Search

The Ironwood tree (Casuarina equisetifolia) holds a significant ecological role in Guam where a decline in Ironwood trees was first documented in 2002. Studies have linked the Ironwood tree decline (IWTD) to bacteria from the Ralstonia solanacearum complex and wetwood bacteria, specifically Klebsiella oxytoca and Klebsiella variicola. Presence of termites was first found to be associated with IWTD in 2010; however, the role of termites in IWTD is still not clear. The Asian subterranean termite, Coptotermes gestroi (Wasmann) (Blattodea: Rhinotermitidae) frequently attacks Ironwood trees. As workers of this soil-dwelling species of the lower termites harbor a diverse microbial community in their bodies, we examined whether C. gestroi workers carry IWTD-associated bacteria and could, therefore, act as vectors. We described the bacterial community in C. gestroi workers using 16S rRNA gene sequencing and tested the impact of factors related to the location and health of the Ironwood tree the termites were collected from on termite bacterial diversity. Feeding assays were performed to assess if workers show preference in consumption depending on the amount of Ralstonia and wetwood bacteria in the food source. Health of Ironwood trees and level of site management impacted the bacterial composition of C. gestroi termite workers attacking the trees. Although C. gestroi workers equally consumed food sources with high and low Ralstonia and wetwood bacteria load in lab experiments, Ralstonia and other IWTD-related bacteria were not detected in considerable amounts in termite workers collected from trees. Thus, C. gestroi workers are not a vector for bacteria associated with IWTD in Guam.

This study addresses the challenge of optimizing powdered water kefir's fermentation and preservation processes to enhance its physical-chemical, microbiological, and technological characteristics. The main objective was to determine the best fermentation conditions and evaluate the efficacy of different drying methods. The optimal fermentation conditions were 5 % kefir grains, 10 % brown sugar, and an incubation temperature of 25 °C. Remarkably, the microbiological analysis revealed high abundances of Zymomonas mobilis (grains: 94.31 % and beverage: 91.68 %), Sporolactobacillus spathodeae (grains: 3.00 % and beverage: 5.42 %), and Liquorilactobacillus satsumensis (grains: 1.47 % and beverage: 0.62 %) among bacteria, and Lachancea fermentati (grains: 95.54 % and beverage: 67.53 %), Wickerhamomyces anomalus (grains: 3.00 % and beverage: 26.77 %) among fungi. The study innovatively demonstrates that lyophilization preserves the viability of these microorganisms, making it a promising method for producing stable, probiotic-rich powdered kefir. Although spray drying resulted in a logarithmic reduction of 3 logs CFU/g, it maintained sufficient microorganism counts, proving its viability as an alternative drying method. These methods retain the ideal physical-chemical properties and expand the accessibility and practical applications of water kefir. This research underscores the potential for powdered water kefir to deliver health benefits conveniently and versatilely, paving the way for broader industrial and academic applications.

Abstract Background Pinus koraiensis cone essential oil (PEO) contains functional compounds such as monoterpene hydrocarbons, and the administration of PEO reduced methane (CH4) emissions during growing phase of goats. However, the mode of action of PEO driven CH4 reduction is not known, especially how the administration of PEO can affect rumen microbiota and host metabolism in goats during the fattening phase. This study aimed to elucidate the potential microbial and host responses PEO supplementation in goats using metataxonomics (prokaryotes and protozoa) and metabolomics (rumen fluid and serum). Results Ten fattening Korean native goats were divided into two dietary groups: control (CON; basal diet without additives) and PEO (basal diet + 1.5 g/d of PEO) with a 2 × 2 crossover design and the treatment lasted for 11 weeks. Administration of PEO reduced CH4 concentrations in the exhaled gas from eructation by 12.0–13.6% (P

Abstract Background and aims The gut microbiota is implicated in the pathogenesis of colorectal cancer (CRC). We aimed to map the CRC mucosal microbiota and metabolome and define the influence of the tumoral microbiota on oncological outcomes. Methods A multicentre, prospective observational study was conducted of CRC patients undergoing primary surgical resection in the UK (n = 74) and Czech Republic (n = 61). Analysis was performed using metataxonomics, ultra-performance liquid chromatography-mass spectrometry (UPLC-MS), targeted bacterial qPCR and tumour exome sequencing. Hierarchical clustering accounting for clinical and oncological covariates was performed to identify clusters of bacteria and metabolites linked to CRC. Cox proportional hazards regression was used to ascertain clusters associated with disease-free survival over median follow-up of 50 months. Results Thirteen mucosal microbiota clusters were identified, of which five were significantly different between tumour and paired normal mucosa. Cluster 7, containing the pathobionts Fusobacterium nucleatum and Granulicatella adiacens, was strongly associated with CRC (P FDR = 0.0002). Additionally, tumoral dominance of cluster 7 independently predicted favourable disease-free survival (adjusted p = 0.031). Cluster 1, containing Faecalibacterium prausnitzii and Ruminococcus gnavus, was negatively associated with cancer (P FDR = 0.0009), and abundance was independently predictive of worse disease-free survival (adjusted p = 0.0009). UPLC-MS analysis revealed two major metabolic (Met) clusters. Met 1, composed of medium chain (MCFA), long-chain (LCFA) and very long-chain (VLCFA) fatty acid species, ceramides and lysophospholipids, was negatively associated with CRC (P FDR = 2.61 × 10−11); Met 2, composed of phosphatidylcholine species, nucleosides and amino acids, was strongly associated with CRC (P FDR = 1.30 × 10−12), but metabolite clusters were not associated with disease-free survival (p = 0.358). An association was identified between Met 1 and DNA mismatch-repair deficiency (p = 0.005). FBXW7 mutations were only found in cancers predominant in microbiota cluster 7. Conclusions Networks of pathobionts in the tumour mucosal niche are associated with tumour mutation and metabolic subtypes and predict favourable outcome following CRC resection. Video Abstract

ABSTRACTBackground A growing body of evidence demonstrates a different bacterial composition in the oral cavity of patients with oral lichen planus (OLP).Patients and methods Buccal swab samples were collected from affected and non-affected sites of six patients with reticular OLP and the healthy oral mucosa of six control subjects. 16S rRNA gene MiSeq sequencing and mass spectrometry-based proteomics were utilised to identify the metataxonomic and metaproteomic profiles of the oral microbiome in both groups.Results From the metataxonomic analysis, the most abundant species in the three subgroups were Streptococcus oralis and Pseudomonas aeruginosa, accounting for up to 70% of the total population. Principal Coordinates Analysis showed differential clustering of samples from the healthy and OLP groups. ANCOM-BC compositional analysis revealed multiple species (including P. aeruginosa and several species of Veillonella, Prevotella, Streptococcus and Neisseria) significantly over-represented in the control group and several (including Granulicatella elegans, Gemella haemolysans and G. parahaemolysans) in patients with OLP. The metaproteomic data were generally congruent and revealed that several Gemella haemolysans-belonging peptidases and other proteins with inflammatory and virulence potential were present in OLP lesions.Conclusion Our data suggest that several bacterial species are associated with OLP. Future studies with larger cohorts should be conducted to determine their role in the aetiology of OLP and evaluate their potential as disease biomarkers.

The Lactobacillaceae are lactic acid bacteria harnessed to deliver important outcomes across numerous industries, and their unambiguous, species-level identification from mixed community environments is an important endeavor. Amplicon-based metataxonomics using short-read sequencing of partial 16S rRNA gene regions is widely used to support this, however, the high genetic similarity among Lactobacillaceae species restricts our ability to confidently describe these communities even at genus level. Long-read sequencing (LRS) of the whole 16S rRNA gene or the near complete rRNA operon (16S-ITS-23S) has the potential to improve this. We explored species ambiguity amongst Lactobacillaceae using in-silico tool RibDif2, which identified allele overlap when various partial and complete 16S rRNA gene and 16S-ITS-23S rRNA regions were amplified. We subsequently implemented LRS by MinION™ to compare the capacity of V3–V4, 16S and 16S-ITS-23S rRNA amplicons to accurately describe the diversity of a 20-species Lactobacillaceae mock community in practice. In-silico analysis identified more instances of allele/species overlap with V3–V4 amplicons (n = 43) compared to the 16S rRNA gene (n = 11) and partial (n = up to 15) or complete (n = 0) 16S-ITS-23S rRNA amplicons. With subsequent LRS of a DNA mock community, 80% of target species were identified using V3–V4 amplicons whilst the 16S rRNA gene and 16S-ITS-23S rRNA region amplicons resulted in 95 and 100% of target species being identified. A considerable reduction in false-positive identifications was also seen with 16S rRNA gene (n = 3) and 16S-ITS-23S rRNA region (n = 9) amplicons compared with V3–V4 amplicons (n = 43). Whilst the target species affected by allele overlap in V3–V4 and 16S rRNA gene sequenced mock communities were predicted by RibDif2, unpredicted species ambiguity was observed in 16S-ITS-23S rRNA sequenced communities. Considering the average nucleotide identity (ANI) between ambiguous species (~97%) and the basecall accuracy of our MinION™ sequencing protocol (96.4%), the misassignment of reads between closely related taxa is to be expected. With basecall accuracy exceeding 99% for recent MinION™ releases, the increased species-level differentiating power promised by longer amplicons like the 16S-ITS-23S rRNA region, may soon be fully realized.

