Search

This study explored the influence of living settings on physical activity (PA) levels and volition in exercise and their correlation, considering sex differences. Five hundred and sixty-six university students (261 rural and 305 urban) from Calabria region (Italy) attending universities courses filled an online survey where Global Physical Activity Questionnaire and Volition in Exercise Questionnaire were administered. Rural females (RF) showed lower PA levels and self-confidence than rural males (RM) (p<0.01). Postponing training and unrelated thoughts were higher in RF than RM (p<0.01 and p<0.05 respectively). PA levels, self-confidence and coping with failure were lower in urban females (UF) than urban males (UM) (p<0.01), Postponing training and unrelated thoughts were higher in UF than UM (p<0.01 and p<0.05). In RF and UF, PA levels positively correlated with self-confidence (Rho = 0.397) and coping with failure (Rho = 0.330), whereas negatively correlated with postponing training (Rho = -0.487) and unrelated thoughts (Rho = -0.283). In RM and UM, PA levels positively correlated with self-confidence (Rho = 0.270) and coping with failure (Rho = 0.258), whereas it negatively correlated with postponing training (Rho = -0.285). PA levels positively correlated with reasons (Rho = 0.260) only in UM. We showed for the first time the relationship between PA and volition factors considering the living setting in university students. Sex differences were observed in some volition facilitators and PA levels independently by the living context. [ABSTRACT FROM AUTHOR]

Background: Magnesium is a micronutrient and an intracellular cation responsible for different biochemical reactions involved in energy production and storage, control of neuronal and vasomotor activity, cardiac excitability, and muscle contraction. Magnesium deficiency may result in impaired physical performance. Moreover, magnesium plays an important role on delayed onset muscle soreness after training. Thus, physically active individuals and sport specialists have to pay attention to magnesium supplementation (MgS). However, the type, timing and dosage of magnesium intake are not well elucidated yet. Hence, we aimed to systematically review the literature regarding the effects of MgS on muscle soreness in physically active individuals. We focused exclusively on MgS, excluding those studies in which magnesium was administered together with other substances. Methods: Three electronic databases and literature sources (PUBMED, SCOPUS and Web of Sciences-Core Collection) were searched, in accordance with PRISMA guidelines. After the database search, 1254 articles were identified, and after excluding duplicates, 960 articles remained. Among these, 955 were excluded following the title and abstract screening. The remaining 5 articles were screened in full text and 4 study met the eligibility criteria. Results: These studies showed that MgS reduced muscle soreness, improved performance, recovery and induced a protective effect on muscle damage. Conclusion: To reach these positive effects, individuals engaged in intense exercise should have a Mg requirement 10–20% higher than sedentary people, to be taken in capsules and 2 h before training. Moreover, it is suggested to maintain magnesium levels in the recommended range during the off-season. Systematic review registration: PROSPERO registration number: CRD42024501822. [ABSTRACT FROM AUTHOR]

The use of novel psychoactive substances (NPSs) has dramatically increased worldwide, and among them, synthetic opioids are one of the fastest growing groups, where cinnamylpiperazines and 2‐benzylbenzimidazoles represent two of the most relevant subclasses. However, the data on their toxicity and metabolism are still limited. The aim of the present study was to evaluate the toxicity and metabolic pathways of some compounds belonging to these families, namely, AP‐237, 2‐methyl AP‐237, isotonitazene, flunitazene, etodesnitazene, metonitazene, metodesnitazene, N‐pyrrolidino etonitazene, and butonitazene. The study was performed using a zebrafish early life stages model. In fact, zebrafish (Danio rerio) embryos and larvae have recently been recognized as a suitable animal model in alternative to mammals, because they require less time and resources and do not need complex procedures for ethics approval. The cellular toxicity after a single administration was assessed at the fourth day post‐fertilization with acridine orange staining. Possible morphological defects were evaluated with a light microscope after 24 h of exposure to 1 μmol/L concentration of each drug. Subsequently, the larvae were euthanized and underwent analysis of drug metabolites using UPLC coupled to an Orbitrap high‐resolution mass spectrometer. High rates of morphological defects, as well as of cellular death, were detected, but no significant difference in mortality between treatment and control groups was observed. In addition, several metabolites, mainly produced through monohydroxylation, N‐dealkylation, and O‐dealkylation, were identified in the larvae extracts. [ABSTRACT FROM AUTHOR]

