Search

Introduction: the judicialization of health is an alternative to the health services in Brazil, despite criticism of judicial decisions and control of public health policy. The large number of actions that demand health services is a health problem that characterizes the political, social, ethical, legal, and health systems of the Public Health Policy. Objective: to analyze the judicialization of health care in the Acre State, Brazil, from 2010 to 2016. Methods: it is a documentary and cross-sectional study of collegiate decisions, with final judgments, in the period from 2010 to 2016, issued by the Court of Justice of the State of Acre, Results: all proposed actions were Writ of Mandamus. The use of preliminary injunction was the most common strategy (n = 34; 94.44%). One third of the respondents were not questioned by the State of Acre (n = 9; 25%) as decisions of the Court of Justice on health concern medicines, examinations, and procedures, in these cases, it only manages interests, with no litigation per se. (n = 25, 69.44%). Men and women demanded in the same proportion, all of them characterized by living in poverty (n = 28; 77.78%). Conclusion: the collective health decisions handed down by the State Court of Justice Acre, Brazil, guarantee access to health goods and services to the claimants, with emphasis on preliminary injunctions and grounds based on the principle of human dignity, physical integrity and life, and on medical prescriptions in each specific case and, in a third of the cases, serving as a mere administration of interests. [ABSTRACT FROM AUTHOR]

Columbiformes have a worldwide distribution, of which 166 species occur in Eurasia. They have been reported parasitized by coccidians recurrently in recent years; however, Eimeria labbeana (Labbé, 1896) Pinto, 1928, which is first Eimeria sp. from Columbiformes described in the late nineteenth century, is not taxonomically identified by its oocysts since the 1930s. In this context, the current study aimed to supplement the morphology of E. labbeana from Eurasian collared doves Streptopelia decaocto Frivaldszky, 1838 and from a common woodpigeon Columba palumbus Linnaeus, 1758 in Portugal, providing a preliminary genotypic characterization. Three of the four columbiforms were positive for oocysts identified as E. labbeana, which were morphologically revised as having micropyles, in addition to other minor adjustments. Oocysts from S. decaocto and C. palumbus were morphologically identical and equivalent in all morphometric aspects, besides having genotypic similarity of 99.5%. Phylogenetic analysis based on the mitochondrial cytochrome c oxidase subunit 1 gene resulted in a large clade with Eimeria spp. and Isospora spp. from different vertebrates and low similarity between Eimeria spp. from Columbiformes, whereas the phylogenetic analysis based on the small subunit ribosomal RNA gene resulted in well-supported monophyletic groups, including one with the coccidians of columbiform birds. [ABSTRACT FROM AUTHOR]

The marine flora of Panama harbors a rich diversity of green, red and brown algae, and despite chronic understudy, it is reported as the second most diverse marine flora along the Pacific Central American coast, with 174 macroalgal species. Extensive new collections and molecular assisted identification (MAI) by an international team of researchers has revealed an even greater diversity for this country. Here, the intertidal and shallow subtidal marine flora of the remote Burica Peninsula is introduced. This area is characterized by an uplifted extensive intertidal flat composed of firm, sedimentary benthos known as mudrock, on which abundant algal communities thrive, even during extended periods of exposure. A collection of nearly 200 brown, green and red macroalgae specimens representing the first marine floristic inventory of this region was made in January 2011 and results of analyses of 45 foliose red algae specimens are presented. DNA sequence data for several loci (rbcL-3P; COI-5P; UPA) have been generated for molecular assisted identification and to guide morphological assessments. Twenty-six species were identified among the specimens including 21 new Pacific Panama records, as well as previously unrealized transisthmian distributions, and two new species, Neorubra parvolacertoides sp. nov. and Grateloupia irregularis sp. nov. [ABSTRACT FROM AUTHOR]

Electrospray ionization mass spectrometry has become invaluable in the characterization of macromolecular biological systems such as nucleic acids and proteins. Recent advances in the field of mass spectrometry and the soft conditions characteristic of electrospray ionization allow for the investigation of non-covalent interactions among large biomolecules and ligands. Modulation of genetic processes through the use of small molecule inhibitors with the DNA minor groove is gaining attention as a potential therapeutic approach. In this review, we discuss the development of a competition method using electrospray ionization mass spectrometry to probe the interactions of multiple DNA sequences with libraries of minor groove binding molecules. Such an approach acts as a high-throughput screening method to determine important information including the stoichiometry, binding mode, cooperativity, and relative binding affinity. In addition to small molecule-DNA complexes, we highlight other applications in which competition mass spectrometry has been used. A competitive approach to simultaneously investigate complex interactions promises to be a powerful tool in the discovery of small molecule inhibitors with high specificity and for specific, important DNA sequences. [ABSTRACT FROM AUTHOR]