Intestinal parasites continue to pose a significant threat to human health worldwide, particularly among children. Contaminated water and soil serve as major transmission vehicles for these parasites and intestinal protists are among the most prevalent parasites in both developed and developing nations. Traditionally, parasites have been studied using human or animal fecal samples, while studying them in environmental samples has been challenging due to technical limitations. However, advancements in Next-Generation Sequencing (NGS) and bioinformatic approaches now enable the detection of parasite DNA in environmental samples. In this study, we applied a metataxonomic and phylogenetic strategy to detect and classify DNA of protists present in sewage sludge from two major cities in Colombia: Medellin and Cali. We successfully detected several human pathogenic parasites including Giardia intestinalis, Entamoeba histolytica, and Blastocystis sp., among other protists, in all sludge samples examined. We also investigated the entry and exit of parasite DNA from the San Fernando wastewater treatment plant (WWTP). We observed a higher number of parasite DNA sequences in the plant's influent wastewater, but we also detected the discharge of DNA from pathogenic parasites in both effluent waters and biosolids.

ABSTRACTAge-related gut microbes and urine metabolites were investigated in 568 healthy individuals using metataxonomics and metabolomics. The richness and evenness of the fecal microbiota significantly increased with age, and the abundance of 16 genera differed between the young and old groups. Additionally, 17 urine metabolites contributed to the differences between the young and old groups. Among the microbes that differed by age, Bacteroides and Prevotella 9 were confirmed to be correlated with some urine metabolites. The machine learning algorithm eXtreme gradient boosting (XGBoost) was shown to produce the best performing age predictors, with a mean absolute error of 5.48 years. The accuracy of the model improved to 4.93 years with the inclusion of urine metabolite data. This study shows that the gut microbiota and urine metabolic profiles can be used to predict the age of healthy individuals with relatively good accuracy.

ABSTRACT The lacustrine systems of La Brava and La Punta, located in the Tilopozo sector in the extreme south of Salar de Atacama, are pristine high-altitude Andean lakes found along the central Andes of South America. This shallow ecosystem suffers from permanent evaporation, leading to falling water levels, causing it to recede or disappear during the dry season. This dynamic causes physicochemical changes in lakes, such as low nutrient availability, pH change, and dissolved metals, which can influence the composition of the microbial community. In this study, we used a metataxonomic approach (16S rRNA hypervariable regions V3 to V4) to characterize the sedimentary microbiota of these lakes. To understand how the water column affects and is structured in the microbiota of these lakes, we combined the analysis of the persistence of the water column through satellite images and physicochemical characterization. Our results show a significant difference in abiotic factors and microbiota composition between La Punta and La Brava lakes. In addition, microbiota analysis revealed compositional changes in the ecological disaggregation (main and isolated bodies) and antagonistic changes in the abundance of certain taxa between lakes. These findings are an invaluable resource for understanding the microbiological diversity of high Andean lakes using a multidisciplinary approach that evaluates the microbiota behavior in response to abiotic factors. IMPORTANCE In this study, we analyzed the persistence of the water column through satellite images and physicochemical characterization to investigate the composition and diversity in High Andean Lake Systems in a hyperarid environment. In addition to the persistence of the water column, this approach can be used to analyze changes in the morphology of saline accumulations and persistence of snow or ice; for example, for establishing variable plant cover over time and evaluating the microbiota associated with soils with seasonal changes in plants. This makes it an ideal approach to search for novel extremophilic microorganisms with unique properties. In our case, it was used to study microorganisms capable of resisting desiccation and water restriction for a considerable period and adapting to survive in ecological niches, such as those with high UV irradiation, extreme drought, and high salt concentration.

ABSTRACT Rarely has the vast diversity of bacteria on Earth been profiled, particularly on inaccessible plateaus. These uncultured microbes, which are also known as “microbial dark matter,” may play crucial roles in maintaining the ecosystem and are linked to human health, regarding pathogenicity and prebioticity. The plateau pika (Ochotona curzoniae) is a small burrowing steppe lagomorph that is endemic to the Qinghai-Tibetan Plateau and is a keystone species in the maintenance of ecological balance. We used a combination of full-length 16S rRNA amplicon sequencing, shotgun metagenomics, and metabolomics to elucidate the species-level community structure and the metabolic potential of the gut microbiota of the plateau pika. Using a full-length 16S rRNA metataxonomic approach, we clustered 618 (166 ± 35 per sample) operational phylogenetic units (OPUs) from 105 plateau pika samples and assigned them to 215 known species, 226 potentially new species, and 177 higher hierarchical taxa. Notably, 39 abundant OPUs (over 60% total relative abundance) are found in over 90% of the samples, thereby representing a “core microbiota.” They are all classified as novel microbial lineages, from the class to the species level. Using metagenomic reads, we independently assembled and binned 109 high-quality, species-level genome bins (SGBs). Then, a precise taxonomic assignment was performed to clarify the phylogenetic consistency of the SGBs and the 16S rRNA amplicons. Thus, the majority of the core microbes possess their genomes. SGBs belonging to the genus Treponema, the families Muribaculaceae, Lachnospiraceae, and Oscillospiraceae, and the order Eubacteriales are abundant in the metagenomic samples. In addition, multiple CAZymes are detected in these SGBs, indicating their efficient utilization of plant biomass. As the most widely connected metabolite with the core microbiota, tryptophan may relate to host environmental adaptation. Our investigation allows for a greater comprehension of the composition and functional capacity of the gut microbiota of the plateau pika. IMPORTANCE The great majority of microbial species remain uncultured, severely limiting their taxonomic characterization and biological understanding. The plateau pika (Ochotona curzoniae) is a small burrowing steppe lagomorph that is endemic to the Qinghai-Tibetan Plateau and is considered to be the keystone species in the maintenance of ecological stability. We comprehensively investigated the gut microbiota of the plateau pika via a multiomics endeavor. Combining full-length 16S rRNA metataxonomics, shotgun metagenomics, and metabolomics, we elucidated the species-level taxonomic assignment of the core uncultured intestinal microbiota of the plateau pika and revealed their correlation to host nutritional metabolism and adaptation. Our findings provide insights into the microbial diversity and biological significance of alpine animals.

BackgroundMenstrual cups (MCs) are increasingly used to collect cervicovaginal secretions to characterise vaginal mucosal immunology, in conjunction with high vaginal swabs (HVS) for metataxonomics, particularly in HIV transmission studies. We hypothesised that both methods of collecting bacterial biomass are equivalent for 16S rRNA gene sequencing.Material and MethodsCervicovaginal fluid (CVF) samples from 16 pregnant women with HIV-1 (PWWH) were included to represent the major vaginal bacterial community state types (CST I-V). Women underwent sampling during the second trimester by liquid amies HVS followed by a MC (Soft disc™) and samples were stored at -80°C. Bacterial cell pellets obtained from swab elution and MC (500 µL, 1 in 10 dilution) were resuspended in 120 µL PBS for DNA extraction. Bacterial 16S rRNA gene sequencing was performed using V1-V2 primers and were analysed using MOTHUR. Paired total DNA, bacterial load, amplicon read counts, diversity matrices and bacterial taxa were compared by sampling method using MicrobiomeAnalyst, SPSS and R.ResultsThe total DNA eluted from one aliquot of diluted CVF from an MC was similar to that of a HVS (993ng and 609ng, p=0.18); the mean bacterial loads were also comparable for both methods (MC: 8.0 log10 16S rRNA gene copies versus HVS: 7.9 log10 16S rRNA gene copies, p=0.27). The mean number of sequence reads generated from MC samples was lower than from HVS (MC: 12730; HVS:14830, p=0.05). The α-diversity metrices were similar for both techniques; MC Species Observed: 41 (range 12-96) versus HVS: 47 (range 16-96), p=0.15; MC Inverse Simpson Index: 1.98 (range 1.0-4.0) versus HVS: 0.48 (range 1.0-4.4), p=0.22). The three most abundant species observed were: Lactobacillus iners, Lactobacillus crispatus and Gardnerella vaginalis. Hierarchical clustering of relative abundance data showed that samples obtained using different techniques in an individual clustered in the same CST group.ConclusionThese data demonstrate that despite sampling slightly different areas of the lower genital tract, there was no difference in bacterial load or composition between methods. Both are suitable for characterisation of vaginal microbiota in PWWH. The MC offers advantages, including a higher volume of sample available for DNA extraction and complimentary assays.

