Search

Objective: The purpose of this research was to examine whether the clustering of underage risky drinking and its consequences within communities might arise from shared perceptions regarding underage drinking as well as the social context of drinking. Method: The Enforcing Underage Drinking Laws Randomized Community Trial provided data from repeated cross-sectional samples of 5,017 current drinkers (2,619 male) ages 14-20 years from 68 communities surveyed in 2004, 2006, and 2007. Alternating logistic regressions were used to estimate the influence of social factors on the clustering of getting drunk, heavy episodic drinking, nonviolent consequences, and driving after drinking or riding with a drinking driver. Results: The clustering of getting drunk, heavy episodic drinking, and nonviolent consequences was no longer statistically significant after adjustment for drinking with friends and drinking with parents. Parents providing alcohol explained the clustering of heavy episodic drinking and nonviolent consequences, whereas drinking with other underage drinkers and friends providing alcohol explained the clustering of nonviolent consequences. Drinking with friends or other underage drinkers and friends providing alcohol increased the risk of these behaviors, whereas drinking with parents and parents providing alcohol were protective. Perceptions regarding peer drinking, community norms, consequences for drinking, and drinking at a party did not influence clustering. Conclusions: These findings suggest that interventions to reduce underage risky drinking in communities should focus on the differential effects of the social context in which drinking occurs. [ABSTRACT FROM AUTHOR]

BACKGROUND: Kallikrein-related peptidase 6 (KLK6) encodes a trypsin-like serine protease that is up-regulated in several cancers, although the putative functions of KLK6 in cancer have not been elucidated. In the current study, overexpression of KLK6 was identified in colon cancer, and the possibility that KLK6 may be a suitable candidate as a tumor marker was examined. METHODS: Messenger RNA (mRNA) transcript levels and protein up-regulation of KLK6 in colon cancer tissues was examined using reverse transcriptase-polymerase chain reaction, immunohistochemistry, and clinicopathologic analyses. Cell proliferation, invasiveness, and antiapoptotic activity were determined in colon cancer cells that were transfected with small-interfering RNA (siRNA) of KLK6. RESULTS: KLK6 mRNA was up-regulated significantly in tumor tissues compared with nontumor regions. KLK6 protein was strongly expressed in adenocarcinomas but was not expressed in normal mucosa or in premalignant dysplastic lesions. Sera from patients with colon cancer revealed an increase in KLK6 secretion (0.25 lg/mL; P = .031) compared with noncancer cells (0.19 µg/mL). Clinicopathologic and immunohistochemical studies of 143 patients with colon cancer revealed a significant correlation between KLK6 expression and Dukes disease stage (P = .005). High KLK6 expression was associated significantly with shorter overall (P = .001) and recurrence-free survival (P = .001). The rates of proliferation and invasiveness were decreased by 50% in cells that were transfected with KLK6 siRNA. The overexpression of KLK6 led to decreased activity of the E-cadherin promoter. CONCLUSIONS: KLK6 was up-regulated significantly in tissues and sera from patients with colon cancer and was associated closely with a poor prognosis, suggesting that KLK6 may be used as a potential biomarker and a therapeutic target for colon cancer. [ABSTRACT FROM AUTHOR]

Background: CD36 is a multifunctional membrane receptor and a cell-adhesion molecule that is expressed in platelets, monocytes/macrophages, microvascular endothelial cells, cardiac monocytes and adipocytes. In this study, we investigated whether genetic polymorphisms of the CD36 gene are associated with risk of coronary artery disease (CAD) in a Korean population. Methods: PCR and polyacrylamide gel electrophoresis or PCR-restriction fragment length polymorphism assays were performed to analyze the following CD36 gene polymorphisms: a (TG) repeat in intron 3 and the base substitution 478C>T (Pro90Ser). A total of 219 patients with significant CAD and 236 control subjects were examined with regard to their genotypes, lipid profiles and other risk factors for CAD. Results: The frequency of (TG) 11- or 12-repeat homozygotes was significantly higher in male CAD patients than in control men (28.4% vs. 15.7%, OR=2.13, p=0.018). Homozygosity for the (TG) 11- or 12-repeat allele was also significantly associated with a higher body mass index (BMI) compared to non-carriers in 134 control men after controlling for age, smoking and hypertension, and explains a 13% BMI variation observed in this study (p=0.015, analysis of covariance). For the 478C>T mutation, which has been reported to be associated with CD36 deficiency, there was no difference in the frequency of the 478T allele between CAD patients and control subjects. However, the 478T allele was found to be closely linked with a (TG) 11- or 12-repeat allele of intron 3 in the control subjects (χ2=18.88, p<0.001). Conclusions: The (TG) repeat polymorphism in intron 3 of the CD36 gene is associated with a higher BMI and cardiovascular risk for men in a Korean population. Clin Chem Lab Med 2007;45:1277–82. [ABSTRACT FROM AUTHOR]