Diet and exercise intervention are the first strategies to counteract obesity. An online home-based exercise program may be a feasible approach in an obese population. Therefore, this study aimed to investigate the effects of twelve weeks of online Pilates plus diet on body composition in individuals affected by obesity. Thirty-five females were randomly assigned to a home-based Pilates group (PG, n = 18) or a group without intervention (control group, CG, n = 17). All participants followed a Mediterranean diet. The PG followed a twelve-week online Pilates Matwork program (three times/week; 180 min/week), while the CG was not involved in any structured physical exercise program. Body composition and handgrip strength were evaluated at baseline (T0) and after the intervention (T1). A significant group × time interaction (p < 0.05) was found for the fat mass percentage (pFM). Specifically, the pFM was significantly lower at T1 than at T0 in the PG. Significant group × time interactions for fat-free mass (p < 0.05), appendicular skeletal muscle mass (p < 0.05), and skeletal muscle mass (p < 0.01) were found. All these variables were significantly higher at T1 than at T0 in the PG (p < 0.05). Home-based Pilates combined with diet intervention may represent an effective strategy to improve body composition in terms of fat mass reduction and muscle mass gain in adults affected by obesity. [ABSTRACT FROM AUTHOR]

Purpose: In this article, the authors analyse the impact of the 2020 lockdown and the subsequent measures to contain the spread of COVID-19 in Italy in the hospitality industry by looking at the social demands brought forward by the restaurant sector. Design/methodology/approach: To analyse social demands, the authors choose Twitter as an observation point using two hashtags as keywords to scratch the data: #iononriapro and #ioapro, which correspond to two different instances conveyed by the same subject: the restaurant sector. The instances linked to the hashtags produced different levels of engagement and penetration within the social structure and digital platform. To analyse the first block of data linked to the first hashtag-flag #iononriapro, the authors used content analysis. To analyse the second and third block of data linked to the hashtag-flag #ioapro, the authors used an automatic procedure, emotional text mining. Findings: The analysis procedures allow us to reconstruct the positioning of the topics of closures and reopenings due to lockdown in this sector and to identify two explanatory dimensions: structural and affective, which explain the tension that has emerged between the State and the restaurant sector around COVID-related closures. Originality/value: The study's findings not only contribute to the current understandings of the birth, transformation and penetration of social issues by the restaurant sector over the specific period linked to the COVID-19 pandemic and the measures imposed for its containment but are also valuable to analyse the dynamics through which Twitter hashtags and the social issues they represent find strength or lose interest in the public. [ABSTRACT FROM AUTHOR]

Interventional radiotherapy (brachytherapy) has become the new therapeutic standard in the management of early stages nasal vestibule tumors; in fact it allows for high local control rates and low toxicity profiles. However, since more and more patients will receive interventional radiotherapy (brachytherapy) as primary treatment, it is desirable to implement novel strategies to reduce the dose to organs at risk with the future aim to result in further lowering long-term side effects. Materials and methods: We were able to identify two different strategies to reduce dose to the treatment volume, including the implantation technique (the implant can be interstitial, endocavitary or mixed and the catheters may be placed either using the Paris system rules or the anatomical approach) and the dose distribution within the implant (the most commonly used parameter to consider is the dose non-uniformity ratio). We subsequently propose two novel strategies to reduce dose to organs at risk, including the use of metal shields for fixed organs as in the case of the eyes and the use of a mouth swab to push away mobile organs, such in the case of the mandible. We used two different algorithms to verify the values namely the TG-43 and the TG-186. Results: We provided an accurate literature review regarding strategies to reduce toxicity to the treatment volume, underlining the pros and cons of all implantation techniques and about the use dose non-uniformity ratio. Regarding the innovative strategies to reduce the dose to organs at risk, we investigated the use of eye shielding and the use of swabs to push away the mandible by performing an innovative calculation using two different algorithms in a series of three consecutive patients. Our results show that the dose reduction, both in the case of the mandible and in the case of eye shielding, was statistically significant. Conclusion: Proper knowledge of the best implantation technique and dose non-uniformity ratio as highlighted by existing literature is mandatory in order to reduce toxicity within the treatment volume. With regard to the dose reduction to the organs at risk we have demonstrated that the use of eye shielding and mouth swab could play a pivotal role in clinical practice; in fact, they are effective at lowering the doses to the surrounding organs and do not require any change to the current clinical workflow. [ABSTRACT FROM AUTHOR]