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety.

In this paper, we consider the development of reliable tools to assess the water quality and state of aquatic ecosystems in dynamic conditions a crucial need to address. One of such tools could be devised by monitoring the taxonomic structure of reservoirs’ microbiomes. Microbial taxa’s ecological and metabolic characteristics suggest their essential roles in maintaining the water ecosystem’s environmental equilibrium. The study aimed to explainthe role of diversity and seasonal variability of the microbial communities in the ecosystem stability on the example of Goczałkowice Reservoir (Poland). The structure of the reservoir microbiome was studied using bioinformatics and modeling techniques. Water was sampled periodically in July & November 2010, and April 2011 at four representative sites. The abundance and relative fraction of the limnetic taxonomic units were determined in respectto the physicochemical indices. Significant seasonal variations in the number of operational taxonomic units (OTU)were observed within the reservoir basin’s main body but not at the main tributary’s mouth. The highest valuesof the correlation coefficients between OTU and physicochemical variables were obtained for Burkholderiales,Pseudoanabenales, Rickettsiales, Roseiflexales, Methylophilales, Actinomycetales, and Cryptophyta. Thesemicroorganisms are proposed as indicators of environmental conditions and water quality. Metataxonomic analyses of the fresh water microbiome in the reservoir, showed that microorganisms constitute conservative communities that undergo seasonal and local changes regarding the relative participation of the identified taxa. Therefore, we propose that monitoring those variations could provide a reliable measure of the state of aquatic ecosystems.

Abstract Background Vaginal microbiota (VMB) composition is altered in women with cervical intra-epithelial neoplasia (CIN) compared to healthy controls and is associated with disease progression. However, the impact of CIN excision on the VMB and innate immunity is not known. This observational study aims to explore the impact of CIN excision on the VMB, antimicrobial peptides (AMP) and proinflammatory cytokines. Methods We sampled 103 non-pregnant, premenopausal women at the time of excisional treatment for CIN and at their 6-month follow-up visit. A further 39 untreated controls with normal cytology were also sampled. We used metataxonomics to group vaginal swab samples into community state types (CSTs) and ELISA to quantify cytokine and AMP levels in matched vaginal secretions. Analyses were performed to compare the bacterial composition and immune analyte levels before and after CIN excision and in healthy controls. Results Women with CIN had significantly higher rates of Lactobacillus species depletion pre-treatment compared to healthy controls (CST IV 21/103, 20% vs 1/39, 3%, p = 0.0081). Excision did not change the VMB composition, with CST IV remaining significantly more prevalent after excision compared to untreated, healthy controls (CST IV 19/103, 20% vs 1/39, 3%, p = 0.0142). Prevotella bivia and Sneathia amnii were significantly higher in samples before treatment compared to untreated controls, and Prevotella bivia remained significantly higher amongst the treated, with less Lactobacillus crispatus compared to untreated controls. IL-1β and IL-8 remained significantly elevated pre- (p < 0.0001 and p = 0.0014, respectively) and post-treatment (p < 0.0001 and p = 0.0035, respectively) compared to untreated controls. Levels of human beta-defensin-1 and secretory leukocyte protease inhibitor were both significantly reduced following CIN excision (p < 0.0001); however, their levels remained lower than controls post-treatment. Conclusions Women with CIN have an increased prevalence of Lactobacillus sp. depletion, high-diversity VMB composition, and higher levels of proinflammatory cytokines and AMPs compared to normal controls. Surgical excision of the disease reduces levels of vaginal AMPs but does not alter VMB composition or cytokine levels. These findings suggest that women with CIN have an inherent predisposition to a high-diversity proinflammatory environment that is not corrected by disease excision. The failure to re-establish a Lactobacillus-enriched CST may explain why women remain at high risk of pre-invasive and invasive disease recurrence.

Elderly was the most affected population during the first COVID-19 and those living in nursing homes represented the most vulnerable group, with high mortality rates, until vaccines became available. In a previous article, we presented an open-label trial showing the beneficial effect of the strain Ligilactobacillus salivarius CECT 30632 (previously known as L. salivarius MP101) on the functional and nutritional status, and on the nasal and fecal inflammatory profiles of elderly residing in a nursing home highly affected by the pandemic. The objective of this post-hoc analysis was to elucidate if there were changes in the nasal and fecal bacteriomes of a subset of these patients as a result of the administration of the strain for 4 months and, also, its impact on their fecal fatty acids profiles. Culture-based methods showed that, while L. salivarius (species level) could not be detected in any of the fecal samples at day 0, L. salivarius CECT 30632 (strain level) was present in all the recruited people at day 120. Paradoxically, the increase in the L. salivarius counts was not reflected in changes in the metataxonomic analysis of the nasal and fecal samples or in changes in the fatty acid profiles in the fecal samples of the recruited people. Overall, our results indicate that L. salivarius CECT 30632 colonized, at least temporarily, the intestinal tract of the recruited elderly and may have contributed to improvements in their functional, nutritional, and immunological status, without changing the general structure of their nasal and fecal bacteriomes when assessed at the genus level. They also suggest the ability of low abundance bacteria to train immunity.

BackgroundPost-mortem microbial communities are increasingly investigated as proxy evidence for a variety of factors of interest in forensic science. The reported predictive power of the microbial community to determine aspects of the individual’s post-mortem history (e.g., the post-mortem interval) varies substantially among published research. This observed variation is partially driven by the local environment or the individual themselves. In the current study, we investigated the impact of BMI, sex, insect activity, season, repeat sampling, decomposition time, and temperature on the microbial community sampled from donated human remains in San Marcos, TX using a high-throughput gene-fragment metabarcoding approach.Materials and methodsIn the current study, we investigated the impact of BMI, sex, insect activity, season, repeat sampling, decomposition time, and temperature on the microbial community sampled from donated human remains in San Marcos, TX using a high-throughput gene-fragment metabarcoding approach.ResultsWe found that season, temperature at the sampling site, BMI, and sex had a significant effect on the post-mortem microbiome, the presence of insects has a homogenizing influence on the total bacterial community, and that community consistency from repeat sampling decreases as the decomposition process progresses. Moreover, we demonstrate the importance of temperature at the site of sampling on the abundance of important diagnostic taxa.ConclusionThe results of this study suggest that while the bacterial community or specific bacterial species may prove to be useful for forensic applications, a clearer understanding of the mechanisms underpinning microbial decomposition will greatly increase the utility of microbial evidence in forensic casework.

ABSTRACT Bats have attracted global attention because of their zoonotic association with severe acute respiratory syndrome coronavirus (SARS-CoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Previous and ongoing studies have predominantly focused on bat-borne viruses; however, the prevalence or abundance of bat-borne pathogenic bacteria and their potential public health significance have largely been neglected. For the first time, this study used both metataxonomics (16S rRNA marker gene sequencing) and culturomics (traditional culture methods) to systematically evaluate the potential public health significance of bat fecal pathogenic bacteria. To this end, fecal samples were obtained from five bat species across different locations in China, and their microbiota composition was analyzed. The results revealed that the bat microbiome was most commonly dominated by Proteobacteria, while the strictly anaerobic phylum Bacteroidetes occupied 35.3% of the relative abundance in Rousettus spp. and 36.3% in Hipposideros spp., but less than 2.7% in the other three bat species (Taphozous spp., Rhinolophus spp., and Myotis spp.). We detected 480 species-level phylotypes (SLPs) with PacBio sequencing, including 89 known species, 330 potentially new species, and 61 potentially higher taxa. In addition, a total of 325 species were identified by culturomics, and these were classified into 242 named species and 83 potentially novel species. Of note, 32 of the 89 (36.0%) known species revealed by PacBio sequencing were found to be pathogenic bacteria, and 69 of the 242 (28.5%) known species isolated by culturomics were harmful to people, animals, or plants. Additionally, nearly 40 potential novel species which may be potential bacterial pathogens were identified. IMPORTANCE Bats are one of the most diverse and widely distributed groups of mammals living in close proximity to humans. In recent years, bat-borne viruses and the viral zoonotic diseases associated with bats have been studied in great detail. However, the prevalence and abundance of pathogenic bacteria in bats have been largely ignored. This study used high-throughput sequencing techniques (metataxonomics) in combination with traditional culture methods (culturomics) to analyze the bacterial flora in bat feces from different species of bats in China, revealing that bats are natural hosts of pathogenic bacteria and carry many unknown bacteria. The results of this study can be used as guidance for future investigations of bacterial pathogens in bats.

