data, which results in that PPD is often misdiagnosed with other diseases. Whole exome sequencing (WES) and Sanger sequencing were employed to reveal the novel mutations on CCN6 of five patients with PPD from China in order to increase the clinical data of PPD. Methods Four suspected PPD pedigrees containing five patients in total were collected from 1998 to 2018 in our medical center. The phenotypes of each suspected PPD case were recorded in detail, and peripheral blood samples were collected for subsequent sequencing. Genomic DNA was extracted from peripheral blood samples, and Agilent liquid phase chip capture system was utilized for efficient enrichment of whole exome region DNA. After acquiring raw sequenced reads of whole exome region, bioinformatics analysis was completed in conjunction with reference or genome sequence (GRCh37/hg19). Sanger sequencing was performed to identify the results of WES. Results In total, four novel PPD‐related mutation sites in CCN6 gene were identified including (CCN6):c.643 + 2T>C, (CCN6):c.1064_1065dupGT(p.Gln356ValfsTer33), (CCN6):c.1064G > A), and exon4:c.670dupA:p.W223fs. Conclusion Our findings increase the clinical data of PPD including the CCN6 mutation spectrum, the clinical symptoms and signs. Moreover, the study highlights the utility of WES in reaching definitive diagnoses for PPD.

Background: Aldehyde dehydrogenase 2 (ALDH2) catalyzes the detoxification of aliphatic aldehydes, including acetaldehyde. About 45% of Han Chinese (East Asians), accounting for 8% of humans, carry a single point mutation in ALDH2*2 (E504K) that leads to accumulation of toxic reactive aldehydes. Methods: Sequencing of a small Mexican cohort and a search in the ExAC genomic database for additional ALDH2 variants common in various ethnic groups was set to identify missense variants. These were evaluated in vitro, and in cultured cells expressing these new and common variants. Findings: In a cohort of Hispanic donors, we identified 2 novel mutations in ALDH2. Using the ExAC genomic database, we found these identified variants and at least three other ALDH2 variants with a single point mutation among Latino, African, South Asian, and Finnish ethnic groups, at a frequency of >5/1000. Although located in different parts of the ALDH2 molecule, these common ALDH2 mutants exhibited a significant reduction in activity compared with the wild type enzyme in vitro and in 3T3 cells overexpressing each of the variants, and a greater ethanol-induced toxicity. As Alda-1, previously identified activator, did not activate some of the new mutant ALDH2 enzymes, we continued the screen and identified Alda-64, which is effective in correcting the loss of activity in most of these new and common ALDH2 variants. Interpretation: Since ~80% of the world population consumes ethanol and since acetaldehyde accumulation contributes to a variety of diseases, the identification of additional inactivating variants of ALDH2 in different ethnic groups may help develop new ‘precision medicine’ for carriers of these inactive ALDH2.

Background: Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant cancer syndrome characterized by the occurrence of primary hyperparathyroidism (PHPT), pituitary adenoma (PA) and pancreatic neuroendocrine tumor (pNET). Whether the underlying mutations in M EN1 gene predict clinical presentation of affected heterozygotes or not, is still a matter of a debate. Methods: Clinical and genetic analysis of 90 consecutive MEN1 patients was performed in a retrospective, single - center study. Results: M EN1 mutation was found in 67 (74.4% ) patients belonging to 31 different families. Twenty nine different heteozygous mutations were found, including 6 novel point mutations (W 220G , 941delG, 1088del7, 1184insA, 1473del10, 1602del17) and one large deletion of exon 8. Truncating mutations predicted development of pNETs (O R = 5.8, 95% CI 1.7 - 19.7%) and PHPT (O R = 4.3, 95% CI 1.5 - 12.4%). Conclusions: Large number of novel mutations among MEN1 patients confirmed previously reported data. PNETs and PHPT were more frequent in patients with truncating mutations.

