Search

The incorporation of physical environmental performance as a primary consideration in building design can facilitate the harmonization of the built environment with the surrounding site and climate, enhance the building's environmental adaptability and environmental friendliness, and contribute to the achievement of energy-saving and emission-reduction objectives through the integration of natural lighting and ventilation. General computational fluid dynamics (CFD) can help architects make accurate predictions and effectively control the building's wind environment. However, CFD integration into the design workflow in the preliminary stages is frequently challenging due to program uncertainty, intricate parameter settings, and substantial computational expenses. This study offers a methodology and framework based on machine learning to overcome the complexity and computational cost barriers in simulating outdoor wind environments of buildings. In this framework, the machine learning model is trained using an automated CFD simulation system based on Butterfly and implemented within the Rhino and Grasshopper environment. This framework provides real-time simulation feedback within the design software and exhibits promising accuracy, with a Structural Similarity Index Measure (SSIM) ranging from 90–97% on a training dataset of 1200 unique urban geometries in Xinjiekou Area of Nanjing, China. Furthermore, we programmatically integrate various parts of the simulation and computation process to automate multiscenario CFD simulations and computations. This automation saves a significant amount of time in producing machine-learning training sets. Finally, we demonstrate the effectiveness and accuracy of the proposed working framework in the design process through a case study. Although our approach cannot replace CFD simulation computation in the later design stages, it can support architects in making design decisions in the preliminary stages with minimal effort and immediate performance feedback. [ABSTRACT FROM AUTHOR]

Based on five periods of Landsat remote sensing data from 1980 to 2020, this study constructs a landscape ecological risk-ecosystem service value evaluation model and integrates it with a geodetector model to analyse the environmental benefits of the development of the "production–living–ecological space" pattern and its driving factors in the Xuzhou planning area. The results of the study are as follows: (1) Over the past 40 years, the expansion of living spaces has significantly encroached upon adjacent agricultural production areas and ecological spaces, such as forests and grasslands. Specifically, the areas of agricultural land, forests, and grassland have been diminished by 277.39 km2, 23.8 km2 and 12.93 km2, respectively; in contrast, urban and rural living spaces have increased by 238.62 km2 and 58.92 km2, alongside a rise in industrial production areas, water bodies, and other ecological spaces. (2) Throughout the 40-year period, both the landscape ecological risk (ERI) and ecosystem service value (ESV) in the study area have shown a decreasing trend. The proportion of high- and medium-high-risk areas of the ERI have decreased by 5.19% and 7.50%, respectively, while low, lower, and medium ecological risk areas have increased by 6.40%, 3.22% and 3.07%, respectively. In addition, low-ESV areas have increased by 14.22%, while the proportion of high- and medium-high-ESV areas have decreased by 1.16%. (3) There is a significant positive spatial correlation between the ERI and ESV. Regions with dense ecological spaces comprising forests, water bodies, and grasslands, particularly in the northeastern part of the Jiawang District and the southeastern part of the Tongshan District, demonstrate superior regional ecosystem service quality. The ERI and ESV are dominated by "high–high" and "low–high" aggregation. Conversely, in the southwestern part of the study area, the expansion of living space has led to the transformation of some agricultural land, forest land, and grassland into less risky construction land, resulting in a decline in the quality of regional ecosystem services. The local spatial correlation between the ERI and ESV changed from "high–high", "low–low", "low–high" agglomeration to "low–low" agglomeration. (4) Key factors influencing the spatial differentiation of the "production–living–ecological space" include the GDP, population density, soil type, and the distance to towns and roads. Among these, the interaction between population density and soil type has the most significant effect on the changes in the pattern of the "production–living–ecological space". [ABSTRACT FROM AUTHOR]

Long-term spaceflight is known to induce disruptions in circadian rhythms, which are driven by a central pacemaker located in the suprachiasmatic nucleus (SCN) of the hypothalamus, but the underlying molecular mechanisms remain unclear. Here, we developed a rat model that simulated microgravity and isolation environments through tail suspension and isolation (TSI). We found that the TSI environment imposed circadian disruptions to the core body temperature, heart rate, and locomotor-activity rhythms of rats, especially in the amplitude of these rhythms. In TSI model rats' SCNs, the core circadian gene NR1D1 showed higher protein but not mRNA levels along with decreased BMAL1 levels, which indicated that NR1D1 could be regulated through post-translational regulation. The autophagosome marker LC3 could directly bind to NR1D1 via the LC3-interacting region (LIR) motifs and induce the degradation of NR1D1 in a mitophagy-dependent manner. Defects in mitophagy led to the reversal of NR1D1 degradation, thereby suppressing the expression of BMAL1. Mitophagy deficiency and subsequent mitochondrial dysfunction were observed in the SCN of TSI models. Urolithin A (UA), a mitophagy activator, demonstrated an ability to enhance the amplitude of core body temperature, heart rate, and locomotor-activity rhythms by prompting mitophagy induction to degrade NR1D1. Cumulatively, our results demonstrate that mitophagy exerts circadian control by regulating NR1D1 degradation, revealing mitophagy as a potential target for long-term spaceflight as well as diseases with SCN circadian disruption. [ABSTRACT FROM AUTHOR]