Potable water supply and sanitization inrural areas in developing countries are still inadequate. The main risk associated with unsafe drinking water is the infection with pathogenic microorganisms. Objective: In this study, we investigate the bacterial diversity and the potentially pathogenic bacteria in water samples from diffe-rent points of distribution in three rural villages from the Andean region of Colombia. Methods: Illumina libraries for water samples were prepared and sequenced using 300 bp paired-end MiSeq protocol, the bioinformatic analyses were performed with Mothur pipeline and the phyloseq package in Rstudio. Results: The mi-crobial community composition showed statistically significant differences according to the village and the sample origin. Alpha, Beta, and Gammaproteobacteria were the dominant class detected in all water samples. The most relevant pathogenic genera detected in the surface were Legionella, Mycobacterium, Yersinia, Burkholderia, and Rickettsia. In the tap water samples, potential pathogens like Streptococcus, Staphylococcus, Corynebacterium, Nocardia, and Escherichia/Shige-lla were detected.

ABSTRACT Salar de Atacama is located approximately 55 km south of San Pedro de Atacama in the Antofagasta region, Chile. The high UV irradiation and salt concentration and extreme drought make Salar de Atacama an ideal site to search for novel soil microorganisms with unique properties. Here, we used a metataxonomic approach (16S rRNA V3-V4) to identify and characterize the soil microbiota associated with different surface azonal vegetation formations, including strict hygrophiles (Baccharis juncea, Juncus balticus, and Schoenoplectus americanus), transitional hygrophiles (Distichlis spicata, Lycium humile, and Tessaria absinthioides), and their various combinations. We detected compositional differences among the soil surface microbiota associated with each plant formation in the sampling area. There were changes in soil microbial phylogenetic diversity from the strict to the transitional hygrophiles. Moreover, we found alterations in the abundance of bacterial phyla and genera. Halobacteriota and Actinobacteriota might have facilitated water uptake by the transitional hygrophiles. Our findings helped to elucidate the microbiota of Salar de Atacama and associate them with the strict and transitional hygrophiles indigenous to the region. These findings could be highly relevant to future research on the symbiotic relationships between microbiota and salt-tolerant plants in the face of climate change-induced desertification. IMPORTANCE The study of the composition and diversity of the wetland soil microbiota associated with hygrophilous plants in a desert ecosystem of the high Puna in northern Chile makes it an ideal approach to search for novel extremophilic microorganisms with unique properties. These microorganisms are adapted to survive in ecological niches, such as those with high UV irradiation, extreme drought, and high salt concentration; they can be applied in various fields, such as biotechnology and astrobiology, and industries, including the pharmaceutical, food, agricultural, biofuel, cosmetic, and textile industries. These microorganisms can also be used for ecological conservation and restoration. Extreme ecosystems are a unique biological resource and biodiversity hot spots that play a crucial role in maintaining environmental sustainability. The findings could be highly relevant to future research on the symbiotic relationships between microbiota and extreme-environment-tolerant plants in the face of climate change-induced desertification.

Bacterial pathogens in the domestic environment present a risk to residents, particularly among susceptible populations. However, the impact of consumer demographic characteristics and food handling methods on kitchen microbiomes is not fully understood. The domestic kitchen bacterial communities of ten predominantly low-income families in Houston, TX, were assessed in conjunction with a cross-sectional food safety survey to evaluate differences in household and surface-specific microbiomes and bacterial foodborne pathogen presence. Three kitchen surfaces within each household, including the sink drain, the refrigerator handle, and the counter, were environmentally sampled and metataxonomically evaluated via targeted 16S rRNA sequencing. Disposable dish sponges were also acquired and examined. Results indicated that alpha diversity did not vary by the households, sampling locations, or demographic characteristics evaluated. Significant differences in beta diversity were observed among the bacterial communities of five pairs of households and between refrigerator handle and disposable dish sponge microbiomes. A total of 89 unique bacterial foodborne pathogens were identified across surface types. Each household contained at least one contaminated surface, and the most common bacterial foodborne pathogens identified were Escherichia coli, Staphylococcus aureus, and Klebsiella pneumoniae. All parents reported washing their hands before meal preparation, washing fresh fruits and vegetables, and washing cutting boards with soap after use to prepare raw animal proteins. Gaps in food safety behaviors identified included a lack of serious concern for food contamination with germs and inappropriate handwashing, food handling, and cleaning behaviors. The number of unique bacterial foodborne pathogens identified within households was significantly higher among households whose respondent parent reported that they did not consider food contamination with germs to be a serious food safety problem (median: 41.0 species) compared to households whose respondent parent did consider food contamination to be a serious food safety problem (median: 3.0 species; p value = 0.0218). These results demonstrate that domestic kitchen taxonomic abundance profiles vary according to household and surface type. Data suggest that low-income consumers may be at risk of foodborne pathogen exposure from contaminated home kitchen surfaces, and that food safety attitudes may directly contribute to this hazard.

ObjectivesTo characterize the healthy ocular surface microbiota at the species level, including cultured and uncultured taxa.MethodsWe integrated the metataxonomic method with culturomics and genome sequencing analysis of selected isolated strains to better illustrate the taxonomic structure of the ocular surface microbiota. The metataxonomics used the full-length 16S rRNA gene sequences and the operational phylogenetic unit strategy, which can precisely identify the cultured and uncultured or potentially new taxa to species level based on the phylogenetic tree constructed.ResultsWe detected 1,731 operational phylogenetic units (OPUs) in 196 healthy eyes from 128 people, affiliated to 796 cultured species, 784 potentially new species, and 151 potentially new higher taxa. The microbiota for each eye had 49.17 ± 35.66 OPUs. Of the 796 cultured species, 170 (21.36%) had previously caused clinical infections. Based on where they were initially isolated, the ocular surface microbiota mainly came from human body sites (34.55%), the environment (36.93%), plants (9.05%), animals (4.90%), and others; 428 strains were isolated from 20 eyes, affiliated to 42 species, and had come from the environment (33.33%) and the skin (16.67%). Of these, 47.62% had previously caused clinical infections. Genome analysis of 73 isolators revealed that 68.5% of them carried antibiotic resistance genes. The most frequently isolated genera, namely Staphylococcus, Streptococcus, and Moraxella, had an average of 5.30, four, and three resistance genes per strain, respectively.DiscussionThe study found that the ocular surface microbiota mainly came from the environment, plants, animals, food, and human body sites such as the skin, oral cavity, upper respiratory tract, etc. No core member of ocular surface microbiota was detected at the species level. The human eyes were invaded and colonized by bacteria from the exposed environment, some of which were capable of causing infections in humans and carried antibiotic resistance genes. Preventive measures should be developed to protect our eyes from danger.

The North Atlantic Ocean surrounds Iceland, influencing its climate and hosting a rich ecosystem that provides the Icelandic nation with economically valuable marine species. The basis of the Icelandic marine ecosystem consists of communities of diverse microorganisms including bacteria, archaea, and unicellular eukaryotes. While the primary production of Icelandic waters has been monitored since the 50s, there is limited knowledge of the taxonomic and metabolic diversity of the marine microorganisms in Icelandic waters based on molecular techniques. In this study, we conducted annual sampling at four hydrographic stations over several years to characterize marine microbial communities and their metabolic potential. Using 16S ribosomal RNA gene amplicon sequencing and metagenomics, we resolved the microbial community composition on the North and South Shelves of Iceland, analyzed its evolution from 2011 to 2018, identified frequently occurring taxa, and predicted their potential metabolism. The results showed correlations between the marine microbial community profiles and the water masses in spring, between the North and South Shelves of Iceland. The differences in marine microbial diversity appear to be linked to the average seawater temperature in the mixed surface layer at each sampling station which also constrains the relative abundance of photosynthetic microorganisms. This study set a baseline for the marine microbial diversity in Icelandic marine waters and identified three photosynthetic microorganisms – the cyanobacteria Synechococcus and two members of the Chlorophyta clade – as valuable indicator species for future monitoring, as well as for application in ecosystem modeling in context with research on climate change.