The phylogeny of 10 taxa belonging to three sections of Arisaema (Pistillata, Tortuosa, and Arisaema) distributed in Korea and an outgroup taxon (Pinellia ternate) was analyzed by comparing the trnL(UAA)-trnF(GAA) intergenic spacer sequences of the chloroplast DNA (cpDNA). The trnL-trnF regions ranged from 336 to 396 base pairs (bp) in length. Sequence alignment required 18 base substitutions and 4 independent indels in the region. The longest length mutation was a 35-bp deletion in A. thunbergii, A. heterophyllum, A. urashima, and A. candidissimum. Two different restriction fragment patterns were seen with MspI digestions. Section Tortuosa (A. thunbergii and A. heterophyllum) plus A. urashima and A. candidissium were distinguished from the others. In addition, 16-bp deletions were found in A. thunbergii, A. heterophyllum, and A. candidissimum. Four species possessed a 24-bp insertion mutation with a duplication motif, TTTTGTTAGGTTATCCTTACACTT: A. amurense f. serratum, A. robustum f. purpureum, A. peninsulae, and A. sikokianum. A maximum parsimony analysis of 11 accessions produced 12 equally most-parsimonious (MP) trees. The MP trees also contained three independent groups. Group I contained one taxon: A. ringens f. praecox. Group II contained the section Tortuosa accessions including A. urashima and A. candidissimum. Group III contained the section Arisaema and A. sikokianum. These results show that analyses of the cpDNA trnL-trnF intergenic spacer are a useful approach for inferring phylogenetic relationships and identification within the genus Arisaema, distributed in Korea. [ABSTRACT FROM AUTHOR]

Purpose Although many hypotheses regarding the pathogenesis of polycystic ovary syndrome (PCOS) have been generated, genetic studies have not identified specific genes that play a role in PCOS etiopathogenesis. This study aimed to investigate the relationship between TGF-β1 gene polymorphism and PCOS in Koreans. Method A total of 51 Korean women with PCOS and 69 healthy women were enrolled. We analyzed 4 single nucleotide polymorphisms (SNPs) of the TGF-β1 gene (rs11466313, rs1800469, rs2317130, and rs4803457). We also analyzed laboratory measurements, such as free testosterone, glucose, and cholesterol. Results The frequencies of rs1800469T allele negativity, rs4803457T allele negativity, the rs1800469CC genotype, and the rs4803457CC genotype showed positive associations with PCOS (P = 0.003, P = 0.027, P = 0.009, and P=0.031, respectively), whereas the haplotypes rs1800469C– rs4803457T and rs1800469T–rs4803457T showed negative associations with PCOS. A strong protective effect of the "rs1800469CT–rs4803457TT" combination (OR = 0.09) and a strong risk effect of "rs1800469CC–rs4803457CC" (OR = 6.23) for PCOS were observed. The rs1800469C/T and rs2317130C/T SNPs exhibited associations with several laboratory measurements with various levels of significance. Conclusion The results demonstrated an association of TGF-β1 gene polymorphisms with the development and/or characteristics of PCOS in the Korean population. [ABSTRACT FROM AUTHOR]

Objective: To explore the factor structure of the Index of Sojourner's Social Support (ISSS) within a sample of Spanish- speaking immigrant Latino men. Methods: We explored the factor structure and calculated correlations to examine associations between the ISSS subscales and self-esteem, mastery, and depression. Results: Mean age of the 244 participants was 26.9 years old and most were from Mexico, had less than high school educational attainment, and worked in construction. The ISSS did not perform as well as expected. Conclusions: Although the ISSS may prove useful as we begin to conceptualize the role and meaning of social support within the context of immigration, more research is needed to develop meaningful measures of constructs among immigrant Latinos in the United States. [ABSTRACT FROM AUTHOR]