Choking (or foreign body airway obstruction) is a widespread phenomenon with serious consequences of morbidity and mortality. Choking (often also called suffocation) can be caused by food or inedible objects and leads to various degrees of asphyxiation or lack of oxygen in the blood stream. The incidence is very high in both young children and adults, especially seniors. However, since not all choking episodes end up in the emergency room or become fatalities, they often escape statistics. Although episodes of choking from non-edible bodies are infrequent, they affect mostly young children. Three of the most common risks for choking in general are neurological disorders, dysphagia and dental issues (few or no teeth, unstable or unsuitable prosthesis or orthodontic appliances). The purpose of this study was to evaluate the risk factors of choking and ways to reduce/avoid this event. We reported data on a series of 138 patients admitted to the emergency department following a choking event, at a hospital in Rome, Italy. The age group of the analyzed population ranged from 1 to 88 years, with the most represented age group of these between 40 and 59, with a similar distribution between males and females. The types of foods on which people choked reflected the seasonal, traditional and local foods: 67% of patients reported choking on fish bones followed by meat bones (9%) and artichokes (3%). Three relevant non-food choking elements reported were: orthodontic items, toothpicks and pins (one occurrence each). We also reported on two clinical cases of patients choking on meat and a chicken bone. In conclusion, choking awareness and prevention are essential for implementing potential life-saving precautions. Prevention is the first tool to reduce the occurrence of this event, therefore it is necessary to analyze the risk factors and educate the population to eliminate them. Proper chewing and oral manipulation are paramount functions in preventing choking, along with meal-time supervision if little children and elderly. Then, it behooves the healthcare professionals to disseminate knowledge of emergency maneuvers (e.g., Heimlich maneuver) to be implemented in the event of choking. [ABSTRACT FROM AUTHOR]

The article addresses concerns about the control of tuberculosis and multi-drug resistance in Calabria, Southern Italy, amidst the migration emergency. It highlights the potential impact of increased migration, particularly from high-endemic TB countries and emphasizes the need for active surveillance, screening and healthcare system strengthening to prevent the re-emergence of TB and the spread of drug-resistant strains.

Thyroid hormones play a crucial role in skeletal muscle development, suggesting that thyroid function may influence muscle mass and muscle strength, which are both fundamental health-related indicators of several age-related consequences. However, whether there is a relationship between thyroid hormones, muscle mass, and muscle strength in individuals without thyroid dysfunctions is still unknown. Therefore, this systematic review aims to investigate whether thyroid hormones are related to muscle mass and strength parameters in euthyroid individuals. Three databases were searched (PubMed, Scopus, Web of Science) up to February 14, 2022, for peer-reviewed papers published in English. The search results were conducted independently by two different reviewers. The review included 13 studies with a total of 241,044 participants. All studies were observational: twelve studies measured thyroid stimulating hormone, ten and thirteen studies measured free triiodothyronine and free thyroxine, four studies analyzed the thyroid hormone ratio. The assessment methods for muscle mass were computed tomography, dual-energy X-ray absorptiometry and bioimpedance analysis, whereas hand dynamometer for muscle strength. Low levels within the normal range of free triiodothyronine, high levels within the normal range of free thyroxine, and lower thyroid hormone ratio may contribute to a reduced muscle function, which seems more evident in older males. [ABSTRACT FROM AUTHOR]

Thyroid hormones play a crucial role in skeletal muscle development, suggesting that thyroid function may influence muscle mass and muscle strength, which are both fundamental health-related indicators of several age-related consequences. However, whether there is a relationship between thyroid hormones, muscle mass, and muscle strength in individuals without thyroid dysfunctions is still unknown. Therefore, this systematic review aims to investigate whether thyroid hormones are related to muscle mass and strength parameters in euthyroid individuals. Three databases were searched (PubMed, Scopus, Web of Science) up to February 14, 2022, for peer-reviewed papers published in English. The search results were conducted independently by two different reviewers. The review included 13 studies with a total of 241,044 participants. All studies were observational: twelve studies measured thyroid stimulating hormone, ten and thirteen studies measured free triiodothyronine and free thyroxine, four studies analyzed the thyroid hormone ratio. The assessment methods for muscle mass were computed tomography, dual-energy X-ray absorptiometry and bioimpedance analysis, whereas hand dynamometer for muscle strength. Low levels within the normal range of free triiodothyronine, high levels within the normal range of free thyroxine, and lower thyroid hormone ratio may contribute to a reduced muscle function, which seems more evident in older males. [ABSTRACT FROM AUTHOR]