The study of microbial communities or microbiotas in animals and environments is important because of their impact in a broad range of industrial applications, diseases and ecological roles. High throughput sequencing (HTS) is the best strategy to characterize microbial composition and function. Microbial profiles can be obtained either by shotgun sequencing of genomes, or through amplicon sequencing of target genes (e.g., 16S rRNA for bacteria and ITS for fungi). Here, we compared both HTS approaches at assessing taxonomic and functional diversity of bacterial and fungal communities during vermicomposting of white grape marc. We applied specific HTS workflows to the same 12 microcosms, with and without earthworms, sampled at two distinct phases of the vermicomposting process occurring at 21 and 63 days. Metataxonomic profiles were inferred in DADA2, with bacterial metabolic pathways predicted via PICRUSt2. Metagenomic taxonomic profiles were inferred in PathoScope, while bacterial functional profiles were inferred in Humann2. Microbial profiles inferred by metagenomics and metataxonomics showed similarities and differences in composition, structure, and metabolic function at different taxonomic levels. Microbial composition and abundance estimated by both HTS approaches agreed reasonably well at the phylum level, but larger discrepancies were observed at lower taxonomic ranks. Shotgun HTS identified ~1.8 times more bacterial genera than 16S rRNA HTS, while ITS HTS identified two times more fungal genera than shotgun HTS. This is mainly a consequence of the difference in resolution and reference richness between amplicon and genome sequencing approaches and databases, respectively. Our study also revealed great differences and even opposite trends in alpha- and beta-diversity between amplicon and shotgun HTS. Interestingly, amplicon PICRUSt2-imputed functional repertoires overlapped ~50% with shotgun Humann2 profiles. Finally, both approaches indicated that although bacteria and fungi are the main drivers of biochemical decomposition, earthworms also play a key role in plant vermicomposting. In summary, our study highlights the strengths and weaknesses of metagenomics and metataxonomics and provides new insights on the vermicomposting of white grape marc. Since both approaches may target different biological aspects of the communities, combining them will provide a better understanding of the microbiotas under study.

Caged salmon farming is increasingly undertaken in water bodies with strong hydrodynamics where hard and mixed substrate habitats are more prevalent. Yet, these structurally complex and heterogeneous habitats support diverse benthic communities including several cnidarians and sponges that remain poorly characterized. This study used a combination of respirometry measurements, gas chromatography and 16S rRNA metabarcoding to define the respiration rate, stable carbon (δ13C) and nitrogen isotopes (δ15N), fatty acid (FA) and microbial profiles, and assess the impact of salmon farming on four important epibenthic suspension-feeders along the western Norwegian coast: the sponges Craniella and Weberella, the soft coral Duva florida and the anemone Hormathia digitata. Our results showed striking differences in fatty acid profiles and host microbiome communities in terms of identity, functional capabilities and genetic properties across the suspension-feeders. We found evidence of increased mortality rate in specimens located near fish farm activities and of a species-specific effect on respiration rate, with D. florida showing increased activity under the farm. Effects of fish farming on the suspension feeders were also species-specific and particularly evidenced by functional microbial turnover and by alteration of overall FA profiles in the soft coral and sea anemone. In particular, D. florida showed reduced level of FAs close to the farm (0-350 m), with significant difference in composition along a distance gradient. Only H. digitata showed evidence of incorporation of organic material from the fish farm waste via fatty acids trophic markers (FATM) and stable isotope analysis. Overall, our study demonstrates that suspension feeders have taxon-specific sensitivity towards the effect of salmon farming, and identified several potential molecular indicators that could be used as surrogate of impact gradient upon further research and validation. It also provides a wealth of ecological and physiological information on some of the most common sessile epibenthic organisms within Arctic and sub-Arctic regions, enabling us to better understand their response and evaluate their resilience to environmental changes.

Dry fermented sausage innovation trends are linked to consumer preferences for clean label and sodium-reduced foods. This study aims to evaluate the effect of the formulation and production process temperature on the dynamics of bacterial communities in fuet-type dry fermented sausages using metataxonomics. Six fuet batches were manufactured, including formulations without and with the addition of nitrifying salts (replaced or not by pork liver auto-hydrolysate as a colouring agent), processed at 3 to 12 °C, and a partial replacement of NaCl by KCl, processed at 12 °C. Fermentation was performed spontaneously or by a starter culture. Physicochemical characterisation and culture-dependent and independent bacterial analyses were performed at day 0, 4 and 12, at the end of ripening (aw < 0.90) and after storage. Temperature was the most important factor determining the change in pH, aw and lactic acid bacteria levels while the presence of a starter culture promoted a pH decrease. Metataxonomic analysis showed that low temperature processes and the absence of nitrifying salts allowed the growth of spoilage-related species, while sausages submitted to a mild temperature containing a starter culture and nitrifying salts showed less bacterial diversity. Liver auto-hydrolysate added putative probiotic species to the product. This study provides valuable information to manufacturers who want to innovate safely.

Background: Biofilms, when formed on the surfaces of water pipes, can be responsible for a wide range of water quality and operational problems. We sought to assess the bacterial and free-living protozoa (FLP) diversity, in relation to the presence of Legionnaire's disease-causing bacteria Legionella pneumophila (L. pneumophila) in 45 biofilms of hot water distribution system pipes of apartment buildings in Riga, the capital city of Latvia.Results: 16S rRNA amplicon sequencing (metataxonomics) revealed that each biofilm contained 224 rather evenly distributed bacterial genera and that most common and most abundant were two genera, completely opposites in terms of their oxygen requirements: the obligately anaerobic Thermodesulfovibrio and the strictly aerobic Phenylobacterium. Water temperature and north-south axis (i.e., different primary water sources) displayed the most significant effect on the inter-sample variations, allowing us to re-construct three sub-networks (modules) of co-occurring genera, one involving (potentially FLP-derived) Legionella spp. Pangenome-based functional profile predictions suggested that all three may be dominated by pathways related to the development and maintenance of biofilms, including quorum sensing and nutrient transport, as well as the utilization of various energy sources, such as carbon and nitrogen. In our 18S rRNA amplicon sequencing data, potential hosts of L. pneumophila were detected in 11 out of 12 biofilm samples analyzed, however, in many cases, their relative abundance was very low (

Edible mushrooms contain biologically active compounds with antioxidant, antimicrobial, immunomodulatory and anticancer properties. The link between their anticancer and immunomodulatory properties with their possible prebiotic activity on gut micro-organisms has been the subject of intense research over the last decade. Lyophilized Pleurotus eryngii (PE) mushrooms, selected due to their strong lactogenic effect and anti-genotoxic, immunomodulatory properties, underwent in vitro static batch fermentation for 24 h by fecal microbiota from eight elderly apparently healthy volunteers (>65 years old). The fermentation-induced changes in fecal microbiota communities were examined using Next Generation Sequencing of the hypervariable regions of the 16S rRNA gene. Primary processing and analysis were conducted using the Ion Reporter Suite. Changes in the global metabolic profile were assessed by 1H NMR spectroscopy, and metabolites were assigned by 2D NMR spectroscopy and the MetaboMiner platform. PLS-DA analysis of both metataxonomic and metabolomic data showed a significant cluster separation of PE fermented samples relative to controls. DEseq2 analysis showed that the abundance of families such as Lactobacillaceae and Bifidobacteriaceae were increased in PE samples. Accordingly, in metabolomics, more than twenty metabolites including SCFAs, essential amino acids, and neurotransmitters discriminate PE samples from the respective controls, further validating the metataxonomic findings.

The present study aimed to determine whether dietary supplementation with methanogen inhibitors during early life may lead to an imprint on the rumen microbial community and change the rumen function and performance of calves to 49-weeks of rearing. Twenty-four 4-day-old Friesian x Jersey cross calves were randomly assigned into a control and a treatment group. Treated calves were fed a combination of chloroform (CF) and 9,10-anthraquinone (AQ) in the solid diets during the first 12 weeks of rearing. Afterward, calves were grouped by treatments until week 14, and then managed as a single group on pasture. Solid diets and water were offered ad libitum. Methane measurements, and sample collections for rumen metabolite and microbial community composition were carried out at the end of weeks 2, 4, 6, 8, 10, 14, 24 and 49. Animal growth and dry matter intake (DMI) were regularly monitored over the duration of the experiment. Methane emissions decreased up to 90% whilst hydrogen emissions increased in treated compared to control calves, but only for up to 2 weeks after treatment cessation. The near complete methane inhibition did not affect calves’ DMI and growth. The acetate:propionate ratio decreased in treated compared to control calves during the first 14 weeks but was similar at weeks 24 and 49. The proportions of Methanobrevibacter and Methanosphaera decreased in treated compared to control calves during the first 14 weeks; however, at week 24 and 49 the archaea community was similar between groups. Bacterial proportions at the phylum level and the abundant bacterial genera were similar between treatment groups. In summary, methane inhibition increased hydrogen emissions, altered the methanogen community and changed the rumen metabolite profile without major effects on the bacterial community composition. This indicated that the main response of the bacterial community was not a change in composition but rather a change in metabolic pathways. Furthermore, once methane inhibition ceased the methanogen community, rumen metabolites and hydrogen emissions became similar between treatment groups, indicating that perhaps using the treatments tested in this study, it is not possible to imprint a low methane microbiota into the rumen in the solid feed of pre-weaned calves.