Hairpin nucleic acids are frequently used in physical studies due to their greater thermal stability compared to their equivalent duplex structures. They are also good models for more complex loop-containing structures such as quadruplexes, i-motifs, cruciforms, and molecular beacons. Although a connecting loop can increase stability, there is little information on how the loop influences the interactions of small molecules with attached base-paired nucleic acid regions. In this study, the effects of different hairpin loops on the interactions of A/T specific DNA minor groove binding agents with a common stem sequence have been investigated by spectroscopic and surface plasmon resonance (SPR) biosensor methods. The results indicate that the hairpin loop has little influence on the specific site interactions on the stem but significantly affects nonspecific binding. The use of a non-nucleotide loop (with a reduced negative charge) not only enhances the thermal stability of the hairpin but also reduces the nonspecific binding at the loop without compromising the primary binding affinity on the stem. [ABSTRACT FROM AUTHOR]

AbstractBackground:Burn cellulitis is an infection of the unburned skin at the margin of a burn wound or graft donor site, typically caused by group A β-hemolytic streptococci and Staphylococcus aureus. β-Lactam antibiotics exhibit time-dependent killing and, because of their narrow spectrum, minimize bacterial resistance. We therefore use continuous-infusion oxacillin in the treatment of burn cellulitis.Methods:Patients at a regional burn center who were treated for burn cellulitis from January 2003 to December 2005 were included. Charts were reviewed for all pertinent data regarding the antibiotic treatment methods and outcomes. Successful treatment was defined as resolution of physical findings, fever, and leukocytosis and intravenous antibiotic cessation.Results:Thirty-seven patients were treated for burn cellulitis, 26 (70) of whom were treated initially with continuous-infusion oxacillin. Other initial antibiotics were chosen because of concomitant infections, penicillin allergy, or development of cellulitis during treatment with a β-lactam antibiotic. Oxacillin treatment was successful in 19 patients (73). Success required an average of 5.16 days, with 1.53 days required for fever resolution and 0.89 days for resolution of leukocytosis. Seven patients who did not respond rapidly were switched to intravenous vancomycin an average of 2.4 days after starting oxacillin, leading to a 100 success rate. There were no deaths, and only one suspected case of allergic reaction to oxacillin. In eleven patients treated with other antibiotics, the success rate was 75. Success with these drugs required a longer treatment course of 6.45 days. Leukocytosis resolved significantly more slowly at 4.45 days (p 0.02), and fever resolution was also slower at 3.18 days.Conclusions:Continuous-infusion oxacillin was successful in the treatment of 73 of patients, a success rate that might have been higher with clinical patience, and leukocytosis resolved faster than with other antibiotics. Failure of continuous-infusion oxacillin can be managed without clinical consequence by conversion to intravenous vancomycin. [ABSTRACT FROM AUTHOR]

Accurate knowledge of distribution and population size is required for effective conservation and management of wild species. Here we report on the first estimates of the distribution and density of the green python (Morelia viridis), an iconic rainforest species widely kept in captivity. We used climatic modelling to predict its distribution in Papua New Guinea, and both climate and vegetation mapping to predict its Australian distribution. We used mark?recapture methods to estimate the density and population structure of green pythons at Iron Range, northern Australia. Bioclimatic analyses suggested that there is extensive climatically suitable habitat in Papua New Guinea (?200000 km2), but very little in Australia (~300 km2). However, use of vegetation maps increases the predicted suitable area of occupancy in Australia to 3127 km2, including nine regional ecosystems. Density estimates at Iron Range were 4?5 ha?1 in the complex vine forest regional ecosystem; however, only half of these were mature adults. The large predicted area of occurrence and the high density in the one intensively studied area suggest that the species is not vulnerable to extinction in the short term. However, more studies are needed in both New Guinea and Australia, especially to quantify the impact of harvesting green pythons for the pet trade. [ABSTRACT FROM AUTHOR]

Large tissue damage or wounds cause serious comorbidities and represent a major burden for patients, families, and health systems. Due to the pivotal role of immune cells in the proper resolution of inflammation and tissue repair, we focus our current study on the interaction of macrophages with skin cells, and specifically on the effects of CD163 gene induction in macrophages in wound healing. We hypothesize that the over-expression of the scavenger receptor gene CD163 in human macrophages would result in a more efficient wound healing process. Using 3D human wounded skin organotypic tissues, we observed that CD163 overexpression in THP-1 and human primary macrophages induced a more efficient re-epithelization when compared to control cells. Using human primary skin cells and an in vitro scratch assay we observed that CD163 overexpression in THP-1 macrophages promoted a more rapid and efficient wound healing process through a unique interaction with fibroblasts. The addition of CD163-blocking antibody, but not isotype control, blocked the efficient wound healing process induced by CD163 overexpression in macrophages. We found that the co-culture of skin cells and CD163 overexpressing macrophages reduced monocyte chemoattractant protein (MCP)-1 and enhanced tumor growth factor (TGF)-α, without altering interleukin (IL)-6 or TGF-β. Our findings show that CD163 induces a more efficient wound healing and seems to promote a wound milieu with a pro-resolution molecular profile. Our studies set the foundation to study this approach in in vivo clinically relevant settings to test its effects in wound healing processes such as acute major injuries, large surgeries, or chronic ulcers. [ABSTRACT FROM AUTHOR]