Background: Frailty, neurodegeneration and geriatric syndromes cause a significant impact at the clinical, social, and economic level, mainly in the context of the aging world. Recently, Information and Communication Technologies (ICTs), virtual reality tools, and machine learning models have been increasingly applied to the care of older patients to improve diagnosis, prognosis, and interventions. However, so far, the methodological limitations of studies in this field have prevented to generalize data to real-word. This review systematically overviews the research designs used by studies applying technologies for the assessment and treatment of aging-related syndromes in older people. Methods: Following the PRISMA guidelines, records from PubMed, EMBASE, and Web of Science were systematically screened to select original articles in which interventional or observational designs were used to study technologies' applications in samples of frail, comorbid, or multimorbid patients. Results: Thirty-four articles met the inclusion criteria. Most of the studies used diagnostic accuracy designs to test assessment procedures or retrospective cohort designs to build predictive models. A minority were randomized or non-randomized interventional studies. Quality evaluation revealed a high risk of bias for observational studies, while a low risk of bias for interventional studies. Conclusions: The majority of the reviewed articles use an observational design mainly to study diagnostic procedures and suffer from a high risk of bias. The scarce presence of methodologically robust interventional studies may suggest that the field is in its infancy. Methodological considerations will be presented on how to standardize procedures and research quality in this field. [ABSTRACT FROM AUTHOR]

Background: Frailty, neurodegeneration and geriatric syndromes cause a significant impact at the clinical, social, and economic level, mainly in the context of the aging world. Recently, Information and Communication Technologies (ICTs), virtual reality tools, and machine learning models have been increasingly applied to the care of older patients to improve diagnosis, prognosis, and interventions. However, so far, the methodological limitations of studies in this field have prevented to generalize data to real-word. This review systematically overviews the research designs used by studies applying technologies for the assessment and treatment of aging-related syndromes in older people. Methods: Following the PRISMA guidelines, records from PubMed, EMBASE, and Web of Science were systematically screened to select original articles in which interventional or observational designs were used to study technologies' applications in samples of frail, comorbid, or multimorbid patients. Results: Thirty-four articles met the inclusion criteria. Most of the studies used diagnostic accuracy designs to test assessment procedures or retrospective cohort designs to build predictive models. A minority were randomized or non-randomized interventional studies. Quality evaluation revealed a high risk of bias for observational studies, while a low risk of bias for interventional studies. Conclusions: The majority of the reviewed articles use an observational design mainly to study diagnostic procedures and suffer from a high risk of bias. The scarce presence of methodologically robust interventional studies may suggest that the field is in its infancy. Methodological considerations will be presented on how to standardize procedures and research quality in this field. [ABSTRACT FROM AUTHOR]

Copyright of Dermatology Review / Przeglad Dermatologiczny is the property of Termedia Publishing House and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Muscular dystrophies (MDs) are a heterogeneous group of myopathies characterized by progressive muscle weakness leading to death from heart or respiratory failure. MDs are caused by mutations in genes involved in both the development and organization of muscle fibers. Several animal models harboring mutations in MD-associated genes have been developed so far. Together with rodents, the zebrafish is one of the most popular animal models used to reproduce MDs because of the high level of sequence homology with the human genome and its genetic manipulability. This review describes the most important zebrafish mutant models of MD and the most advanced tools used to generate and characterize all these valuable transgenic lines. Zebrafish models of MDs have been generated by introducing mutations to muscle-specific genes with different genetic techniques, such as (i) N-ethyl-N-nitrosourea (ENU) treatment, (ii) the injection of specific morpholino, (iii) tol2-based transgenesis, (iv) TALEN, (v) and CRISPR/Cas9 technology. All these models are extensively used either to study muscle development and function or understand the pathogenetic mechanisms of MDs. Several tools have also been developed to characterize these zebrafish models by checking (i) motor behavior, (ii) muscle fiber structure, (iii) oxidative stress, and (iv) mitochondrial function and dynamics. Further, living biosensor models, based on the expression of fluorescent reporter proteins under the control of muscle-specific promoters or responsive elements, have been revealed to be powerful tools to follow molecular dynamics at the level of a single muscle fiber. Thus, zebrafish models of MDs can also be a powerful tool to search for new drugs or gene therapies able to block or slow down disease progression. [ABSTRACT FROM AUTHOR]