Anurag Mehta,1 Smreti Vasudevan,2 Sanjeev Kumar Sharma,1 Dushyant Kumar,1 Manoj Panigrahi,1 Moushumi Suryavanshi,1 Garima Gupta2 1Department of Laboratory and Transfusion Services, Rajiv Gandhi Cancer Institute and Research Centre, Rohini, Delhi 110085, India; 2Department of Research, Rajiv Gandhi Cancer Institute and Research Centre, Rohini, Delhi 110085, India Background: The spectrum of BRCA mutations that predispose to development of breast/ovarian cancer in Indian population remains unexplored. We report incidence and various types of pathogenic, likely pathogenic and variants of unknown significance (VUS) mutations in BRCA1 and BRCA2 genes observed at a tertiary cancer center in North India.Materials and methods: A total of 206 unrelated breast and/or ovarian cancer patients, who met the National Comprehensive Cancer Network (NCCN) guidelines for genetic testing, were screened for germline BRCA1/BRCA 2 mutations on high-throughput sequencing platform; large genomic rearrangements were assessed by multiple ligation probe assay. Mutations were mined in mutational databases, PubMed, and discerned into classes. Furthermore, the clinicopathological correlation of BRCA mutation status with prognostic markers in breast cancer and tumor histology in ovarian cancer was performed.Results: In total, 45/206 and 17/206 cases showed positivity for BRCA1 and BRCA2 mutations, respectively, whereas 1/206 was positive for a mutation in both the genes. Altogether, 33 distinct BRCA1 mutations were observed, among which 27 were deleterious (12 frameshifts, 8 nonsense, 1 missense, 3 splice-site variants, 2 big deletions and 1 large duplication) and 6 were VUS. Five novel BRCA1 mutations (c.541G>T, c.1681delT, c.2295delG, c.4915C>T and exon 23 deletion) were identified. Seven mutations (c.2214_2215insT, c.2295delG, c.3607C>T, c.4158_4162delCTCTC, c.4571C>A, splicesite_3 (C>T) and exon 21–23 duplication) occurred more than once, whereas 16 distinct BRCA2 mutations were noted – 9 were lethal (6 frameshifts, 2 nonsense and 1 big deletion) and 7 VUS. One unique pathogenic BRCA2 mutation (c.932_933insT) was recognized. Two mutations (c.9976A>T and c.10089A>G) recurred twice. No significant difference in hormone receptor status was observed among BRCA1 carriers, BRCA2 carriers and noncarriers.Conclusion: We have documented various pathogenic and VUS mutations in BRCA1 and BRCA2 genes observed in the cohort. Six novel mutations were identified. The knowledge shared would assist genetic testing in enabling more focused site-specific screening for mutations in biological relatives. Keywords: genetic screening, high-throughput sequencing, multiplex ligation-dependent probe amplification assay, novel mutations, recurrent mutations

Abstract Background Congenital hypothyroidism (CH) has an incidence of approximately 1:3000, but only 15% have mutations in the thyroid hormone synthesis pathways. Genetic analysis allows for the precise diagnosis. Case presentation A 3-week old girl presented with a large goiter, serum TSH > 100 mIU/L (reference range: 0.7–5.9 mIU/L); free T4 A, p.Gly2322Ser, which was subsequently confirmed by Sanger sequencing and present in one allele of both parents. DNA samples from 354 alleles in four Sudanese ethnic groups (Nilotes, Darfurians, Nuba, and Halfawien) failed to demonstrate the presence of the mutant allele. Haplotyping showed a 1.71 centiMorgans stretch of homozygosity in the TG locus suggesting that this mutation occurred identical by descent and the possibility of common ancestry of the parents. The mutation is located in the cholinesterase-like (ChEL) domain of TG. Conclusions A novel rare missense mutation in the TG gene was identified. The ChEL domain is critical for protein folding and patients with CH due to misfolded TG may present without low serum TG despite the TG gene mutations.