In building massing design, using passive design strategies is a critical approach to reducing energy consumption while offering comfortable indoor environments. However, it is often impractical for architects to systematically explore passive design strategies at the outset of the building massing design and architectural form-finding processes, which may result in inefficient or ineffective utilization of the strategies. To address this issue, this study presents a reverse passive design strategy exploration approach that leverages the capability of computational optimization and parametric modeling to help architects identify feasible passive design strategies for building massing design. The approach is achieved using a building massing design generation and optimization tool, called EvoMass, and various building performance simulation tools in Rhino-Grasshopper. The optimization can produce site-specific design references that reflect rich performance implications associated with passive design strategies, such as atriums and self-shading. As such, architects can screen out promising passive design strategies corresponding to different performance factors from the optimization result. Two case studies related to daylighting, sky exposure, and solar heat utility are presented to demonstrate the approach, and the relevant utility and limitations are discussed. [ABSTRACT FROM AUTHOR]

A large number of aerospace practices have confirmed that the aerospace microgravity environment can lead to cognitive function decline. Mitochondria are the most important energy metabolism organelles, and some studies demonstrate that the areospace microgravity environment can cause mitochondrial dysfunction. However, the relationships between cognitive function decline and mitochondrial dysfunction in the microgravity environment have not been elucidated. In this study, we simulated the microgravity environment in the Sprague-Dawley (SD) rats by -30° tail suspension for 28 days. We then investigated the changes of mitochondrial morphology and proteomics in the hippocampus. The electron microscopy results showed that the 28-day tail suspension increased the mitochondria number and size of rat hippocampal neuronal soma. Using TMT-based proteomics analysis, we identified 163 differentially expressed proteins (DEPs) between tail suspension and control samples, and among them, 128 proteins were upregulated and 35 proteins were downregulated. Functional and network analyses of the DEPs indicated that several of mitochondrial metabolic processes including the tricarboxylic acid (TCA) cycle were altered by simulating microgravity (SM). We verified 3 upregulated proteins, aconitate hydratase (ACO2), dihydrolipoamide S-succinyltransferase (DLST), and citrate synthase (CS), in the TCA cycle process by western blotting and confirmed their differential expressions between tail suspension and control samples. Taken together, our results demonstrate that 28-day tail suspension can cause changes in the morphology and metabolic function of hippocampus mitochondria, which might represent a mechanism of cognitive disorder caused by aerospace microgravity. [ABSTRACT FROM AUTHOR]

Gene amplification chiefly manifests as homogeneously stained regions (HSRs) or double minutes (DMs) in cytogenetically and extrachromosomal DNA (ecDNA) in molecular genetics. Evidence suggests that gene amplification is becoming a hotspot for cancer research, which may be a new treatment strategy for cancer. DMs usually carry oncogenes or chemoresistant genes that are associated with cancer progression, occurrence and prognosis. Defining the molecular structure of DMs will facilitate understanding of the molecular mechanism of tumorigenesis. In this study, we re‐identified the origin and integral sequence of DMs in human colorectal adenocarcinoma cell line NCI‐H716 by genetic mapping and sequencing strategy, employing high‐resolution array‐based comparative genomic hybridization, high‐throughput sequencing, multiplex‐fluorescence in situ hybridization and chromosome walking techniques. We identified two distinct populations of DMs in NCI‐H716, confirming their heterogeneity in cancer cells, and managed to construct their molecular structure, which were not investigated before. Research evidence of amplicons distribution in two different populations of DMs suggested that a multi‐step evolutionary model could fit the module of DM genesis better in NCI‐H716 cell line. In conclusion, our data implicated that DMs play a very important role in cancer progression and further investigation is necessary to uncover the role of the DMs. [ABSTRACT FROM AUTHOR]