Bioorthogonal chemistry involves selective biocompatible reactions between functional groups that are not normally present in biology. It has been used to probe biomolecules in living systems, and has advanced biomedical strategies such as diagnostics and therapeutics. In this review, the challenges and opportunities encountered when translating in vitro bioorthogonal approaches to in vivo settings are presented, with a focus on methods to deliver the bioorthogonal reaction components. These methods include metabolic bioengineering, active targeting, passive targeting, and simultaneously used strategies. The suitability of bioorthogonal ligation reactions and bond cleavage reactions for in vivo applications is critically appraised, and practical considerations such as the optimum scheduling regimen in pretargeting approaches are discussed. Finally, we present our own perspectives for this area and identify what, in our view, are the key challenges that must be overcome to maximise the impact of these approaches. [ABSTRACT FROM AUTHOR]

The incomplete partition type III is a severe cochlear malformation present in X-linked deafness. It is a rare, non-syndromic cause of severe to profound mixed hearing loss, often progressive. The complete absence of bony modiolus and the wide communication between the cochlea and the internal auditory canal make cochlear implantation challenging, with still no consensus on the management of these patients. To the best of our knowledge, no results have ever been published in the literature on the treatment of these patients with hybrid stimulation (bone and air). We present three cases in which this hybrid stimulation gave better audiological results then air stimulation alone. A literature review on audiological results of the current treatment options in children affected by IPIII malformation was conducted independently by two researchers. Ethical considerations on the treatment of these patients were conducted by the Bioethics department of the University of Insubria. In two of the patients, the bone–air stimulation, associated with prosthetic–cognitive rehabilitation, meant that surgery was avoided, obtaining similar communication performances of those present in the literature. We believe that, when the bone threshold appears partially preserved, a stimulation through the bone or hybrid modality, such as the Varese B.A.S. stimulation, should be attempted. [ABSTRACT FROM AUTHOR]

In this study, we fabricated three different ZnO tetrapodal nanostructures (ZnO-Ts) by a combustion process and studied their physicochemical properties by different techniques to evaluate their potentiality for label-free biosensing purposes. Then, we explored the chemical reactivity of ZnO-Ts by quantifying the available functional hydroxyl groups (–OH) on the transducer surface necessary for biosensor development. The best ZnO-T sample was chemically modified and bioconjugated with biotin as a model bioprobe by a multi-step procedure based on silanization and carbodiimide chemistry. The results demonstrated that the ZnO-Ts could be easily and efficiently biomodified, and sensing experiments based on the streptavidin target detection confirmed these structures' suitability for biosensing applications. [ABSTRACT FROM AUTHOR]

Copyright of L'Idomeneo is the property of Salento University Publishing, Dipartimento di Beni Culturali and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Loss of function mutations in the PHEX gene could determine X-linked dominant hypophosphatemia. This is the most common form of genetic rickets. It is characterized by renal phosphate wasting determining an increase in fibroblast growth factor 23 (FGF-23), growth retard, bone deformities and musculoskeletal manifestations. In recent decades, analysis of the PHEX gene has revealed numerous different mutations. However, no clear genotype-phenotype correlations have been reported in patients with hypophosphatemic rickets (XLH). We report two cases of a 28-year-old-male (patient 1) and a 19-year-old male (patient 2) affected by XLH initially treated with phosphate and 1,25-dihydroxyvitamin–D admitted to the Endocrinology unit because of the persistence of muscle weakness, bone pain and fatigue. After phosphate withdrawal, both patients started therapy with burosumab and symptoms ameliorated in three months. However, patient 1's biochemical parameters did not improve as expected so we decided to investigate his genetic asset. We herein describe a possible clinical implication for the missense "de novo" mutation, c.250G>C (p.Ala84Pro) in the PHEX gene, reported in the PHEX database and classified as a variant of uncertain significance (VUS). The clinical implication of this mutation on disease burden and quality of life in adults is still under investigation. [ABSTRACT FROM AUTHOR]

Peritonitis is the most frequent complication of peritoneal dialysis (PD) and 3-6% of episodes have fungal origin. Candida guilliermondii is an uncommon species of Candida with invasive behavior in patients affected by severe underlying disorders or using indwelling vascular devices. Here we report the case of an 84-year-old woman undergoing outpatient PD for 4 years who had fever, chills, and diffuse increasing abdominal pain. After empiric antimicrobial therapy, based on teicoplanin in the dialytic circuit plus oral ciprofloxacin plus fluconazole, the patient was hospitalized. Afterwards, the culture from the peritoneal fluid showed the presence of C. guilliermondii. PD-related fungal peritonitis is an infrequent event, but the morbidity and mortality rates are significant. In this scenario, appropriate prevention strategies including antifungal prophylaxis during antibiotic treated bacterial peritonitis should be evaluated. [ABSTRACT FROM AUTHOR]