Background/Aims: Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common inherited cystic kidney diseases caused by mutations in two large multi-exon genes, PKD1 and PKD2. High allelic heterogeneity and duplication of PKD1 exons 1–32 as six pseudo genes on chromosome 16 complicate molecular analysis of this disease. Methods: We applied targeted next-generation sequencing (NGS) in 9 non-consanguineous unrelated Iranian families with ADPKD to identify the genes hosting disease-causing mutations. This approach was confirmed by Sanger sequencing. Results: Here, we determined three different novel frameshift mutations and four previously reported nonsense mutations in the PKD1 gene encoding polycystin1 in heterozygotes. Conclusion: This study demonstrates the effectiveness of NGS in significantly reducing the cost and time for simultaneous sequence analysis of PKD1 and PKD2, simplifying the genetic diagnostics of ADPKD. Although a probable correlation between the mutation types and phenotypic outcome is possible, however for more extensive studies in future, the consideration of renal hypouricemia (RHUC) and PKD1 coexistence may be helpful. The novel frameshift mutations reported by this study are p. Q1997X, P. D73X and p. V336X.

This article presents the dataset regarding spectrum of mutations in 21-Hydroxylase deficient CAH patients as described in “The spectrum of CYP21A2 mutations in Congenital Adrenal Hyperplasia in an Indian cohort” (R. Khajuria, R. Walia, A. Bhansali, R. Prasad, 2017) [1]. This dataset features about the CAH patients in the cohort, their classification into subtypes and finally screening the exon–intron boundaries of 21-Hydroxylase gene (CYP21A2) to detect common mutations, novel mutations along polymorphisms in the CYP21A2 gene. The specified large set of primers and the parameters for the mutation detection allow the identification and molecular characterization of CYP21A2 gene in the CAH patients.

Abstract Background Dysferlinopathies are a group of autosomal recessive limb‐girdle muscular dystrophies (LGMDs) caused by mutations in DYSF (#603,009). This gene encodes a transmembrane protein called dysferlin. Since there are few reports on Iranian dysferlinopathy patients, we tried to identify the DYSF mutations in affected individuals of Iran. Methods Eight unrelated Iranian families have been selected for this study. Sanger sequencing followed by haplotype analysis was performed to identify individual variations in DYSF sequence. Identified variants were analyzed, and their pathogenicity was interpreted according to the recommendations of the American College of Medical Genetics and Genomics. Results We identified two new mutations in DYSF, the first one is a nonsense mutation c.2419C > T (p.Gln807*), which eliminates downstream part of the protein. Another novel mutation is c. (1,053 + 1_1,054‐1)_(1,397 + 1_1,398‐1)del, which causes deletion of the DNA segment from exon 12 to exon 15. Conclusion Two of the other six families are from the same ethnicity and share the same mutation and haplotype patterns, suggesting a founder mutation. Genetic analysis of dysferlinopathy can prevent a wrong diagnosis of myositis for these patients.

Abstract Background Alport syndrome (AS) is an inherited progressive renal disease caused by mutations in COL4A3, COL4A4, and COL4A5 genes. The large sizes of these genes and the absence of mutation hot spots have complicated mutational analysis by routine PCR‐based approaches. In recent years, the development of next‐generation sequencing (NGS) has made possible the time‐ and cost‐effective and accurate analysis of the three genes in a single step. Methods Here, we analyze COL4A3, COL4A4, and COL4A5 simultaneously in 29 AS patients using NGS. Candidate mutations were validated by classic Sanger sequencing and Real‐time PCR. Results Twenty two new mutations and 10 known mutations were detected. Of those novel mutations, 18, 3, and 1 mutations were detected in COL4A5, COL4A4, and COL4A3, respectively. Twenty six patients showed X‐linked inheritance, one showed autosomal recessive inheritance and two showed digenic inheritance (DI). Conclusion A comparison of the clinical manifestations caused by different types of mutations in COL4A5 suggested that large fragment mutations are relatively more severe than the other missense mutations and AS by some mutations may show inter‐ and intra‐familial phenotypic variability. It is important to consider these transmission patterns in the clinical evaluation according to the results of genetic testing, especially for DI. Twenty two new mutations can expand the genotypic spectrum of AS.