BACKGROUND: This study was performed to determine the prevalence of antibodies to hepatitis B core antigen (anti-HBc) among Korean blood donors and frequencies of hepatitis B virus (HBV) DNA and antibodies to hepatitis B surface antigen (anti-HBs) in anti-HBc-positive donors. STUDY DESIGN AND METHODS: A total of 12,461 consenting blood donors were consecutively enrolled from Korean Red Cross Blood Services from April to October 2008. All of the donors were screened for anti-HBc with an electrochemiluminescence immunoassay. Repeat-reactive anti-HBc-positive donors were assayed for anti-HBs and for HBV DNA using a multiplex test (Cobas TaqScreen, Roche Molecular Systems) on individual donation. RESULTS: Of the 12,461 donors, 1682 (13.5%) were reactive for anti-HBc. Among different age groups, there was a steady increase in the anti-HBc-positive rate, ranging from 2.0% in the age group of less than 20 years to 80.0% in the age group of 60 years and older (p < 0.0001). Of the anti-HBc-positive donors, 1523 (90.5%) were anti-HBs positive. HBV DNA was detected in two donors who were anti-HBc positive and hepatitis B surface antigen negative. The prevalence of occult HBV infection was 0.016%, and the HBV nucleic acid test (NAT) yield was 1 in 838 (0.12%). CONCLUSION: This study helps to determine the current status of hepatitis B infection and the prevalence of occult HBV infection in the blood donor population in Korea. We estimate that in Korea, up to 161 units per million donated units from blood donors may contain HBV DNA. Although the potential infectivity of these units has been debated upon, the HBV NAT assay could prevent certain transfusion-transmitted HBV infections. [ABSTRACT FROM AUTHOR]

It is important to determine the clinical significance of non-human leukocyte antigen (HLA) antibodies and their association with antibody-mediated rejection (ABMR) of kidney allografts. We collected post-transplant sera from 68 ABMR patients, 67 T-cell mediated rejection (TCMR) patients, and 83 control subjects without rejection, and determined the titers of 39 non-HLA antibodies including antibodies for angiotensin II receptor type I and MICA. We compared all these non-HLA antibody titers among the study groups. Then, we investigated their association with the risk of death-censored graft failure in ABMR cases. Among the antibodies evaluated, anti-collagen type I (p = 0.001) and type III (p < 0.001) antibody titers were significantly higher in ABMR cases than in both TCMR cases and no-rejection controls. Both anti-collagen type I [per 1 standard deviation (SD), adjusted odds ratio (OR), 11.72 (2.73-76.30)] and type III [per 1 SD, adjusted OR, 6.22 (1.91-31.75)] antibodies were significantly associated with the presence of ABMR. Among ABMR cases, a higher level of anti-collagen type I [per 1 SD, adjusted hazard ratio (HR), 1.90 (1.32-2.75)] or type III per 1 SD, [adjusted HR, 1.57 (1.15-2.16)] antibody was associated with a higher risk of death-censored graft failure. In conclusion, post-transplant anti-collagen type I and type III antibodies may be novel non-HLA antibodies related to ABMR of kidney allografts. [ABSTRACT FROM AUTHOR]

Background: FoxP3 is the most dependable marker for regulatory T cells which play a major role in immune tolerance. Foxp3 gene polymorphisms were associated with various autoimmune diseases and clearance of viral infections. We studied the association of Foxp3 polymorphisms in severe RRP patients. Methods: A total of 30 Korean severe RRP patients and 195 healthy controls were enrolled. Foxp3 polymorphisms (rs5902434 del/ATT, rs3761548 C/A, rs3761549 C/T, and rs2232365 G/A) were determined by PCR and sequencing. Results: Genotype frequencies (GF) of rs5902434 ATT/ATT and rs2232365 GG were significantly decreased in female RRP patients than controls (0.0% vs 23.0%, p = 0.039, OR = 9.4 for both). Conclusions: We showed that Foxp3 polymorphism of rs5902434 and rs2232365 could be an important protective factor in the susceptibility of severe RRP in female Koreans. Further studies on larger number of patients and other ethnic groups are needed to clarify the association. [ABSTRACT FROM AUTHOR]