Tony Allan was always seeking a more all-encompassing theoretical framework within which to explore the role of water in society: power relations, political economy, virtual water and in recent years, food-water along the food supply chain. Water International, 37 (2), 169 - 182. https://doi.org/10.1080/02508060.2012.662734 16 Syvitski, J., Kettner, A., Overeem, I., Hutton, E. W. H., Hannon, M. T., Brakenridge, G. R., Day, J., Vörösmarty, C., Saito, Y., Giosan, L., & Nicholls, R. J. (2009). 2 Allan, J. A., Bromwich, B., Keulertz, M., & Colman, A. J. (Eds.). 12 Jakeman, A. J., Barreteau, O., Randall, J., Rinaudo, J. D., & Ross, A. (Eds.). [Extracted from the article]

In recent decades, the rate of caesarean deliveries has increased worldwide. The reasons for this trend are still largely misunderstood and controversial among researchers. The decision often depends on the obstetrician, his beliefs and experience, the characteristics of the patients, the hospital environment and its internal protocols, the increasing use of induction of labor, the medico-legal implications, and, finally, the mother's ability to request delivery by caesarean section without medical indication. This review aims to describe the reasons behind the increasing demand for caesarean sections by patients (CDMR) and strategies aimed at reducing caesarean section rates and educating women about the risks and benefits of CS. [ABSTRACT FROM AUTHOR]

We trace the development of a theory and analytical frames within international political economy that originated from Tony Allan's mainstreaming of power as a determining factor in the control of transboundary flows. These include the Framework of Hydro-Hegemony, coexisting conflict and cooperation and Transboundary Water Interaction Analysis, counter-hegemony and virtual water rivers. These contributions are exemplified briefly through cases from around the globe and in particular the Nile. To ensure that this aspect of Tony's legacy lives on, we propose a research agenda that includes the analysis of power interactions at substate levels between central governments and non-state actors. [ABSTRACT FROM AUTHOR]

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1′-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin–West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (Δβ-turn + Δβ-sheet = +23.6%, Δα = −16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14−1 (HDOCK score (top 1–3 poses): −157.11 ± 1.38 (U2O); −129.80 ± 6.92 (HA 14−1); binding energy: −7.6 kcal/mol (U2O); −5.9 kcal/mol (HA 14−1)) and T2O (HDOCK score (top 1–3 poses): −149.93 ± 2.35; binding energy: −7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1′-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the α-helix structure with the concomitant increase in the β-structure are consistent with a partial protein destabilization due to the interaction with U2O. [ABSTRACT FROM AUTHOR]

The analysis of sequences of words and prosody, meter, and rhythm provided in an interview addressing the capacity to identify and describe emotions represents a powerful tool to reveal emotional processing. The ability to express and identify emotions was analyzed by means of the Toronto Structured Interview for Alexithymia (TSIA), and TSIA transcripts were analyzed by Natural Language Processing to shed light on verbal features. The brain correlates of the capacity to translate emotional experience into words were determined through cortical thickness measures. A machine learning methodology proved that individuals with deficits in identifying and describing emotions (n = 7) produced language distortions, frequently used the present tense of auxiliary verbs, and few possessive determiners, as well as scarcely connected the speech, in comparison to individuals without deficits (n = 7). Interestingly, they showed high cortical thickness at left temporal pole and low at isthmus of the right cingulate cortex. Overall, we identified the neuro-linguistic pattern of the expression of emotional experience. [ABSTRACT FROM AUTHOR]

Antiangiogenic agents attenuate tumours' growth and metastases and are therefore beneficial as an adjuvant or standalone cancer regimen. Drugs with dual antiproliferative and antiangiogenic activities can achieve anticancer efficacy and overcome acquired resistance. In this study, synthetic flavones (5a,b) with reported anticancer activity, and derivatives (4b and 6a), exhibited significant inhibition of endothelial cell tube formation (40–55%, 12 h) at 1 µM, which is comparable to sunitinib (50% inhibition at 1 µM, 48 h). Flavones (4b, 5a,b and 6a) also showed 25–37% reduction in HUVECs migration at 10 µM. In a Western blotting assay, 5a and 5b subdued VEGFR2 phosphorylation by 37% and 57%, respectively, suggesting that VEGFR2 may be their main antiangiogenic target. 5b displayed the best docking fit with VEGFR2 in an in silico study, followed by 5a, emphasizing the importance of the 7-hydroxyl group accompanied by a 4−C=S for activity. Conversely, derivatives with a 4-carbonyl moiety fitted poorly into the target's binding pocket, suggesting that their antiangiogenic activity depends on a different target. This study provides valuable insight into the Structure Activity Relationships (SAR) and modes of action of halogenated flavones with VEGFR2 and highlights their therapeutic potential as antiangiogenic/anticancer lead compounds. [ABSTRACT FROM AUTHOR]