Significant research has been undertaken focusing on the application of evolutionary algorithms for design exploration at conceptual design stages. However, standard evolutionary algorithms are typically not well-suited to supporting such optimization-based design exploration due to the lack of design diversity in the optimization result and the poor search efficiency in discovering high-performing design solutions. In order to address the two weaknesses, this paper proposes a hybrid evolutionary algorithm, called steady-stage island evolutionary algorithm (SSIEA). The implementation of SSIEA integrates an island model approach and a steady-state replacement strategy with an evolutionary algorithm. The combination aims to produce optimization results with rich design diversity while achieving significant fitness progress in a reasonable amount of time. Moreover, the use of the island model approach allows for an implicit clustering of the design population during the optimization process, which helps architects explore different alternative design directions. The performance of SSIEA is compared against other optimization algorithms using two case studies. The result shows that, in contrast to the other algorithms, SSIEA is capable of achieving a good compromise between design diversity and search efficiency. The case studies also demonstrate how SSIEA can support conceptual design exploration. For architects, the optimization results with diverse and high-performing solutions stimulate richer reflection and ideation, rendering SSIEA a helpful tool for conceptual design exploration. [ABSTRACT FROM AUTHOR]

Background: Polycystic kidney disease (PKD) is an inherited disease that is life‐threatening. Multiple cysts are present in the bilateral kidneys of PKD patients. The progressively enlarged cysts cause structural damage and loss of kidney function. Methods: This study examined and analyzed 12 families with polycystic kidney disease. Whole exome sequencing (WES) or whole genome sequencing (WGS) of the probands was performed to detect the pathogenic genes. The candidate gene segments for lineal consanguinity in the family were amplified by the nest PCR followed by Sanger sequencing. The variants were assessed by pathogenic and conservational property prediction analysis and interpreted according to the American College of Medical Genetics and Genomics. Results: Nine of the 12 pedigrees were identified the disease causing variants. Among them, four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) were detected. After assessment, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The detected variants were interpreted. Conclusion: The four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) are pathogenic variants and cause autosomal dominant polycystic kidney disease in family. [ABSTRACT FROM AUTHOR]

Sleep loss is one of large challenges during space missions. A variety of sleep problems have been shown in space. We aimed to further characterize more representative and consecutive sleep-wake patterns and to investigate sleep-wake cycle on heart rate during short duration spaceflight mission. Here, we evaluated sleep quality using Pittsburgh Sleep Quality Index, analyzed sleep time, sleep efficiency, and periods of sleep-wake rhythm via the activity data from Actiwatch, and evaluated heart rate data via the Actiheart in three crew members before, during and after a 15-day spaceflight. The study showed that the sleep quality before and during the flight were lower than that after the space flight. Crew members slept less during spaceflight relative to on Earth. The mean sleep duration during spaceflight was 6.5 ± 1.3 h, but after flight, it was 7.2 ± 1.2 h, and the sleep efficiency was significantly higher during the flight than that on Earth. The periods of sleep-wake rhythm could keep at 23.92 h during flight mission. Moreover, the heart rate decreased during spaceflight and it was more obvious during wakeful state than during sleep. These data could help us better understand the effects of short-duration spaceflight on sleep pattern. [ABSTRACT FROM AUTHOR]

Physiological changes in humans are evident under environmental conditions similar to those on a Mars mission involving both a space factor (long-term isolation) and a time factor (the Mars solar day). However, very few studies have investigated the response of the liver to those conditions. Serum protein levels, bilirubin levels, aminotransferase activities, blood alkaline phosphatase, gamma-glutamyltransferase, lipid levels, and serum cytokines interleukin-6 and interferon-γ levels were analyzed 30 days before the mock mission; on days 2, 30, 60, 75, 90, 105, 120, 150, and 175 of the mission; and 30 days after the mission, in four subjects in 4-person 180-day Controlled Ecological Life Support System Experiment. Serum protein levels (total protein and globulin) decreased and bilirubin increased under the isolation environment from day 2 and exhibited chronic acclimatization from days 30 to 175. Effects of the Mars solar day were evident on day 75. Blood lipid levels were somewhat affected. No obvious peak in any enzyme level was detected during the mission. The change tendency of these results indicated that future studies should explore whether protein parameters especially globulin could serve as indicators of immunological function exposure to the stress of a Mars mission. [ABSTRACT FROM AUTHOR]

Background: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. Methods: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Results: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Conclusion: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1. [ABSTRACT FROM AUTHOR]