Tufting enteropathy (TE) is caused by recessive EPCAM mutations, and is characterized by intractable diarrhea of congenital onset and disorganization of enterocytes. TE generally requires parenteral nutrition (PN) during childhood or intestinal bowel transplantation. We report three unrelated families with six children with TE. We highlight the high rate of disease-related mortality. We observe adequate weight gain with PN, but low to normal and stunted body length, supporting the recent notion that a short stature might be intrinsic to TE. The diagnosis of TE in the index patients from each family was delayed for months to years, even when clinical data, duodenal biopsies, or exome sequencing data were obtained early on. We identified three novel pathogenic EPCAM variants: a deletion of exon 1 that removes the ATG initiation codon, a missense variant c.326A > G (p.Gln109Arg), and nonsense mutation c.429G > A (p.Trp143*) in a compound heterozygous state with the Mediterranean splice site variant c.556-14A > G (Tyr186Phefs*6). Homozygosity for p.Gln109Arg was associated with absent EPCAM staining, and compound heterozygosity for p.Trp143*/Tyr186Phefs*6 was associated with reduced EPCAM staining in duodenal biopsies; such observations might contribute to a genotype–phenotype correlation in larger cohorts of TE patients. This study extends the clinical and molecular spectrum of TE.

Background: Autosomal recessive Long QT syndrome is characterized by prolonged QTc along with congenital bilateral deafness depends on mutations in K+ channel genes. A family of a Long QT syndrome proband from India has been identified with novel indel variations. Methods: The molecular study of the proband revealed 4 novel indel variations in KCNQ1. In-silico analysis revealed the intronic variations has led to a change in the secondary structure of mRNA and splice site variations. The exonic variations leads to frameshift mutations. DNA analysis of the available family members revealed a carrier status. Results and Conclusion: It is thus predicted that the variations may lead to a change in the position of the splicing enhancer/inhibitor in KCNQ1 leading to the formation of a truncated S2–S3 fragment of KCNQ1 transmembrane protein in cardiac cells as well as epithelial cells of inner ear leading to deafness and aberrant repolarization causing prolonged QTc.

The risk of patients with Hirschsprung's disease later developing multiple endocrine neoplasia remains a matter of concern. The multiple endocrine neoplasia 2-Hirschsprung's disease association has been shown to cosegregate in Hirschsprung's disease patients with both short- and long-segment aganglionosis, although patients with long-segment aganglionosis a to carry the greatest risk. The Hirschsprung's disease-medullary thyroid carcinoma relationship also appears to be bi-directional, and activation or suppression of the rearranged during transfection gene appeared to vary over succeeding generations within the same family. Rearranged during transfection gene variations are associated with both conditions. The cosegregation of Hirschsprung's disease and multiple endocrine neoplasia 2 is particularly interesting as it involves both "switch off" and "switch on" of the rearranged during transfection proto-oncogene in the same patient. This cosegregation mostly relates to the cysteine-rich area on RET620 (the "Janus gene"). The mechanism whereby rearranged during transfection influences gene activation in multiple endocrine neoplasia 2 is complex, but genetic variations impair the rearranged during transfection tyrosine kinase response to tyrosine kinase activation, thus appearing to dictate downstream signaling cascade responses. Better understanding of the RET-620 relationship allows for a more cost-effective method of identifying those at risk by focusing rearranged during transfection gene testing to this specific area as a "hot spot". The clinical awareness of possible medullary thyroid carcinoma has led to timely intervention and early treatment of this chemo- and radioresistant tumor with poor prognosis. Establishment of "risk" by genetic testing has become a classic model of molecular medicine being integrated into patient care and offering rearranged during transfection directed prophylactic surgical management. In addition, novel approaches to treatment based on this genetic knowledge have already shown early promise in randomized clinical trials.