Background: Strength training plays a crucial role in promoting healthy ageing and music might affect how individuals perform and perceive strength exercises. This study aimed to investigate the effects of self-selected music (SSM) on muscle strength and affective states during maximal isometric contractions on a customized leg extension. Methods: Twenty-six healthy middle-aged males (50.8 ± 8.4 years) performed maximal and endurance isometric strength tests under three different conditions: SSM, motivational music (MM), and control condition (CC). Peak force and Rate of Force Development (RFD) were assessed during the maximal isometric strength test. The isometric endurance test evaluated the mean force and a fatigue index. Moreover, Felt Arousal Scale (FAS) was administered before the strength protocol, whereas the Rate of Perceived Exertion (RPE) and Feeling Scale (FS) at the end of it. Results: Mean force was significantly higher in the SSM (507.3 ± 132.2 N) than MM (476.3 ± 122.4 N, p < 0.01) and CC (484.6 ± 119.2 N, p = 0.03). FAS was significantly higher in the SSM (4.0 [1.3] thanMM(3.0 [2.3], p < 0.01) and CC (3.0 [1.3], p < 0.01) conditions. FS was significantly higher in the SSM (4.0 [2.0] than MM (3.0 [1.3], p < 0.01) and CC (3.0 [1.3], p < 0.01) conditions. No significant differences were found for peak force, RFD, fatigue index, and RPE. Conclusions: Listening to SSM seems to influence isometric endurance strength performance in middle-aged adults positively. Moreover, listening to SSM might improve individuals' affective states without affecting the level of perceived exertion. [ABSTRACT FROM AUTHOR]

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations. [ABSTRACT FROM AUTHOR]

Background: The use of variable rate intravenous insulin infusion (VRIII) is a complex process that has consistently been implicated in reports of error and consequent harm. Investment in patient safety has focused mainly on learning from errors, though this has yet to be proved to reduce error rates. The Resilient Health Care approach advocates learning from everyday practices. Video reflexive ethnography (VRE) is an innovative methodology used to capture everyday practices, reflect on and thereby improve these. This study set out to explore the use of VRIIIs by utilising the VRE methodology.Methods: This study was conducted in a Vascular Surgery Unit. VRE methodology was used to collect qualitative data that involved videoing healthcare practitioners caring for patients treated with VRIII and discussing the resulting clips with participants in reflexive meetings. Transcripts of these were subjected to thematic analysis. Quantitative data (e.g. blood glucose measurements) were collected from electronic patient records in order to contextualise the outcomes of the video-observed tasks.Results: The use of VRE in conjunction with quantitative data revealed that context-dependent adaptations (seeking verbal orders to treat hypoglycaemia) and standardised practices (using VRIII guidelines) were strategies used in everyday work. Reflexive meetings highlighted the challenges faced while using VRIII, which were mainly related to lack of clinical knowledge, e.g. prescribing/continuing long-acting insulin analogues alongside the VRIII, and problems with organisational infrastructure, i.e. the wireless blood glucose meter results sometimes not updating on the electronic system. Reflexive meetings also enabled participants to share the meanings of the reality surrounding them and encouraged them to suggest solutions tailored to their work, for example face-to-face, VRIII-focused training.Conclusions: VRE deepened understanding of VRIII by shedding light on its essential tasks and the challenges and adaptations entailed by its use. Future research might focus on collecting data across various units and hospitals to develop a full picture of the use of VRIIIs. [ABSTRACT FROM AUTHOR]

Music is made up of several features (e.g., melody and rhythm) and it accompanies our life in different daily activities. During the last years, there was a growing interest in research about the music-related effects in the exercise domain. Music stimuli could act as an ergogenic effect leading to improvements in health-related and physical fitness components like cardiorespiratory endurance and muscular fitness. Moreover, listening to music may positively affect individuals’ psychological state which could lead to increased exercise adherence. Conflicting data exist regarding the effects of music on cardiorespiratory and muscle-strengthening exercises indicating that music’s characteristics (i.e., rhythm and musicality), studied samples (i.e., athletes and amateur) and methodology (i.e., self-selected music and research-selected music) might influence the results. Listening to music while exercising is becoming more frequent also in recreationally active individuals. While literature mainly focused on the effects of music in elite and amateur athletes, little data are available regarding recreationally active participants. Therefore, this review aims to summarize evidence regarding the effects of music on health-related physical fitness components in recreationally active individuals, specifically referring to cardiorespiratory endurance and muscular fitness. These outcomes will be helpful to all recreationally active participants to optimize the exercise protocol with the use of music. [ABSTRACT FROM AUTHOR]