Polycystic kidney disease (PKD) is a life-threatening inherited disease with a morbidity of 1:500–1,000 worldwide. Numerous progressively enlarging cysts are observed in the bilateral kidneys of patients with PKD, inducing structural damage and loss of kidney function. The present study analyzed one family with PKD. Whole exome sequencing of the proband was performed to detect the pathogenic gene present in the family. Candidate gene segments for lineal consanguinity in the family were amplified by nest polymerase chain reaction, followed by Sanger sequencing. One novel duplication variant (NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX) and one missense mutation (c.G9022A:p.V3008M) were detected in PKD1. Additionally, the pathogenic substitutions in PKD1 published from the dataset were analyzed. Following analysis and confirmation, the duplication variant NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX in PKD1, within the polycystin-1, lipoxygenase, α-toxin domain, was considered to be the pathogenic factor in the examined family with autosomal dominant PKD. Additionally, based on the analysis of 4,805 pathogenic substitutions in PKD1 within various regions, the presence of the missense mutation in the N-terminal domain of polycystin-1 may present high pathogenicity in ADPKD. [ABSTRACT FROM AUTHOR]

The present study aimed to determine how the learning and memory gradually change with the prolonged hindlimb unloading (HU) treatment in rats. Different HU durations (7 d, 14 d, 21 d, and 28 d) in Sprague-Dawley (SD) rats were implemented. Cognitive function was assessed using the Morris water maze (MWM) and the shuttle box test. Additionally, parameters about cholinergic activity and oxidative stress were tested. Results showed that longer-than-14 d HU led to the inferior performances in the behavioral tasks. Besides, acetylcholine esterase (AChE) activity, malondialdehyde (MDA) level in brain, reactive oxygen species (ROS), and 8-hydroxy-2-deoxyguanosine (8-OHdG) concentrations of HU rats were significantly increased. Furthermore, choline acetyltransferase (ChAT), superoxide dismutase (SOD), and catalase (CAT) activity in brain were notably attenuated. Most of these effects were more pronounced after longer exposure (21 d and 28 d) to HU, although some indicators had their own characteristics of change. These results indicate that cholinergic dysfunction and oxidative damage were involved in the learning and memory impairments induced by longer-than-14 d HU. Moreover, the negative effects of HU tend to be augmented as the HU duration becomes longer. The results may be helpful to present possible biochemical targets for countermeasures development regarding the memory deficits under extreme environmental conditions. [ABSTRACT FROM AUTHOR]

Objective: To investigate the expression of memory-related antioxidant genes and miRNAs under simulated weightlessness and the regulation of mechano growth factor (MGF) E domain, the peptide preventing nerve damage. Results: Igf- iea and mgf mRNA levels, expression of antioxidant genes sod1 and sod2 and levels of miR-134 and miR-125b-3p increased in rat hippocampus after 14 days tail suspension to simulate weightlessness which was inhibited with intramuscular injection of E domain peptide. Therefore, administration of MGF E domain peptide could reverse increased expressions of memory-related igf- iea, mgf, sod1, sod2, miR-134 and miR-125b-3p in rat hippocampus under simulated weightlessness. Conclusions: MGF may regulate the redox state and miRNA-targeted NR-CREB signaling, and intramuscular injection may be the alternative administration because of its safety, convenience and ability to pass through the blood brain barrier. [ABSTRACT FROM AUTHOR]

To address the incomplete problem in pulmonary parenchyma segmentation based on the traditional methods, a novel automated segmentation method based on an eight-neighbor region growing algorithm with left-right scanning and four-corner rotating and scanning is proposed in this paper. The proposed method consists of four main stages: image binarization, rough segmentation of lung, image denoising and lung contour refining. First, the binarization of images is done and the regions of interest are extracted. After that, the rough segmentation of lung is performed through a general region growing method. Then the improved eight-neighbor region growing is used to remove noise for the upper, middle, and bottom region of lung. Finally, corrosion and expansion operations are utilized to smooth the lung boundary. The proposed method was validated on chest positron emission tomography-computed tomography (PET-CT) data of 30 cases from a hospital in Shanxi, China. Experimental results show that our method can achieve an average volume overlap ratio of 96.21 ± 0.39% with the manual segmentation results. Compared with the existing methods, the proposed algorithm segments the lung in PET-CT images more efficiently and accurately. [ABSTRACT FROM AUTHOR]