Carbapenem-resistant Acinetobacter baumannii (CR-AB) causes serious nosocomial infections, especially in ICU wards of hospitals, worldwide. Expression of blaOXA genes is the chief mechanism of conferring carbapenem resistance among CR-AB. Although some blaOXA genes have been studied among CR-AB isolates from Iran, their blaOXA-23-like genes have not been investigated. We used a multiplex-PCR to detect Ambler class A, B, and D carbapenemases of 85 isolates, and determined that 34 harbored blaOXA-23-like genes. Amplified fragment length polymorphism (AFLP) genotyping, followed by DNA sequencing of blaOXA-23-like amplicons of CR-AB from each AFLP group was used to characterize their blaOXA-23-like genes. We also assessed the antimicrobial susceptibility pattern of CR-AB isolates, and tested whether they harbored insertion sequences ISAba1 and ISAba4. Sequence comparison with reference strain A. baumannii (NCTC12156) revealed five types of mutations in blaOXA-23-like genes; including one novel variant and four mutants that were already reported from China and the USA. All of the blaOXA-23-like genes mutations were associated with increased minimum inhibitory concentrations (MICs) against imipenem. ISAba1 and ISAba4 sequences were detected upstream of blaOXA-23 genes in 19% and 7% of isolates, respectively. The isolation of CR-AB with new blaOXA-23 mutations including some that have been reported from the USA and China highlights CR-AB pervasive distribution, which underscores the importance of concerted national and global efforts to control the spread of CR-AB isolates worldwide.

Isolated complex III (cIII) deficiency is a rare biochemical finding in mitochondrial disorders, mainly associated with mutations in mitochondrial DNA MTCYB gene, encoding cytochrome b, or in assembly factor genes (BCS1L, TTC19, UQCC2 and LYRM7), whereas mutations in nuclear genes encoding cIII structural subunits are extremely infrequent. We report here a patient, a 9 year old female born from first cousin related parents, with normal development till 18 months when she showed unsteady gait with frequent falling down, cognitive and speech worsening. Her course deteriorated progressively. Brain MRI showed cerebellar vermis hypoplasia and bilateral lentiform nucleus high signal lesions. Now she is bed ridden with tetraparesis and severely impaired cognitive and language functions. Biochemical analysis revealed isolated cIII deficiency in muscle, and impaired respiration in fibroblasts. We identified a novel homozygous rearrangement in TTC19 (c.213_229dup), resulting in frameshift with creation of a premature termination codon (p.Gln77Argfs*30). Western blot analysis demonstrated the absence of TTC19 protein in patient’s fibroblasts, while Blue-Native Gel Electrophoresis analysis revealed the presence of cIII-specific assembly intermediates. Mutations in TTC19 have been rarely associated with mitochondrial disease to date, being described in about ten patients with heterogeneous clinical presentations, ranging from early onset encephalomyopathy to adult forms with cerebellar ataxia. Contrariwise, the biochemical defect was a common hallmark in TTC19 mutant patients, confirming the importance of TTC19 in cIII assembly/stability. Therefore, we suggest extending the TTC19 mutational screening to all patients with cIII deficiency, independently from their phenotypes.