The ability of ticks to adapt to different ecological zones, coupled with the spread of infectious pathogens negatively affects livestock production and thus, there is a need for better control strategies. However, control measures within a geographical region can only be effective if there is available information on tick population dynamics and ecology. This study focused on ticks infesting livestock in the Kassena-Nankana Districts of the Upper East Region of Ghana. The ticks were morphologically identified, variables such as season, animal host, and predilection sites were recorded, and the data were analyzed using STATA version 13. Out of 448 livestock examined, tick infestation in cattle was (78.60%), followed by sheep (25%) and goats (5.88%). A total of 1,550 ticks including nymphs (303) and adults (1,247) were collected. Adult ticks were found to be significantly associated with season (p < 0.001), with a high burden in the wet season. The nymph burden and body parts of livestock hosts were significantly associated with more nymphs collected from male animals than females (p < 0.001). Three genera of ticks, Amblyomma (62.97%), Hyalomma (18.71%), and Rhipicephalus (18.32%) were morphologically identified with the most predominant tick species recorded as Amblyomma variegatum (62.97%). Matured A. variegatum was sampled primarily in the wet season with their predilection site as the udder/scrotum (p < 0.001). However, adult Hyalomma truncatum was observed to have a significant association with the anal region (p < 0.001). Findings from this study are essential for formulating tick control measures to prevent the spread of infectious pathogens. [ABSTRACT FROM AUTHOR]

Delayed‐onset muscle soreness (DOMS) is a very common condition in athletes and individuals not accustomed to physical activity that occurs after moderate/high‐intensity exercise sessions. The activation of microglial Toll‐like receptor 4 (TLR4) in the spinal cord has been described to be important for the induction and maintenance of persistent pain. Based on that, we hypothesize that 70 kilodalton heat‐shock protein (Hsp70), a mediator released by exercise, could activate microglial TLR4 in the spinal cord, releasing proinflammatory cytokines and contributing to the start of DOMS. In fact, we found that the knockout of TLR4, myeloid differentiation primary response 88 (MyD88), interleukin‐6 (IL‐6), or both tumor necrosis factor‐α (TNF‐α) receptor 1 and TNF‐α receptor 2 in mice prevented the development of DOMS following acute aerobic exercise in contrast to the findings in male C57BL/6 wild‐type mice. Furthermore, DOMS in exercised wild‐type mice was also prevented after pre‐treatment with microglia inhibitor, TLR4 antagonist, and anti‐Hsp70 antibody. During exercise‐induced DOMS, Hsp70 mRNA, TLR4 mRNA, and protein levels, as well as Iba‐1 (a microglial marker), IL‐6, and TNF‐α protein levels, were increased in the muscle and/or spinal cord. Together, these findings suggest that Hsp70 released during exercise‐induced DOMS activates the microglial TLR4/IL‐6/TNF‐α pathway in the spinal cord. Thus, the blockade of TLR4 activation may be a new strategy to prevent the development of DOMS before intense exercise. [ABSTRACT FROM AUTHOR]

The leaves of traditionally used herbal plant Tridax procumbens L. contain lots of phytochemicals having potency to reduce inflammation. In this study, the ethanol extract of the leaves of Tridax procumbens L. was analysed for the phytochemicals by GC–MS. The anti-inflammatory activity was then studied with the extract of 10, 50, and 100 mg/kg b.wt in carrageenan-induced mice model by measuring the inflammatory oedema and by analysing the histopathology. The mRNA expression levels of TNF-α and COX2 genes were studied in the inflammatory site to explore the molecular action by reverse transcription PCR and qPCR analyses. A significant (P ≤ 0.01) reduction in mice paw inflammation and a recovered histology were observed in treated groups when compared to control group in 24 h. The RT-PCR results showed a significant (P ≤ 0.01) decrease in the expression levels of TNF-α and COX2 in terms of band density in treated mice compared to control group. The qPCR RQ values also were decreased in treated groups with respect to increasing doses (RQ values of 18.985 ± 0.230, 12.140 ± 1.121, 6.718 ± 0.807 for TNF-α and 15.583 ± 1.043, 7.725 ± 1.013, 5.075 ± 0.615 for COX2, respectively for the three doses) in comparison with the control group (TNF-α 27.107 ± 2.254, COX2 20.626 ± 1.477). Tridax procumbens L. can be, thus, used for the development of a safe, natural, anti-inflammatory drug as it showed a strong inhibitory action on inflammation by acting at molecular level. [ABSTRACT FROM AUTHOR]