Sea cage fish farms are increasingly situated over hard and mixed substrate habitats for production and waste-dispersion reasons; yet in many cases, these installations are not being effectively managed with respect to benthic impacts due to the lack of a practical sampling method. This study presents the first set of results from a newly developed Substrate Independent Benthic Sampler (SIBS) device that captures the unconsolidated organic and inorganic matter that overlies almost all substrates. The contents of the samples were analyzed using extracted environmental DNA (eDNA) followed by metabarcoding of the bacterial 16S rRNA gene. SIBS microbial assemblages reliably changed with proximity to farm and concurred with visual assessments of impact. Moreover, the approach appeared to be very sensitive with respect to the enrichment gradient, being able to discern influences at distances of 500–1500 m from the impact source. Other spatial differences, due to region and farm, were small in comparison, and the effect of the underlying substrate type was minor. The samples contained sufficient previously described bacterial bioindicator taxa from enriched sediments, such that a meaningful biotic index could be calculated, thereby placing them on a well-established benthic enrichment spectrum with established environmental thresholds. SIBS-derived bacterial data provide a powerful new approach for mapping spatial boundaries of farm effects irrespective of substrate type and topography. More importantly, the tool should also permit quantitative assessment of benthic enrichment levels irrespective of substrate type from depths of at least 100 m. It therefore has the potential to solve the hard-bottom problem that has until now prohibited effective environmental monitoring at mixed and hard-bottom locations.

Abstract The floods of 2018 caused havoc in the State of Kerala, situated in the extreme south‐west of India, in terms of infrastructure and health. This research article provides the first‐ever assessment of the bacterial diversity and its antibiotic susceptibility of the inundated areas of Pampa, Periyar and Vembanad waterbodies by comparing the data collected in two different time intervals succeeding the calamitous floods that is, immediately after flood and 5 months post‐flood. An elevated total coliform count was detected in the waterbodies after the flood thereby rendering it unsafe for drinking. Variation in bacterial diversity was observed in the river and lake water samples with a distinct increase in that of the river samples immediately after flood indicated by shannon diversity index (>5.5). Resistance to ampicillin and cefotaxime was observed in a major proportion of isolates from the three biotopes thus indicating the influence of antibiotic wastes accumulated from different sources of human interventions. Furthermore, operational taxonomic units clustering to Acinetobacter, Legionella, Pseudomonas and Burkholderia genera were detected by metataxonomic analysis which portray as a potential health risk in the future. The article emphasises the importance of adopting sanitation programmes for effective management of epidemic outbreaks post floods.

The current understanding of human gut microbial community is mainly limited to taxonomic features at the genus level. Here, we examined the human gut microbial community at the species level by metataxonomics. To achieve this purpose, a high-throughput approach involving operational phylogenetic unit analysis of the near full-length 16S ribosomal RNA (rRNA) gene sequence was used. A total of 1,235 species-level phylotypes (SLPs) were classified in the feces of 120 Chinese healthy individuals, including 461 previously classified species, 358 potentially new species, and 416 potentially new taxa, which were categorized into low, medium, and high prevalent bacteria groups based on their prevalence. Each individual harbored 186 ± 51 SLPs on average. There was no universal bacterial species shared by all the individuals. However, 90 ± 19 of 116 SLPs were shared in the high prevalent bacteria group. Thirty-two out of thirty-eight species in the high prevalent bacteria group detected in this study were also found in at least one previous study on human gut microbiota based on either culture-dependent or culture-independent approaches. Through compositional analysis, a hierarchical clustering of the prevalence and relative abundance of the 1,235 SLPs revealed two types of gut microbial communities, which were dominated by Prevotella copri and Bacteroides vulgatus, respectively. The type dominated by P. copri was more prevalent in northern China, while the B. vulgatus-dominant type was more prevalent in southern China. Therefore, P- and B-type gut microbial communities in China were proposed. It was found that 166 out of 461 known bacterial species have been previously reported as potential pathogens, and the individuals sampled for this study harbored 20 of these potential pathogenic species on average. The top two most abundant and prevalent potential pathogenic species were Klebsiella pneumoniae and Bacteroides fragilis.

The complex rumen microbiota exhibits some degree of host specificity. The undeveloped simple rumen microbiota is hypothetically more amendable. The objective of this study was to investigate if the rumen prokaryotic microbial assemblage of young calves can be reprogrammed by oral inoculation with rumen microbiota of adult cows. Twenty newborn male calves were randomly assigned to four groups (n = 5 per group), with two groups being orally inoculated with rumen microbiota (fresh rumen fluid) collected from two lactating dairy cows, while the other two groups receiving autoclaved rumen fluid collected from another two donor cows. Each calf was orally drenched with 100, 200, 300, 400, and 500 mL of the rumen fluid at d3, d7, d21, d42, and d50, respectively, after birth. The inoculation with rumen microbiota did not affect (P > 0.05) feed intake, average daily gain (ADG), heart girth, or feed conversion ratio but significantly (P < 0.01) lowered instance of diarrhea. At the age of 77 days (27 days post-weaning), all the calves were slaughtered for the sampling of rumen content and determination of empty rumen weight. Rumen fermentation characteristics were not affected (P > 0.05) by the inoculation. Rumen prokaryotic microbiota analysis using metataxonomics (targeting the V4 region of the 16S rRNA genes) showed that the calf rumen prokaryotic microbiota differed from that of the donors. Two Succinivibrionaceae OTUs, two Prevotella OTUs, and one Succiniclasticum OTU were predominant (relative abundance > 2%) in the donors, but only one Succinivibrionaceae OTU was found in the calves. On the other hand, five other Prevotella OTUs were predominant (>3%) in the calves, but none of them was a major OTU in the donors. No correlation was observed in relative abundance of major OTUs or genera between the donor and the calves. Principal coordinates analysis (PCoA) based on weighted UniFrac distance showed no significant (P > 0.05) difference in the overall rumen prokaryotic microbiota profiles among the four calf groups, and principal component analysis (PCA) based on Bray-Curtis dissimilarity showed no significant (P > 0.05) difference in functional features predicted from the detected taxa. Nor the calf rumen microbiota showed any clustering with their donor’s. Repeated oral inoculation with rumen microbiota probably has a limited effect on the development of rumen microbiota, and the rumen microbiota seems to develop following a program determined by the host and other factors.

Abstract Background Variation in induced models of autoimmunity has been attributed to the housing environment and its effect on the gut microbiota. In Graves’ disease (GD), autoantibodies to the thyrotropin receptor (TSHR) cause autoimmune hyperthyroidism. Many GD patients develop Graves’ orbitopathy or ophthalmopathy (GO) characterized by orbital tissue remodeling including adipogenesis. Murine models of GD/GO would help delineate pathogenetic mechanisms, and although several have been reported, most lack reproducibility. A model comprising immunization of female BALBc mice with a TSHR expression plasmid using in vivo electroporation was reproduced in two independent laboratories. Similar orbital disease was induced in both centers, but differences were apparent (e.g., hyperthyroidism in Center 1 but not Center 2). We hypothesized a role for the gut microbiota influencing the outcome and reproducibility of induced GO. Results We combined metataxonomics (16S rRNA gene sequencing) and traditional microbial culture of the intestinal contents from the GO murine model, to analyze the gut microbiota in the two centers. We observed significant differences in alpha and beta diversity and in the taxonomic profiles, e.g., operational taxonomic units (OTUs) from the genus Lactobacillus were more abundant in Center 2, and Bacteroides and Bifidobacterium counts were more abundant in Center 1 where we also observed a negative correlation between the OTUs of the genus Intestinimonas and TSHR autoantibodies. Traditional microbiology largely confirmed the metataxonomics data and indicated significantly higher yeast counts in Center 1 TSHR-immunized mice. We also compared the gut microbiota between immunization groups within Center 2, comprising the TSHR- or βgal control-immunized mice and naïve untreated mice. We observed a shift of the TSHR-immunized mice bacterial communities described by the beta diversity weighted Unifrac. Furthermore, we observed a significant positive correlation between the presence of Firmicutes and orbital-adipogenesis specifically in TSHR-immunized mice. Conclusions The significant differences observed in microbiota composition from BALBc mice undergoing the same immunization protocol in comparable specific-pathogen-free (SPF) units in different centers support a role for the gut microbiota in modulating the induced response. The gut microbiota might also contribute to the heterogeneity of induced response since we report potential disease-associated microbial taxonomies and correlation with ocular disease.