Background: Integrated 18F-fluorodeoxyglucose positron emission tomography/computed tomography (18F-FDG PET/CT) is widely performed for staging solitary pulmonary nodules (SPNs). However, the diagnostic efficacy of SPNs based on PET/CT is not optimal. Here, we propose a method of detection based on PET/CT that can differentiate malignant and benign SPNs with few false-positives. Method: Our proposed method combines the features of positron-emission tomography (PET) and computed tomography (CT). A dynamic threshold segmentation method was used to identify lung parenchyma in CT images and suspicious areas in PET images. Then, an improved watershed method was used to mark suspicious areas on the CT image. Next, the support vector machine (SVM) method was used to classify SPNs based on textural features of CT images and metabolic features of PET images to validate the proposed method. Results: Our proposed method was more efficient than traditional methods and methods based on the CT or PET features alone (sensitivity 95.6%; average of 2.9 false positives per scan). [ABSTRACT FROM AUTHOR]

SOD2 (superoxide dismutase 2) is one of the endogenous antioxidant enzymes that protect against reactive oxygen species. While explorations of SOD2 expression regulation are mainly focused on transcriptional and post-translational activation, there are few reports about the post-transcriptional regulation of SOD2. MicroRNAs (miRNAs) are 21nt-25nt (nucleotide) small noncoding RNAs that have emerged as indispensable regulators of gene expression. Here we show that miR-146a, a widely expressed miRNA, is up-regulated by H2O2-induced stress. By sequence analysis we found a binding site for miR-146a in the sod2 mRNA 3′UTR, and a luciferase reporter assay confirmed that miR-146a can interact with this sod2 regulatory region. Our results further show that miR-146a could down-regulate the SOD2 protein expression, and antisense-miR-146a could reverse the decrease of both the SOD2 level and cell viability in H2O2 treated PC12 cells. In conclusion, here we have identified a novel function of miR-146a in the post-transcriptional regulation of SOD2 expression. [ABSTRACT FROM AUTHOR]

Human non-small cell lung cancer (NSCLC) is one of the most common malignancies in the modern world. Its recurrence is mainly due to its ability to invade and metastasize. However, the precise mechanism for tumor development and metastasis is still not fully understood. To shed light on the development of lung cancer, the human giant cell lung carcinoma cell lines 95D with high metastatic potential and 95C with low metastatic potential were selected in this study. The 2 cell lines originated from the same parental cell and share a similar genetic background. In the current study, we identified 3 differentially expressed proteins in 95C and 95D cell lines, namely, PAI-RBP1, C1orf142, and COTL1, by using 2-dimensional electrophoresis proteomics analysis. We found that PAI-RBP1 and C1orf142 expression levels were higher in 95D than in 95C cells, whereas COTL1 expression level was lower in 95D when compared to 95C cells. We also confirmed these results by reverse transcription-polymerase chain reaction and immunoblotting analyses. The messenger RNA and protein levels of PAI-RBP1 and C1orf142 were much higher in 95D than in 95C cells, and COTL1 expression level was lower in 95D than in 95C cells. The PAI-RBP1 expression was assessed by immunohistochemistry in 70 NSCLC and 7 normal lung tissue samples from patients. PAI-RBP1 expression level was higher in tumor tissues (positive staining in 87.1% of cases [61/70]) than in normal tissues (positive staining in 14.3% of cases [1/7]). In conclusion, by studying protein expression in NSCLC cell lines with high and low metastasis as well as in human lung cancer tissues, we have identified 3 proteins, namely, PAI-RBP1, C1orf142, and COTL1, which were differentially expressed in NSCLC cell lines with different metastatic potential. In addition, we also found that PAI-RBP1 might contribute to NSCLC development. [ABSTRACT FROM AUTHOR]

For sustainable building design, performance-based optimization incorporating parametric modelling and evolutionary optimization can allow architects to leverage building massing design to improve energy performance. However, two key challenges make such applications of performance-based optimization difficult in practice. First, due to the parametric modelling approaches, the topological variability in the building massing variants is often very limited. This, in turn, limits the scope for the optimization process to discover high-performing solutions. Second, for architects, the process of creating parametric models capable of generating the necessary topological variability is complex and time-consuming, thereby significantly disrupting the design processes. To address these two challenges, this paper presents a parametric massing algorithm based on the subtractive form generation principle. The algorithm can generate diverse building massings with significant topological variability by removing different parts from a predefined volume. Additionally, the algorithm can be applied to different building massing design scenarios without additional parametric modelling being required. Hence, using the algorithm can help architects achieve an explorative performance-based optimization for building massing design while streamlining the overall design process. Two case studies of daylighting performance optimizations are presented, which demonstrate that the algorithm can enhance the exploration of the potential in building massing design for energy performance improvements. [ABSTRACT FROM AUTHOR]