Lewis phenotypes using various types of specimen were compared with the Lewis phenotype predicted from Lewis and Secretor genotypes. This is the first logical step in explaining the association between the Lewis expression and Helicobacter pylori. We performed a study of the followings on 209 patients who underwent routine gastroscopy: erythrocyte and saliva Lewis phenotyping, gastric Lewis phenotyping by the tissue array, and the Lewis and Secretor genes genotyping. The results of phenotyping were as follows [Le(a-b-), Le(a+b-), Le(a-b+), and Le(a+b+), respectively, in order]: erythrocyte (12.4%, 25.8%, 61.2%, and 0.5%); saliva (2.4%, 27.3%, 70.3%, and 0.0%); gastric mucosa (8.1%, 6.7%, 45.5%, and 39.7%).The frequency of Le, le59/508, le 59/1067, and le 59 alleles was 74.6%, 21.3%, 3.1%, and 1.0%, respectively, among 418 alleles. The saliva Lewis phenotype was completely consistent with the Lewis phenotype inferred from Lewis and Secretor genotypes, but that of gastric mucosa could not be predicted from genotypes. Lewis phenotyping using erythrocytes is only adequate for transfusion needs. Saliva testing for the Lewis phenotype is a more reliable method for determining the peripheral Lewis phenotype of an individual and the gastric Lewis phenotype must be used for the study on the association between Helicobacter pylori and the Lewis phenotype. [ABSTRACT FROM AUTHOR]

CD109 gene encodes a glycosylphosphatidylinositol-linked glycoprotein found in a subset of platelets and endothelial cell, and human platelet antigen (HPA) 15 is found on CD109. We evaluated the HPA genotype and/or the CD109 mRNA expression on two peripheral blood stem cells (PBSC), two peripheral bloods (PB), 12 granulocyte products, natural killer (NK)-92, B-lymphocyte (CO88BV59-1), K-562 leukemia cell line, human embryonic stem cell (hESC), and human fibroblasts (HF). HPA genotyping was performed by SNaPshot assay and CD109 mRNA expression was evaluated by real-time PCR with SYBR green and melting curve analysis. Genotype HPA-15a/-15a was found in PBSC#1 and two granulocyte products, and HPA-15a/-15b was found in PBSC#2, eight granulocyte products, NK-92, K-562, hESC, and HF, and HPA-15b/-15b was found in two granulocyte products. CD109 mRNA expression was highly increased in HF and increased in CD34+ and CD34-PBSCs and some granulocyte products, compared to the PB. However, the increase of expression level varied among the PBSC and granulocyte products. The CD109 mRNA expression of NK-92, K-562, hESC, and CO 88BV59-1 was not detected. HPA genotype was evaluated in various cells and the expression of CD109, which contains HPA 15, was different among cell lines and high in HF and PBSCs. [ABSTRACT FROM AUTHOR]

We evaluated the relationship between mean platelet volume (MPV) and characteristics of 10,577 cord blood (CB) units in a public CB bank in Korea. Blood group O has the highest MPV (P = 0.002). MPV correlated with CB volume (r = 0.121), Hb (r = 0.377), WBC (r = 0.111), TNCs (r = 0.110), CD34+ cell (r = 0.174), CD34+ cells/TNCs (r = 0.157), gestational age (r = -0.102), and birth weight (r = 0.023); (P < 0.001 in all). MPV may be one of the useful decision parameters of process priority in CB bank. [ABSTRACT FROM AUTHOR]

Wharton's jelly is not only one of the most promising tissue sources for mesenchymal stem cells (MSCs) but also a source of natural growth factors. To prove that we can get both natural growth factors and MSCs from Wharton's jelly, we compared cellular characteristics and the level of basic fibroblast growth factor (bFGF) from samples using the explant culture method to those derived from the traditional enzymatic culture method. The levels of bFGF were 27.0 ± 11.7 ng/g on day 3, 15.6 ± 11.1 ng/g on day 6, and decreased to 2.6 ± 1.2 ng/g on day 14. The total amount of bFGF released was 55.0 ± 25.6 ng/g on explant culture. Compared with the traditional enzymatic digestion method, the explant culture method showed a tendency to release higher levels of bFGF in supernatant media for the first week of culture, and the higher cellular yield at passage 0 (4.89 ± 3.2 × 105/g versus 1.75 ± 2.2 × 105/g, P = 0.01). In addition, the genes related to mitosis were upregulated in the explant-derived MSCs. [ABSTRACT FROM AUTHOR]