Vermicomposting is the process of organic waste degradation through interactions between earthworms and microbes. A variety of organic wastes can be vermicomposted, producing a nutrient-rich final product that can be used as a soil biofertilizer. Giving the prolific invasive nature of the Australian silver wattle Acacia dealbata Link in Europe, it is important to find alternatives for its sustainable use. However, optimization of vermicomposting needs further comprehension of the fundamental microbial processes. Here, we characterized bacterial succession during the vermicomposting of silver wattle during 56 days using the earthworm species Eisenia andrei. We observed significant differences in α- and β-diversity between fresh silver wattle (day 0) and days 14 and 28, while the bacterial community seemed more stable between days 28 and 56. Accordingly, during the first 28 days, a higher number of taxa experienced significant changes in relative abundance. A microbiome core composed of 10 amplicon sequence variants was identified during the vermicomposting of silver wattle (days 14 to 56). Finally, predicted functional profiles of genes involved in cellulose metabolism, nitrification, and salicylic acid also changed significantly during vermicomposting. This study, hence, provides detailed insights of the bacterial succession occurring during vermicomposting of the silver wattle and the characteristics of its final product as a sustainable plant biofertilizer.

Consumption of probiotic bacteria can result in a transient colonization of the human gut and thereby in potential interactions with the commensal microbiota. In this study, we used novel PolyFermS continuous fermentation models to investigate interactions of the candidate probiotic strain Lactobacillus paracasei CNCM I-1518 (L. paracasei) with colonic microbiota from healthy elderly subjects using 16S rRNA gene amplicon sequencing and metatranscriptomics, or with microbiota in vitro-colonized with Clostridioides difficile (C. difficile NCTC 13307 and C. difficile DSM 1296)—an enteropathogen prevalent in the elderly population. Small changes in microbiota composition were detected upon daily addition of L. paracasei, including increased abundances of closely related genera Lactobacillus and Enterococcus, and of the butyrate producer Faecalibacterium. Microbiota gene expression was also modulated by L. paracasei with distinct response of the Faecalibacterium transcriptome and an increase in carbohydrate utilization. However, no inhibitory effect of L. paracasei was observed on C. difficile colonization in the intestinal models under the tested conditions. Our data suggest that, in the in vitro experimental conditions tested and independent of the host, L. paracasei has modulatory effects on both the composition and function of elderly gut microbiota without affecting C. difficile growth and toxin production.

The genus Treponema contains a number of human and animal pathogenic as well as symbiotic bacteria that are found in vastly different anatomical and environmental habitats. Our understanding of the species range, evolution, and biology of these important bacteria is still limited. To explore the diversity of treponemes, we established, validated, and tested a novel metataxonomic approach. As the informative nature of the hypervariable regions of the 16S rRNA gene differ, we first analyzed each variable region independently. Considering the in silico results obtained, we established and validated the sequencing of the V4-region of the 16S rRNA gene using known mixtures of Treponema species as well as a selected number of clinical samples. The metataxonomic approach was able to identify Treponema to a near-species level. We demonstrate that using a spirochete-specific enrichment, our method is applicable to complex microbial communities and large variety of biological samples. The metataxonomic approach described provides a useful method to unravel the full diversity and range of Treponema in various ecosystems.

Metataxonomic analysis represents a fast and cost-effective approach for acquiring informative insight into the composition of the microbiome of samples with variable diversity, such as wine samples. Nevertheless, it comprises a vast amount of laboratory procedures and bioinformatic frameworks each one associated with an inherent variability of protocols and algorithms, respectively. As a solution to the bioinformatic maze, QIIME bioinformatic framework has incorporated benchmarked, and balanced parameters as default parameters. In the current study, metataxonomic analysis of two types of mock community standards with the same microbial composition has been performed for evaluating the effectivess of QIIME balanced default parameters on a variety of aspects related to different laboratory and bioinformatic workflows. These aspects concern NGS platforms, PCR protocols, bioinformatic pipelines, and taxonomic classification algorithms. Several qualitative performance expectations have been the outcome of the analysis, rendering the mock community a useful evaluation tool.

Marine sponges commonly host a repertoire of bacterial-associated organisms, which significantly contribute to their health and survival by producing several anti-predatory molecules. Many of these compounds are produced by sponge-associated bacteria and represent an incredible source of novel bioactive metabolites with biotechnological relevance. Although most investigations are focused on tropical and temperate species, to date, few studies have described the composition of microbiota hosted by Antarctic sponges and the secondary metabolites that they produce. The investigation was conducted on four sponges collected from two different sites in the framework of the XXXIV Italian National Antarctic Research Program (PNRA) in November–December 2018. Collected species were characterized as Mycale (Oxymycale) acerata, Haliclona (Rhizoniera) dancoi, Hemigellius pilosus and Microxina sarai by morphological analysis of spicules and amplification of four molecular markers. Metataxonomic analysis of these four Antarctic sponges revealed a considerable abundance of Amplicon Sequence Variants (ASVs) belonging to the phyla Proteobacteria, Bacteroidetes, Actinobacteria and Verrucomicrobia. In particular, M. (Oxymycale) acerata, displayed several genera of great interest, such as Endozoicomonas, Rubritalea, Ulvibacter, Fulvivirga and Colwellia. On the other hand, the sponges H. pilosus and H. (Rhizoniera) dancoi hosted bacteria belonging to the genera Pseudhongella, Roseobacter and Bdellovibrio, whereas M. sarai was the sole species showing some strains affiliated to the genus Polaribacter. Considering that most of the bacteria identified in the present study are known to produce valuable secondary metabolites, the four Antarctic sponges could be proposed as potential tools for the discovery of novel pharmacologically active compounds.

This study focused on the potential relationships between midgut microbiota of the common cockchafer Melolontha melolontha larvae and their resistance to entomopathogenic nematodes (EPN) infection. We investigated the bacterial community associated with control and unsusceptible EPN-exposed insects through nanopore sequencing of the 16S rRNA gene. Firmicutes, Proteobacteria, Actinobacteria, and Bacteroidetes were the most abundant bacterial phyla within the complex and variable midgut microbiota of the wild M. melolontha larvae. The core microbiota was found to include 82 genera, which accounted for 3.4% of the total number of identified genera. The EPN-resistant larvae differed significantly from the control ones in the abundance of many genera belonging to the Actinomycetales, Rhizobiales, and Clostridiales orders. Additionally, the analysis of the microbiome networks revealed different sets of keystone midgut bacterial genera between these two groups of insects, indicating differences in the mutual interactions between bacteria. Finally, we detected Xenorhabdus and Photorhabdus as gut residents and various bacterial species exhibiting antagonistic activity against these entomopathogens. This study paves the way to further research aimed at unravelling the role of the host gut microbiota on the output of EPN infection, which may contribute to enhancement of the efficiency of nematodes used in eco-friendly pest management.

The Old World vulture may carry and spread pathogens for emerging infections since they feed on the carcasses of dead animals and participate in the sky burials of humans, some of whom have died from communicable diseases. Therefore, we studied the precise fecal microbiome of the Old World vulture with metataxonomics, integrating the high-throughput sequencing of almost full-length small subunit ribosomal RNA (16S rRNA) gene amplicons in tandem with the operational phylogenetic unit (OPU) analysis strategy. Nine vultures of three species were sampled using rectal swabs on the Qinghai-Tibet Plateau, China. Using the Pacific Biosciences sequencing platform, we obtained 54 135 high-quality reads of 16S rRNA amplicons with an average of 1442±6.9 bp in length and 6015±1058 reads per vulture. Those sequences were classified into 314 OPUs, including 102 known species, 50 yet to be described species and 161 unknown new lineages of uncultured representatives. Forty-five species have been reported to be responsible for human outbreaks or infections, and 23 yet to be described species belong to genera that include pathogenic species. Only six species were common to all vultures. Clostridium perfringens was the most abundant and present in all vultures, accounting for 30.8% of the total reads. Therefore, using the new technology, we found that vultures are an important reservoir for C. perfringens as evidenced by the isolation of 107 strains encoding for virulence genes, representing 45 sequence types. Our study suggests that the soil-related C. perfringens and other pathogens could have a reservoir in vultures and other animals.Emerging Microbes & Infections (2017) 6, e9; doi:10.1038/emi.2016.137; published online 22 February 2017

Characterization of microbial communities via next-generation sequencing (NGS) requires an extraction ofmicrobial DNA. Methodological differences in DNA extraction protocols may bias results and complicate inter-study comparisons. Here we compare the effect of two commonly used commercial kits (Norgen and Qiagen)for the extraction of total DNA on estimatingnasopharyngeal microbiome diversity. The nasopharynxis a reservoir for pathogens associated with respiratory illnesses and a key player in understandingairway microbial dynamics. Total DNA from nasal washes corresponding to 30 asthmatic children was extracted using theQiagenQIAamp DNA and NorgenRNA/DNA Purification kits and analyzed via IlluminaMiSeq16S rRNA V4 ampliconsequencing. The Norgen samples included more sequence reads and OTUs per sample than the Qiagen samples, but OTU counts per sample varied proportionallybetween groups (r = 0.732).Microbial profiles varied slightly between sample pairs, but alpha- and beta-diversity indices (PCoAand clustering) showed highsimilarity between Norgen and Qiagenmicrobiomes. Moreover, no significant differences in community structure (PERMANOVA and adonis tests) and taxa proportions (Kruskal-Wallis test) were observed betweenkits. Finally, aProcrustes analysis also showed low dissimilarity (M2 = 0.173; P< 0.001) between the PCoAs of the two DNA extraction kits. Contrary to what has been observed in previous studies comparing DNA extraction methods, our 16S NGS analysis of nasopharyngeal washes did not reveal significant differences in community composition or structure between kits. Our findingssuggest congruence between column-based chromatography kits and supportthe comparison of microbiomeprofilesacross nasopharyngeal metataxonomic studies.