We herein report an innovative antisense approach based on Peptide Nucleic Acids (PNAs) to down-modulate CD5 expression levels in chronic lymphocytic leukemia (CLL). Using bioinformatics tools, we selected a 12-mer tract of the CD5 mRNA as the molecular target and synthesized the complementary and control PNA strands bearing a serine phosphate dipeptide tail to enhance their water solubility and bioavailability. The specific recognition of the 12-mer DNA strand, corresponding to the target mRNA sequence by the complementary PNA strand, was confirmed by non-denaturing polyacrylamide gel electrophoresis, thermal difference spectroscopy, circular dichroism (CD), and CD melting studies. Cytofluorimetric assays and real-time PCR analysis demonstrated the downregulation of CD5 expression due to incubation with the anti-CD5 PNA at RNA and protein levels in Jurkat cell line and peripheral blood mononuclear cells from B-CLL patients. Interestingly, we also observed that transfection with the anti-CD5 PNA increases apoptotic response induced by fludarabine in B-CLL cells. The herein reported results suggest that PNAs could represent a potential candidate for the development of antisense therapeutic agents in CLL. [ABSTRACT FROM AUTHOR]

Purpose of the article. To explore the role of fetal echocardiography in predicting the risk of urgent balloon atrial septostomy (BAS) at birth in fetuses diagnosed with transposition of the great arteries (TGA). Medline, Embase, and Cochrane databases were searched. The primary aim was to explore the differences in prenatal echocardiographic parameters among fetuses diagnosed with TGA that required urgent BAS within 24 h of birth due to life-threatening cyanosis compared to those who did not require such procedure. Random-effect meta-analyses were used to compute the data. Six studies (292 fetuses) were included. Restrictive appearance of the FO was present in 64.5% (95% CI = 39.8–85.7) of fetuses with TGA requiring BAS at birth compared to 7.9% (95% CI = 2.1–16.8) not requiring such procedure (OR = 71.1; 95% CI = 8.3–608.5, p <.0001). Hypermobile appearance of the atrial septum was present in 39.1% (95% CI = 26.4–56.5) of fetuses requiring BAS at birth compared to 9.8% (95% CI = 1.4–24.3) of those which did (OR 3.6; 95% CI = 1.4–9.0, p =.05). There was no difference in the prevalence of redundant (p =.374) or fixed (p =.051) atrial septum, bidirectional flow in the DA (p =.26) or an abnormal size of the DA (p =.06) in fetuses requiring urgent BAS at birth compared to those which did not. Mean (±SD) size of the right atrium was smaller in the fetuses with TGA undergoing urgent BAS at birth (23.4 ± 6.7) compared to those which did not (29.2 ± 6.2, p =.01). The mean (±SD) ratio between the FO and the aortic valve diameters (1.01 ± 0.41 versus 1.41 ± 0.43, p =.009) and the mean (±SD) ratio between the FO diameter and the septal length (0.36 ± 0.13 versus 0.51 ± 0.14, p =.001) were significantly smaller in fetuses requiring compared to those not undergoing urgent BAS at birth. The diagnostic accuracy of each independent ultrasound marker of the need for urgent BAS showed an overall good specificity but a low sensitivity. Fetal echocardiography prior to birth can stratify the risk of BAS in fetuses with TGA. Further studies are needed to validate these findings and build individualized multiparametric predictive models in order to more accurately identify those fetuses with TGA at a higher risk of urgent BAS after birth. [ABSTRACT FROM AUTHOR]

This article proposes an overview of the work »Storia delle storie generali della filosofia« (»History of the General Histories of Philosophy«; 1979-2004; 5 vol.) from the point of view of a philosophical historiography in a global perspective. The article consists of two parts. First of all, I will display the structure of the work in its five volumes introducing briefly the sections and chapters in which it is organized. In second place, I will examine the delimitation of its research field to the Eurocentric canon through methodological considerations regarding the focus of specific linguistic-geopolitical areas. [ABSTRACT FROM AUTHOR]