Identification of Cladophora species is challenging due to conservation of gross morphology, few discrete autapomorphies, and environmental influences on morphology. Twelve species of marine Cladophora were reported from North Carolina waters. Cladophora specimens were collected from inshore and offshore marine waters for DNA sequence and morphological analyses. The nuclearencoded rRNA internal transcribed spacer regions (ITS) were sequenced for 105 specimens and used in molecular assisted identification. The ITS1 and ITS2 region was highly variable, and sequences were sorted into ITS Sets of Alignable Sequences (SASs). Sequencing of short hyper-variable ITS1 sections from Cladophora type specimens was used to positively identify species represented by SASs when the types were made available. Secondary structures for the ITS1 locus were also predicted for each specimen and compared to predicted structures from Cladophora sequences available in GenBank. Nine ITS SASs were identified and representative specimens chosen for phylogenetic analyses of 18S and 28S rRNA gene sequences to reveal relationships with other Cladophora species. Phylogenetic analyses indicated that marine Cladophorales were polyphyletic and separated into two clades, the Cladophora clade and the "Siphonocladales" clade. Morphological analyses were performed to assess the consistency of character states within species, and complement the DNA sequence analyses. These analyses revealed intra- and interspecific character state variation, and that combined molecular and morphological analyses were required for the identification of species. One new report, Cladophora dotyana, and one new species Cladophora subtilissima sp. nov., were revealed, and increased the biodiversity of North Carolina marine Cladophora to 14 species. [ABSTRACT FROM AUTHOR]

Macrophages orchestrate the initiation and resolution of inflammation by producing pro- and anti-inflammatory products. An imbalance in these mediators may originate from a deficient or excessive immune response. Therefore, macrophages are valid therapeutic targets to restore homeostasis under inflammatory conditions. We hypothesize that a specific mannosylated nanoparticle effectively induces gene expression in human macrophages under inflammatory conditions without undesirable immunogenic responses. THP-1 macrophages were challenged with lipopolysaccharide (LPS, 5 μg/mL). Polyethylenimine (PEI) nanoparticles grafted with a mannose receptor ligand (Man-PEI) were used as a gene delivery method. Nanoparticle toxicity, Man-PEI cellular uptake rate and gene induction efficiency (GFP, CD14 or CD68) were studied. Potential immunogenic responses were evaluated by measuring the production of tumor necrosis factor-alpha (TNF-α), Interleukin (IL)-6 and IL-10. Man-PEI did not produce cytotoxicity, and it was effectively up-taken by THP-1 macrophages (69%). This approach produced a significant expression of GFP (mRNA and protein), CD14 and CD68 (mRNA), and transiently and mildly reduced IL-6 and IL-10 levels in LPS-challenged macrophages. Our results indicate that Man-PEI is suitable for inducing an efficient gene overexpression in human macrophages under inflammatory conditions with limited immunogenic responses. Our promising results set the foundation to test this technology to induce functional anti-inflammatory genes. [ABSTRACT FROM AUTHOR]

A new species of palm-pitviper of the genus Bothriechis is described from Refugio de Vida Silvestre Texíguat in northern Honduras. The new species differs from congeners by having 19 dorsal scale rows at midbody, a bright green dorsal coloration in adults, the prelacunal scale fused to the second supralabial, and in representing a northern lineage that is sister to B. lateralis, which is distributed in Costa Rica and western Panama and is isolated from the new taxon by the Nicaraguan Depression. This represents the 15th endemic species occurring in Refugio de Vida Silvestre Texíguat, one of the richest herpetofaunal sites in Honduras, itself being the country with the highest degree of herpetofaunal endemism in Central America. We name this new species in honor of a Honduran conservationist slain in fighting against illegal logging, highlighting the sacrifices of rural activists in battling these issues and the critical importance of conservation in these areas. [ABSTRACT FROM AUTHOR]

Targeting the minor groove of DNA through binding to a small molecule has long been considered an important molecular-recognition strategy in biology. A wide range of synthetic heterocyclic molecules bind noncovalently in the minor groove of the double helix and are also effective against a number of human and animal diseases. A classic structural concept, the isohelicity principle, has guided much of this work: such heterocyclic molecules require a shape that complements the convex surface of the minor groove. Researchers have used this principle to design molecules that can read DNA sequences. This principle also predicts that molecules that lack the complementary shape requirement would only bind weakly to DNA. Recently, however, researchers have unexpectedly found that some essentially linear compounds, which do not have this feature, can have high DNA affinity. [ABSTRACT FROM AUTHOR]