Haptoglobin, the product of the Hp gene, is a glycoprotein involved in the scavenging of free hemoglobin. Haptoglobin levels increase or decrease in response to various acquired conditions, and they are also influenced by genetic predisposition. There were 2 major alleles, Hp¹ and Hp², and 1 minor allele, Hpdel. Many researchers have attempted to study the haptoglobin types and their association with disease; however, no definitive conclusions have been reached yet. It is reported that patients who are genetically deficient in haptoglobin are at risk of anaphylaxis against blood components containing haptoglobin. Haptoglobin genotypes also affect the reference intervals of haptoglobin levels. Many studies have attempted to establish simple and accurate typing methods. In this paper, we have broadly reviewed several methods for haptoglobin typing--phenotyping, Southern blotting, conventional PCR, real-time PCR, and loop-mediated isothermal amplification. We discuss their characteristics, clinical applications, and limitations. The phenotyping methods are time consuming and labor intensive and not designed to detect patients harboring Hpdel. The rapid and robust haptoglobin genotyping may help in preventing fatal anaphylactic reactions and in establishing the relationships between the haptoglobin phenotypes and diseases. [ABSTRACT FROM AUTHOR]

We compared the performances of 3 Multiple Allergen Simultaneous Test (MAST) assays: RIDA Allergy Screen (R-Biopharm, Darmstadt, Germany), MAST Optigen allergy system (Hitachi Chemical Diagnostics, Mountain View, CA), and Polycheck Allergy (Biocheck GmbH, Munster, Germany). Forty sera that tested positive with the RIDA Allergy Screen (20 for food and 20 for inhalant panel) were subjected to MAST Optigen and Polycheck Allergy. For 26 available sera with discrepant results, 62 ImmunoCAP allergen-specific IgE tests (Pharmacia Diagnostics, Uppsala, Sweden) were performed. Percent agreements (kappa value) were 87.6% (0.59) and 91.3% (0.60) between RIDA and MAST; 89.9% (0.55) and 88.3% (0.46) between RIDA and Polycheck; and 86.8% (0.51) and 90.6% (0.61) between MAST and Polycheck. Compared with ImmunoCAP, agreements (kappa value) of inhalant and food panels were 51.7% (0.04) and 33.3% (-0.38) for RIDA; 60.7% (0.27) and 81.8% (0.59) for MAST; and 65.5% (0.26) and 45.5% (0.07) for Polycheck. The agreements between RIDA, MAST, and Polycheck and ImmunoCAP-positivity were 45.7%, 88.2%, and 28.6%, respectively, and the agreements for ImmunoCAP-negativity were 37.0%, 51.9%, and 88.9%. MAST Optigen showed better agreement with ImmunoCAP than other assays in the food panel. Better sensitivity of MAST Optigen and better specificity of Polycheck Allergy were suspected. [ABSTRACT FROM AUTHOR]

Reverse sequence screening for syphilis (RSSS) (screening with treponemal tests, followed by confirmation with nontreponemal tests) has been increasingly adopted. CDC recommends confirmation of discordant results (reactive EIA/CIA and nonreactive nontreponemal test) with Treponema pallidum particle agglutination assay (TP-PA). We characterized sera with discordant results from RSSS with Architect Syphilis TP CIA. Among 15,713 screening tests using Architect Syphilis TP at Seoul National University Gangnam Center between October 2010 and May 2011,260 (1.7%) showed reactive results. Rapid plasma reagin (RPR) and TP-PA were performed on 153 available sera among them. On sera with discordant results between Architect Syphilis TP and TP-PA, INNO-LIA Syphilis Score and FTA-ABS were performed. Among 153 sera, RPR was nonreactive in 126 (82.4%). Among them, TP-PA was positive in 103 (81.7%), indeterminate (±) in 7 (5.6%), and negative in 16 (12.7%). Out of 16 CIA(+)/RPR(-)/TP-PA(-) sera, INNO-LIA Syphilis Score and/or FTA-ABS were negative on 14 sera. Out of 7 CIA(+)/RPR(-)/TP-PA(±) sera, INNO-LIA Syphilis Score and FTA-ABS were positive/reactive in 6 sera. RSSS with confirmation by TP-PA on sera with discordant results between Architect Syphilis TP and RPR effectively delineated those discordant results and could be successfully adopted for routine checkup for syphilis. [ABSTRACT FROM AUTHOR]