Campylobacter is the most frequent foodborne zoonotic bacteria worldwide, with chicken meat being overwhelmingly the most important reservoir for human infections. Control measures implemented at the farm level (i.e., biosecurity or vaccination), which have been successfully applied to limit other pathogens, such as Salmonella, have not been effective in reducing Campylobacter occurrence. Thus, new approaches are needed to fully understand the ecological interactions of Campylobacter with host animals to effectively comprehend its epidemiology. The objective of this study was to analyse longitudinally the gut microbiota composition of Campylobacter-infected and non-infected farms to identify any difference that could potentially be indicative of gut colonization by Campylobacter spp. Differences in the colonization rate and timing were observed at the farms that became positive for Campylobacter jejuni over the investigated time points, even though in positive tests, the occurrence of Campylobacter jejuni gut colonization was not observed before the second week of the life of the birds. Significant differences were observed in the abundances of specific bacterial taxa between the microbiota of individuals belonging to farms that became Campylobacter positive during the study and those who remained negative with particular reference to Bacteroidales and Clostridiales, respectively. Moreover, Campylobacter colonization dramatically influenced the microbiota richness, although to a different extent depending on the infection timing. Finally, a key role of Faecalibacterium and Lactobacillus genera on the Campylobacter microbial network was observed. Understanding the ecology of the Campylobacter interaction with host microbiota during infection could support novel approaches for broiler microbial barrier restoration. Therefore, evidence obtained through this study can be used to identify options to reduce the incidence of infection at a primary production level based on the targeted influence of the intestinal microbiota, thus helping develop new control strategies in order to mitigate the risk of human exposure to Campylobacter by chicken meat consumption.

The metataxonomic approach combining 16S rRNA gene amplicon sequencing using the PacBio Technology with the application of the operational phylogenetic unit (OPU) approach, has been used to analyze the fecal microbial composition of the high-altitude and herbivorous Tibetan antelopes. The fecal samples of the antelope were collected in Hoh Xil National Nature Reserve, at an altitude over 4500 m, the largest depopulated zone in Qinghai-Tibetan Plateau, China, where non-native animals or humans may experience life-threatening acute mountain sickness. In total, 104 antelope fecal samples were enrolled in this study, and were clustered into 61,258 operational taxonomic units (OTUs) at an identity of 98.7% and affiliated with 757 OPUs, including 144 known species, 256 potentially new species, 103 potentially higher taxa within known lineages. In addition, 254 comprised sequences not affiliating with any known family, and the closest relatives were unclassified lineages of existing orders or classes. A total of 42 out of 757 OPUs conformed to the core fecal microbiome, of which four major lineages, namely, un-cultured Ruminococcaceae, Lachnospiraceae, Akkermansia, and Christensenellaceae were associated with human health or longevity. The current study reveals that the fecal core microbiome of antelope is mainly composited of uncultured bacteria. The most abundant core taxa, namely, uncultured Ruminococcaceae, uncultured Akkermansia, uncultured Bacteroides, uncultured Christensenellaceae, uncultured Mollicutes, and uncultured Lachnospiraceae, may represent new bacterial candidates at high taxa levels, and several may have beneficial roles in health promotion or anti-intestinal dysbiosis. These organisms should be further isolated and evaluated for potential effect on human health and longevity.

Recent advances in Next-Generation Sequencing (NGS) make comparative analyses of the composition and diversity of whole microbial communities possible at a far greater depth than ever before. This brings new challenges, such as an increased dependence on computation to process these huge datasets. The demand on system resources usually requires migrating from Windows to Linux-based operating systems and prior familiarity with command-line interfaces. To overcome this barrier, we developed a fully automated and easy-to-install package as well as a complete, easy-to-follow pipeline for microbial metataxonomic analysis operating in the Windows Subsystem for Linux (WSL)—Bioinformatics Through Windows (BTW). BTW combines several open-access tools for processing marker gene data, including 16S rRNA, bringing the user from raw sequencing reads to diversity-related conclusions. It includes data quality filtering, clustering, taxonomic assignment and further statistical analyses, directly in WSL, avoiding the prior need of migrating from Windows to Linux. BTW is expected to boost the use of NGS amplicon data by facilitating rapid access to a set of bioinformatics tools for Windows users. Moreover, several Linux command line tools became more reachable, which will enhance bioinformatics accessibility to a wider range of researchers and practitioners in the life sciences and medicine. BTW is available in GitHub (https://github.com/vpylro/BTW). The package is freely available for noncommercial users.

Bile acids, the products of concerted host and gut bacterial metabolism, have important signaling functions within the mammalian metabolic system and a key role in digestion. Given the complexity of the mega-variate bacterial community residing in the gastrointestinal tract, studying associations between individual bacterial genera and bile acid processing remains a challenge. Here, we present a novel in vitro approach to determine the bacterial genera associated with the metabolism of different primary bile acids and their potential to contribute to inter-individual variation in this processing. Anaerobic, pH-controlled batch cultures were inoculated with human fecal microbiota and treated with individual conjugated primary bile acids (500 μg/ml) to serve as the sole substrate for 24 h. Samples were collected throughout the experiment (0, 5, 10, and 24 h) and the bacterial composition was determined by 16S rRNA gene sequencing and the bile acid signatures were characterized using a targeted ultra-performance liquid chromatography-mass spectrometry (UPLC-MS) approach. Data fusion techniques were used to identify statistical bacterial-metabolic linkages. An increase in gut bacteria associated bile acids was observed over 24 h with variation in the rate of bile acid metabolism across the volunteers (n = 7). Correlation analysis identified a significant association between the Gemmiger genus and the deconjugation of glycine conjugated bile acids while the deconjugation of taurocholic acid was associated with bacteria from the Eubacterium and Ruminococcus genera. A positive correlation between Dorea and deoxycholic acid production suggest a potential role for this genus in cholic acid dehydroxylation. A slower deconjugation of taurocholic acid was observed in individuals with a greater abundance of Parasutterella and Akkermansia. This work demonstrates the utility of integrating compositional (metataxonomics) and functional (metabonomics) systems biology approaches, coupled to in vitro model systems, to study the biochemical capabilities of bacteria within complex ecosystems. Characterizing the dynamic interactions between the gut microbiota and the bile acid pool enables a greater understanding of how variation in the gut microbiota influences host bile acid signatures, their associated functions and their implications for health.

Soil microbial communities’ assembly is strongly tied to changes in temperature and moisture. Although microbial functional redundancy seems to overcome taxonomical composition changes, the sensitivity and resilience of soil microbial communities from subtropical regions in response to seasonal variations are still poorly understood. Thus, the development of new strategies for biodiversity conservation and sustainable management require a complete understanding of the soil abiotic process involved in the selection of microbial taxa and functions. In this work, we used state of the art molecular methodologies (Next Generation Sequencing) to compare the taxonomic (metataxonomics) and functional (metatranscriptomics) profiles among soil samples from two subtropical natural grasslands located in the Pampa biome, Brazil, in response to short-term seasonal variations. Our data suggest that grasslands maintained a stable microbial community membership along the year with oscillation in abundance. Apparently soil microbial taxa are more susceptible to natural climatic disturbances while functions are more stable and change with less intensity along the year. Finally, our data allow us to conclude that the most abundant microbial groups and functions were shared between seasons and locations reflecting the existence of a stable taxonomical and functional core microbiota.

Diagnoses that are both timely and accurate are critically important for patients with life-threatening or drug resistant infections. Technological improvements in High-Throughput Sequencing (HTS) have led to its use in pathogen detection and its application in clinical diagnoses of infectious diseases. The present study compares two HTS methods, 16S rRNA marker gene sequencing (metataxonomics) and whole metagenomic shotgun sequencing (metagenomics), in their respective abilities to match the same diagnosis as traditional culture methods (culture inference) for patients with ventilator associated pneumonia (VAP). The metagenomic analysis was able to produce the same diagnosis as culture methods at the species-level for five of the six samples, while the metataxonomic analysis was only able to produce results with the same species-level identification as culture for two of the six samples. These results indicate that metagenomic analyses have the accuracy needed for a clinical diagnostic tool, but full integration in diagnostic protocols is contingent on technological improvements to decrease turnaround time and lower costs.