Previous NMR studies of Hoechst 33258 with the d(CTTTTGCAAAAG) 2sequence have shown very strong ( K2≫ K1) cooperativity between two adjacent binding sites ( Searle, M. S.; Embrey, K. J.Nucleic Acids Res.1990, 18( 13), 3753− 3762). In contrast, surface plasmon resonance (SPR) results with the hairpin analog of the same sequence show significantly reduced cooperativity. In an effort to explain the difference, two-dimensional (2-D) NMR experiments were done on both duplex and hairpin. Hoechst 33258 and an amidine analog, DB183, show very strong cooperativity with the duplex DNA but much weaker cooperativity with the hairpin. The significantly lower thermal melting temperature ( Tm) of the duplex (34.8 °C) in comparison to its hairpin analog (62.3 °C) supports the idea of a dynamic difference between the two DNA structures that can influence cooperativity in binding. These results confirm the role of conformational entropy in positive cooperativity in some DNA interactions. [ABSTRACT FROM AUTHOR]

The classification of Cystoclonium obtusangulum has been questioned since the species was first described by Hooker and Harvey as Gracilaria? obtusangula. The objective of this study was to provide the first comprehensive taxonomic analysis of Cystoclonium obtusangulum, based on DNA sequences coupled with morphological observations made on syntype specimens and new collections. Sequence divergences of rbcL, UPA, and COI‐5P, and maximum‐likelihood phylogenies for rbcL and 18S demonstrated that specimens identified as Cystoclonium obtusangulum represent a clade of two distinct species that are distantly related to the generitype Cystoclonium purpureum. A new genus, Meridionella gen. nov., is proposed for this clade. The two species placed in this new genus were morphologically indistinguishable cryptic species, but have disjunct distributions, with Meridionella obtusangula comb. nov. found from temperate to cold coasts of South America and the Falkland Islands and Meridionella antarctica sp. nov., occurring in Antarctic waters. Vegetative and reproductive characters of Meridionella gen. nov. are described, and implications of our results for the biogeography of the family Cystocloniaceae are discussed. [ABSTRACT FROM AUTHOR]

The article information on the geographical distribution of lizard specie Hemidactylus mabouia which was found near Tamaulipas, Mexico.

Lobophora is a common tropical to temperate genus of brown algae found in a plethora of habitats including shallow and deep-water coral reefs, rocky shores, mangroves, seagrass beds, and rhodoliths beds. Recent molecular studies have revealed that Lobophora species diversity has been severely underestimated. Current estimates of the species numbers range from100 to 140 species with a suggested center of diversity in the Central Indo-Pacific. This study used three molecular markers (cox3, rbcL, psbA), different single-marker species delimitation methods (GMYC, ABGD, PTP), and morphological evidence to evaluate Lobophora species diversity in theWestern Atlantic and the Eastern Pacific oceans. Cox3 provided the greatest number of primary species hypotheses(PSH), followed by rbcL and then psbA. GMYC species delimitation analysis was the most conservative across all three markers, followed by PTP, and then ABGD. The most informative diagnostic morphological characters were thallus thickness and number of cell layers in both the medulla and the dorsal/ventral cortices. Following a consensus approach, 14 distinct Lobophora species were identified in the Western Atlantic and five in the Eastern Pacific. Eight new species from these two oceans were herein described: L. adpressa sp. nov., L. cocoensis sp. nov., L. colombiana sp. nov., L. crispata sp. nov., L. delicata sp. nov., L. dispersa sp. nov., L. panamensis sp. nov., and L. tortugensis sp. nov. This study showed that the best approach to confidently identify Lobophora species is to analyze DNA sequences (preferably cox3 and rbcL) followed by comparative morphological and geographical assessment. [ABSTRACT FROM AUTHOR]