utoreactive cytotoxic T cells play a key role in the pathogenesis of aplastic anemia (AA) by myelosuppressive cytokines including interferon-gamma, tumor necrosis factor alpha, and transforming growth factor beta. The purpose of this study is to determine which single nucleotide polymorphisms (SNPs) in cytokine genes were relevant to AA risk and whether the relevant SNPs were associated with response to immunosuppressive therapy (IST). Among 84 screened patients, 80 patients confirmed as having acquired AA, and 84 age- and sex-matched healthy controls were analyzed consecutively. We genotyped ten polymorphisms in three cytokine genes ( IFNG, TNF, and TGFB1) and FAS gene. We assessed the association between polymorphisms and AA risk, and the association between polymorphisms and response to IST in three genetic models (dominant, recessive, and additive). The IFNG −2,353 T allele (dominant model, OR = 0.43, p = .012) and TCA haplotype (dominant model, OR = 0.50, p = .038) were significantly associated with the development of AA. In addition, this relevant IFNG −2,353 T allele and TCA haplotype were related to the response of IST (dominant model, OR = 0.076, p = .034). Concerning TGFB1, although its polymorphisms are not related to AA susceptibility, P10L T allele (recessive model, OR = 0.18, p = .038) and CT haplotype (dominant model, OR = 5.68, p = .038) were associated with response to IST. This exploratory study concurred with prior studies indicating that polymorphisms in IFNG are related to AA susceptibility. In addition, it was found that polymorphisms in IFNG and TGFB1 are associated with response to IST. [ABSTRACT FROM AUTHOR]

Background: Serum cystatin B (CSTB) concentrations have been reported to be increased in patients with hepatocellular carcinoma compared to concentrations seen in normal subjects. In this study, we developed a 'fluorescent microsphere immunoassay' (FMI) capable of specifically detecting CSTB in serum. Methods: The FMI used a microparticle conjugated polyclonal antibody to CSTB and biotinylated monoclonal antibody as capture protein and probe protein, respectively. The results were obtained using the Bio-Plex200 system. Results: The dose-response relationship between CSTB and fluorescent intensity showed linearity in the range 0-1000 pg/mL and 7 pg/mL, sensitivity lower than 11.2 pg/mL. This result revealed that the FMI system was more sensitive than enzyme-linked immunoassay (ELISA). Additionally, the FMI system used smaller sample volumes compared to ELISA. Conclusions: We measured CSTB with both the FMI and an ELISA procedure and compared the two methods. The CSTB concentrations in serum specimens as measured with the FMI assay system were similar to those measured with ELISA. Thus, the new FMI using the Bio-Plex system may be useful for detection of CSTB in human serum. [ABSTRACT FROM AUTHOR]

Background: Anti-cyclic citrullinated peptide (CCP) antibody is emerging as an important diagnostic marker for rheumatoid arthritis (RA). We evaluated the analytical and diagnostic performance of the ARCHITECT anti-CCP (Abbott Diagnostics), a new fully automated chemiluminescent microparticle immunoassay. Methods: Serum samples from 69 patients with RA and 86 non-RA patients were used to evaluate the performance of the ARCHITECT anti-CCP assay, and the results were compared with those of EliA CCP (Phadia). The optimal cut-off value was calculated using receiver operating characteristic (ROC) curve analysis. Results: Within-run and total imprecision (%CV) of the ARCHITECT anti-CCP were <6% and good linearity was observed over the claimed range. The areas under the ROC curves for the ARCHITECT anti-CCP and EliA CCP were 0.90 and 0.89, respectively. The sensitivity and specificity were 76.8% and 95.3% for the ARCHITECT anti-CCP and 78.3% and 95.3% for EliA CCP using the manufacturer's cut-off thresholds. Both assays showed sensitivity of 84.1% and specificity of 94.2% using the optimal cut-off values. Conclusions: The analytical performance of the ARCHITECT anti-CCP was satisfactory and diagnostic performance was comparable to that of EliA CCP. The use of optimal cut-off thresholds can yield higher sensitivity with minimal loss of specificity. Clin Chem Lab Med 2010;48:225–30. [ABSTRACT FROM AUTHOR]

A letter to the editor is presented in response to the article "Prospective validation of an immunohistochemical panel (glypican 3, heat shock protein 70 and glutamine synthetase) in liver biopsies for diagnosis of very early hepatocellular carcinoma," by S. Tremosini in a 2012 issue of the journal.