Mitochondrial deficiencies with unknown causes have been observed in schizophrenia (SZ) and bipolar disorder (BD) in imaging and postmortem studies. Polymorphisms and somatic mutations in mitochondrial DNA (mtDNA) were investigated as potential causes with next generation sequencing of mtDNA (mtDNA-Seq) and genotyping arrays in subjects with SZ, BD, majordepressive disorder (MDD) and controls. The common deletion of 4,977 bp inb mtDNA was compared between SZ and controls in eleven different vulnerable brain regions and in blood samples, and in dorsolateral prefrontal cortex (DLPFC) of BD, SZ, and controls. In a separate analysis, association of mitochondria SNPs (mtSNPs) with SZ and BD in European ancestry individuals(n = 6,040) was tested using Genetic Association Information Network (GAIN) and Wellcome Trust Case Control Consortium 2 (WTCCC2) datasets. The common deletion levels were highly variable across brain regions, with a 40-fold increase in some regions (nucleus accumbens, caudate nucleus and amygdala), increased with age, and showed little change in blood samples from the same subjects. The common deletion levels were increased in the DLPFC for BD compared to controls, but not in SZ. Full mtDNA genome resequencing of 23 subjects, showed 7 novel homoplasmic mutations, 5 were novel synonymous coding mutations. By logistic regression analysis there were no significant mtSNPs associated with BD or SZ after genome wide correction. However, nominal association of mtSNPs (p < 0.05) to SZ and BD were found in the hypervariable region of mtDNA to T195C and T16519C. The results confirm prior reports that certain brain regions accumulate somatic mutations at higher levels than blood. The study in mtDNA of common polymorphisms, somatic mutations, and rare mutations in larger populations may lead to a better understanding of the pathophysiology of psychiatric disorders.

Background: By using whole genome sequencing (WGS), researchers are beginning to understand the genetic diversity of Mycobacterium tuberculosis (MTB) and its consequences for the diagnosis of multidrug-resistant tuberculosis (MDR–TB) on a genomic scale. The Global Consortium for Drug-resistant TB Diagnostics (GCDD) conducted a genome scale variant analyses of 366 clinical MTB genomes (mostly MDR/XDR [extensively drug resistant]) from four countries in order to inform the development of rapid molecular diagnostics. This project has been extended by performing an evolutionary analysis of isoniazid (INH)-resistant isolates for prognostic purposes. Methods: 151 (130 INHR , 21 INHS) clinical MTB isolates from India (19: 17 INHR, 2 INHS), Moldova (48: 42 INHR, 6 INHS), the Philippines (26: 20 INHR, 6 INHS), and South Africa (58: 51 INHR, 7 INHS) were included in this study. INH drug susceptibility was determined by using MGIT 960 and WHO (World Health Organization)-recommended critical concentration of 0.1 mg/L. Isolates were sequenced using PacBio RS WGS platform. A genome-wide variant analysis was conducted using a proprietary pipeline (PacDAP) developed at San Diego State University. To infer the amino acid changes in katG that confer resistance, PAML was utilized to detect sites in silico that are under positive selection. The dN/dS method was used in combination with Bayes empirical Bayes to determine sites under positive selection and Chi-Squared analysis to determine the significance of the selected sites. Results: PacDAP variant analysis revealed 22 novel catalase-peroxidase (katG product) mutations. Of these, 14 were single nucleotide polymorphisms, while 8 novel mutations appeared in combination with katG S315T and/or with inhA promoter C-15T. These SNPs have not been previously reported. Additionally, 11 previously observed, but uncommon, katG mutations were also observed in these clinical isolates. These results suggest that 17 amino acids in the enzyme are under positive selective pressure; most significantly in South Africa and the Philippines. No selective pressure on codons other than 315 was observed in isolates from Moldova. Due to the low number of isolates from India, the significance of the sites under positive selection was low and no prediction for India could be made based on this study. Conclusions: Eleven of the 14 SNPs are resistance conferring, and it is believed that the remaining 8 combinatorial mutations are either compensatory in nature or, in combination with known SNPs, could increase resistance levels. Positive selection results indicate a diversifying evolutionary path to resistance more in line with long tail statistics and therefore indicate a departure from the traditional point mutation (or “hotspot”) model that current molecular diagnostics are based on. Positive selection pressures indicate a future with elevated diagnostic and prognostic significance of the “long tail” (i.e., alternative mechanisms of resistance) and potentially diminishing significance of the canonical mutations (especially in South Africa and the Philippines), which could have significant future implications on narrowly targeting molecular diagnostics.