Skillful communication with attention to patient and care partner priorities can help people with serious illnesses. Few patient-facing agenda-setting tools exist to facilitate such communication. To develop a tool to facilitate prioritization of patient and care partner concerns during serious illness visits. Two family members of seriously ill individuals advised. We performed a literature review and developed a prototype agenda-setting tool. We modified the tool based on cognitive interviews with patients, families and clinicians. We piloted the tool with patients, care partners and clinicians to gain an initial impression of its perceived value. Interviews with eight patients, eight care partners and seven clinicians, resulted in refinements to the initial tool, including supplementation with visual cues. In the pilot test, seven clinicians used the tool with 11 patients and 12 family members. Qualitatively, patients and care partners reported the guide helped them consider and assert their priorities. Clinicians reported the tool complemented usual practice. Most participants reported no distress, disruption or confusion. Patients, care partners and clinicians appreciated centering patient priorities in serious illness visits using the agenda-setting tool. More thorough evaluation is required. The agenda-setting tool may operationalize elements of good serious illness care. • The experience of serious illness is poor and often misaligned with patient priorities. • Good communication can help improve patient experiences. • With user-centered design, we made an agenda-setting tool so patients and clinicians could set shared discussion priorities. • Called Serious Illness Topics, patients found the agenda-setting tool empowering. • Clinicians found it acceptable and helpful. [ABSTRACT FROM AUTHOR]

M1 macrophages release proinflammatory factors during inflammation. They transit to an M2 phenotype and release anti-inflammatory factors to resolve inflammation. An imbalance in the transition from M1 to M2 phenotype in macrophages contributes to the development of persistent inflammation. CD163, a member of the scavenger receptor cysteine-rich family, is an M2 macrophage marker. The functional role of CD163 during the resolution of inflammation is not completely known. We postulate that CD163 contributes to the transition from M1 to M2 phenotype in macrophages. We induced CD163 gene in THP-1 and primary human macrophages using polyethylenimine nanoparticles grafted with a mannose ligand (Man-PEI). This nanoparticle specifically targets cells of monocytic origin via mannose receptors. Cells were challenged with a single or a double stimulation of lipopolysaccharide (LPS). A CD163 or empty plasmid was complexed with Man-PEI nanoparticles for cell transfections. Quantitative RT-PCR, immunocytochemistry, and ELISAs were used for molecular assessments. CD163-overexpressing macrophages displayed reduced levels of tumor necrosis factor-alpha (TNF)-α and monocytes chemoattractant protein (MCP)-1 after a single stimulation with LPS. Following a double stimulation paradigm, CD163-overexpressing macrophages showed an increase of interleukin (IL)-10 and IL-1ra and a reduction of MCP-1. This anti-inflammatory phenotype was partially blocked by an anti-CD163 antibody (effects on IL-10 and IL-1ra). A decrease in the release of TNF-α, IL-1β, and IL-6 was observed in CD163-overexpressing human primary macrophages. The release of IL-6 was blocked by an anti-CD163 antibody in the CD163-overexpressing group. Our data show that the induction of the CD163 gene in human macrophages under inflammatory conditions produces changes in cytokine secretion in favor of an anti-inflammatory phenotype. Targeting macrophages to induce CD163 using cell-directed nanotechnology is an attractive and practical approach for inflammatory conditions that could lead to persistent pain, i.e. major surgeries, burns, rheumatoid arthritis, etc. [ABSTRACT FROM AUTHOR]

New more selective and potent drugs are urgently need to treat Chagas disease (CD). Among the many synthetic compounds evaluated against Trypanosoma cruzi, aromatic amidines (AAs) and especially arylimidamides (AIAs) have potent activity against this parasite. Presently, the effect of four mono-amidines (DB2228, DB2229, DB2292 and DB2294), four diamidines (DB2232, DB2235, DB2251 and DB2253) and one AIA (DB2255) was screened in vitro against different forms (bloodstream trypomastigotes - BT and intracellular forms) and strains from discrete typing unit (DTU) I and VI of T. cruzi and their cytotoxic profile on mammalian host cells. Except for DB2253, all molecules were as active as benznidazole (Bz), resulting in 50% of reduction in the number of alive BT, with EC50 ranging from 2⋅7 to 10⋅1 µm after 24 h of incubation. DB2255 was also the most potent against amastigotes (Tulahuen strain) showing similar activity to that of Bz (3 µm). In silico absorption, distribution, metabolism, excretion and toxicity analysis demonstrated probability of human intestinal adsorption, while mutagenicity and inhibition of hERG1 were not predicted, besides giving acceptable predicted volumes of distribution. Our findings contribute for better knowledge regarding the biological effect of this class of aromatic molecules against T. cruzi aiming to identify novel promising agent for CD therapy. [ABSTRACT FROM AUTHOR]

