Search

The phylogeny of 10 taxa belonging to three sections of Arisaema (Pistillata, Tortuosa, and Arisaema) distributed in Korea and an outgroup taxon (Pinellia ternate) was analyzed by comparing the trnL(UAA)-trnF(GAA) intergenic spacer sequences of the chloroplast DNA (cpDNA). The trnL-trnF regions ranged from 336 to 396 base pairs (bp) in length. Sequence alignment required 18 base substitutions and 4 independent indels in the region. The longest length mutation was a 35-bp deletion in A. thunbergii, A. heterophyllum, A. urashima, and A. candidissimum. Two different restriction fragment patterns were seen with MspI digestions. Section Tortuosa (A. thunbergii and A. heterophyllum) plus A. urashima and A. candidissium were distinguished from the others. In addition, 16-bp deletions were found in A. thunbergii, A. heterophyllum, and A. candidissimum. Four species possessed a 24-bp insertion mutation with a duplication motif, TTTTGTTAGGTTATCCTTACACTT: A. amurense f. serratum, A. robustum f. purpureum, A. peninsulae, and A. sikokianum. A maximum parsimony analysis of 11 accessions produced 12 equally most-parsimonious (MP) trees. The MP trees also contained three independent groups. Group I contained one taxon: A. ringens f. praecox. Group II contained the section Tortuosa accessions including A. urashima and A. candidissimum. Group III contained the section Arisaema and A. sikokianum. These results show that analyses of the cpDNA trnL-trnF intergenic spacer are a useful approach for inferring phylogenetic relationships and identification within the genus Arisaema, distributed in Korea. [ABSTRACT FROM AUTHOR]

The inheritance patterns of the chloroplast genomes of the Actinidia hybrids A. eriantha (male parent) x A. chinensis (female parent) and A. chinensis (male parent) x A. melanandra (female parent) were analyzed using single-strand conformation polymorphism (SSCP) analysis of the trnL-trnF and psbA-trnH intergenic spacers, This showed that the artificial hybrids between A. eriantha and A. chinensis all had the haplotype of their male parent. Alignment of the sequences of A, eriantha and A. chinensis revealed four substitutions and one insertion (GATTO) in trnL-TrunF and two substitutions in psbh-trnH. In contrast, the haplotypes of the artificial hybrids between A. chinensis and A. melanandra had the same patterns as their female parent. Alignment of the entire region of A. chinensis and A. melanandra revealed 12 substitusions: 1 in trnL-trnF and 11 in psbA-trnH. However, no sequence variation in the trnL-trnF and psbA-trnH intergenic spacers was found. We have developed a simple screening method for detecting the inheritance patterns of Actinidia chloroplast sNA haplotypes using SSCP analysis if the trnL-trnF and psbA-trnH iatergenic spacers. Our findings indicate that the inheritance of the chloroplast genome in Actinidia hybrids according to the species selected. [ABSTRACT FROM AUTHOR]

Presents a study which determined the nucleotide sequences of the hypervariable D-loop region of mitochondrial DNA from horse bone that was excavated from the Kwakji archaeological site in Jeju, Korea. Characteristics of the Jeju horses; Materials and methods used; Results and discussion.

We determined the complete mitochondrial genomes of Pseudolabrus sieboldi and P. eoethinus, and analyzed the genome organization, codon usage, and transition/transversion mutation ratio of the mitochondrial genome. The mitochondrial genomes of P. sieboldi and P. eoethinus are 16,507 and 16,508 bp in length, respectively, and consisted of 37 genes (13 protein-coding genes, two ribosomal RNAs, and 22 transfer RNAs), which is typical for vertebrate mitochondrial DNA. All protein-coding genes of two species used the initiation codon ATG except the cytochrome c oxidase subunit (CO) 1, which began with GTG as an initiation codon. However, the termination codon for the NADH dehydrogenase subunit (ND) 6 gene encoded with TAA in P. sieboldi, and TAG in P. eoethinus. The 12S and 16S rRNA genes were 949 and 1694 bp, respectively, in P sieboldi, and were 948 and 1693 bp in P. eoethinus. The A+T content of the two rRNA genes were 52.9% in P. sieboldi and 52.5% in P. eoethinus, which is slightly lower than that of other labrid species. The identity of the 13 protein-coding genes ranged between 67% (ND6) and 94% (CO2 and ATP8). The G+C contents of all of the protein-coding genes of P. sieboldi were slightly higher than those of P. eoethinus. Our data contribute to the identification, and further our understanding, of the comparative genetics of Pseudolabrus species distributed in East Asia. [ABSTRACT FROM AUTHOR]

We determined the complete nucleotide sequence of the mitochondrial genome for the rabbitfish Siganus fuscescens (Perciformes, Siganidae). This mitochondrial genome, consisting of 16,491 base pairs (bp), included 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a noncoding control region similar those found in other vertebrates; the gene order was identical to that of typical vertebrates. Most of the genes of S. fuscescens were encoded on the H-strand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser [UCN], Glu, and Pro) genes were encoded on the L-strand. The reading frames of ATPase 8 and 6 and those of ND4L and ND4 overlapped by ten and seven nucleotides, respectively. All mitochondrial protein-coding genes began with an ATG start codon, except for CO1, which started with GTG. Open reading frames of S. fuscescens ended with TAA (ND1, CO1, ATPase 8, ND4L, ND5 and ND6), and the remainder had incomplete stop codons, either TA (ATPase 6 and CO3) or T (ND2, CO2, ND3, ND4, and Cytb). The origin of L-strand replication in S. fuscescens was located in a cluster of five tRNA genes (WANCY) and was 34 nucleotides in length. A major noncoding region between the tRNA-Pro and tRNA-Phe genes (828 bp) was considered to be the control region (D-loop). Within this sequence, we identified a conserved sequence block characteristic of this region. The rabbitfish was grouped with Siganus canaliculatus in most parsimony analyses, which showed 100% bootstrap support for their divergence. These findings are useful for inferring phylogenetic relationships and identification within the suborder Acanthuroidei. [ABSTRACT FROM AUTHOR]

Ancient cattle bones were excavated from archaeological sites in Jeju, Korea. We used molecular genetic techniques to identify the species and establish its relationship to extant cattle breeds. Ancient DNA was extracted from four sources: a humerus (Gonae site, A.D. 700-800), two fragments of radius, and a tooth (Kwakji site, A.D. 0-900). The mitochondrial DNA (mtDNA) D-loop regions were cloned, sequenced, and compared with previously reported sequences of various cattle breeds (9 Asian, 8 European, and 3 African). The results revealed that these bones were of the breed, Bos taurus, and a phylogenetic tree indicated that the four cattle bones formed a monophyletic group with Jeju native black cattle. However, the patterns of sequence variation and reports from archaeological sites suggest that a few wild cattle, with a different maternal lineage, may have existed on Jeju Island. Our results will contribute to further studies of the origin of Jeju native cattle and the possible existence of local wild cattle. [ABSTRACT FROM AUTHOR]