DB1255 is a symmetrical diamidinophenyl-dithiophene that exhibits cellular activity by binding to DNA and inhibiting binding of ERG, an ETS family transcription factor that is commonly overexpressed or translocated In leukemia and prostate cancer [Nhili, R, Peixoto, P., Depauw, S., Flajollet, S.F Dezitter, X., Munde, M. M., Ismail, M. A, Kumar, A., Farahat, A. A, Stephens, C. E., Duterque-Coquillaud, M., Wilson, W. D., Boykin, D. W., and David-Cordonnier, M. H. (2013) Nucleic Acids Res. 41, 125-138]. Because transcription factor inhibition is complex but is an attractive area for anticancer and antiparasitic drug development, we have evaluated the DNA interactions of additional derivatives of DB1255 to gain an improved understanding of the biophysical chemistry of complex function and inhibition. DNase I footprinting, biosensor surface plasmon resonance, and circular dichroism experiments show that DB1255 has an unusual and strong monomer binding mode in minor groove sites that contain a single GC base pair flanked by AT base pairs, for example, 5'-ATGAT-3'. Closely related derivatives, such as compounds with the thiophene replaced with furan or selenophane, bind very weakly to GC-containing sequences and do not have biological activity. DB1255 is selective for the ATGAT site; however, a similar sequence, 5'-ATGAC-3', binds DB125S more weakly and does not produce a footprint. Molecular docking studies show that the two thiophene sulfur atoms form strong, bifurcated hydrogen bond-type interactions with the G-N-H sequence that extends into the minor groove while the amidines form hydrogen bonds to the flanking AT base pairs. The central dithiophene unit of DB1255 thus forms an excellent, but unexpected, single-GC base pair recognition module in a monomer minor groove complex. [ABSTRACT FROM AUTHOR]

The DNA sequence 5′-ACGCGT-3′ is in the core site of the Mlu 1 cell-cycle box, a transcriptional element in the promoter region of human Dbf4 gene that is highly correlated with a large number of aggressive solid cancers. The polyamide formamido-imidazole-pyrrole-imidazole-amine+ (f-Im-Py-Im-Am+) can target the minor groove of 5′-ACGCGT-3′ as an antiparallel stacked dimer and has shown good activity in inhibiting transcription factor binding. Recently, f-Im-Py-Im-Am+ derivatives that involve different orthogonally positioned substituents were synthesized to target the same binding site, and some of them have displayed improved binding and pharmacological properties. In this study, the gel electrophoresis-ligation ladders assay was used to evaluate the conformational effects of f-Im-Py-Im-Am+ and derivatives on the target DNA, an essential factor for establishing the molecular basis of polyamide-DNA complexes and their transcription factor inhibition. The results show that the ACGCGT site in DNA has a relatively wide minor groove and a B-form like overall structure. After binding with f-Im-Py-Im-Am+ derivatives, the DNA conformation is changed as indicated by the different mobilities in the gel. These conformational effects on DNA will at least help to point to the mechanism for the observed Mlu 1 inhibition activity of these polyamides. Therefore, modulating DNA transcription by locking the DNA shape or altering the minor groove geometry to affect the binding affinity of certain transcription factors is an attractive possible therapeutic mechanism for polyamides. Some of the substituents are charged with electrostatic interactions with DNA phosphate groups, and their charge effects on DNA gel mobility have been observed. Copyright © 2013 John Wiley & Sons, Ltd. [ABSTRACT FROM AUTHOR]

Abstract: Rules for polyamide–DNA recognition have proved invaluable for the design of sequence-selective DNA binding agents in cell-free systems. However, these rules are not fully transferrable to predicting activity in cells, tissues or animals, and additional refinements to our understanding of DNA recognition would help biomedical studies. Similar complexities are encountered when using internal β-alanines as polyamide building blocks in place of N-methylpyrrole; β-alanines were introduced in polyamide designs to maintain good hydrogen bonding registry with the target DNA, especially for long polyamides or those with several GC bp (P.B. Dervan, A.R. Urbach, Essays Contemp. Chem. (2001) 327–339). Thus, to clarify important subtleties of molecular recognition, we studied the effects of replacing a single pyrrole with β-alanine in 8-ring polyamides designed against the Ets-1 transcription factor. Replacement of a single internal N-methylpyrrole with β-alanine to generate a β/Im pairing in two 8-ring polyamides causes a decrease in DNA binding affinity by two orders of magnitude and decreases DNA binding selectivity, contrary to expectations based on the literature. Measurements were made by fluorescence spectroscopy, quantitative DNA footprinting and surface plasmon resonance, with these vastly different techniques showing excellent agreement. Furthermore, results were validated for a range of DNA substrates from small hairpins to long dsDNA sequences. Docking studies helped show that β-alanine does not make efficient hydrophobic contacts with the rest of the polyamide or nearby DNA, in contrast to pyrrole. These results help refine design principles and expectations for polyamide–DNA recognition. [Copyright &y& Elsevier]

Abstract: A novel diamino/dicationic polyamide f-Im ∗ PyIm (5) that contains an orthogonally positioned aminopropyl chain on an imidazole (Im ∗ ) moiety was designed to target 5′-ACGCGT-3′. The DNA binding properties of the diamino polyamide 5, determined by CD, ΔTM, DNase I footprinting, SPR, and ITC studies, were compared with those of its monoamino/monocationic counterpart f-ImPyIm (1) and its diamino/dicationic isomer f-ImPy ∗ Im (2), which has the aminopropyl group attached to the central pyrrole unit (Py ∗ ). The results gave evidence for the minor groove binding and selectivity of polyamide 5 for the cognate sequence 5′-ACGCGT-3′, and with strong affinity (K eq =2.3 × 107 M−1). However, the binding affinities varied according to the order: f-ImPy ∗ Im (2)>f-ImPyIm (1)⩾f-Im ∗ PyIm (5) confirming that the second amino group can improve affinity, but its position within the polyamide can affect affinity. [Copyright &y& Elsevier]

Abstract: Pyrrole- and imidazole-containing polyamides are widely investigated as DNA sequence selective binding agents that have potential use as gene control agents. The key challenges that must be overcome to realize this goal is the development of polyamides with low molar mass so the molecules can readily diffuse into cells and concentrate in the nucleus. In addition, the molecules must have appreciable water solubility, bind DNA sequence specifically, and with high affinity. It is on this basis that the orthogonally positioned diamino/dicationic polyamide Ph-ImPy*Im 5 was designed to target the sequence 5′-ACGCGT-3′. Py* denotes the pyrrole unit that contains a N-substituted aminopropyl pendant group. The DNA binding properties of diamino polyamide 5 were determined using a number of techniques including CD, ΔT M, DNase I footprinting, SPR and ITC studies. The effects of the second amino moiety in Py* on DNA binding affinity over its monoamino counterpart Ph-ImPyIm 3 were assessed by conducting DNA binding studies of 3 in parallel with 5. The results confirmed the minor groove binding and selectivity of both polyamides for the cognate sequence 5′-ACGCGT-3′. The diamino/dicationic polyamide 5 showed enhanced binding affinity and higher solubility in aqueous media over its monoamino/monocationic counterpart Ph-ImPyIm 3. The binding constant of 5, determined from SPR studies, was found to be 1.5×107 M−1, which is ∼3 times higher than that for its monoamino analog 3 (4.8×106 M−1). The affinity of 5 is now approaching that of the parent compound f-ImPyIm 1 and its diamino equivalent 4. The advantages of the design of diamino polyamide 5 over 1 and 4 are its sequence specificity and the ease of synthesis compared to the N-terminus pyrrole analog 2. [Copyright &y& Elsevier]

Abstract: Background: Recent data from Ghana indicates that after seven rounds of annual mass drug administration (MDA) there is still sustained transmission albeit at low levels in certain areas where Anopheles melas, An. gambiae s.s., Mansonia and Culex species are the main biting mosquitoes. Anopheles gambiae s.l. and An. funestus are the known vectors in Ghana and a recent report indicated that An. melas could transmit at low level microfilaraemia. However, because An. melas is not found everywhere there was the need to determine whether any of the other culicine species could also be playing a role in the transmission of LF. Methods: Indoor mosquitoes collected once a month for three months using pyrethrum spray catches in six communities within the Kommenda-Edina-Eguafo-Abirem (KEEA) District, Central Region of Ghana were morphologically identified, dissected and examined for the presence of W. bancrofti. Additionally, stored mosquito samples collected during previous years in 8 communities from the Gomoa District also in the Central Region were similarly processed. The identities of all W. bancrofti parasites found were confirmed using an established PCR method. Results: A total of 825 indoor resting mosquitoes comprising of 501 Anopheles species, 239 Mansonia species, 84 Culex species and 1 Aedes species were dissected and examined for the presence of W. bancrofti. Mansonia africana had infection and infectivity rates of 2.5%. and 2.1% respectively. Anopheles gambiae s.l. had an infection rate of 0.4% and a similar infectivity rate. None of the Culex sp. and Aedes sp were found with infection. From the stored mosquitoes the infection and infectivity rates for M. africana were 7.6% (N = 144) and 2.8% respectively whilst the corresponding rates for M. uniformis were 2.9% (N = 244) and 0.8%. Conclusions: This is the first report of Mansonia species as vectors of lymphatic filariasis (LF) in Ghana and in West Africa since that of 1958 in Guinea. The revelation of a hitherto unrecognised vector which is possibly more efficient in transmission than the recognised ones has a profound implication for elimination of lymphatic filariasis programmes in the sub-region [ABSTRACT FROM AUTHOR]

Abstract: A new series of fourteen dicationic flexible triaryl bis-guanidines 3a,b, bis-N-substituted guanidines 7a,b and 8a,b as well as bis-imidamides 9–12a,b having a 1,3- or 1,4-diphenoxybenzene scaffold backbone were synthesized. The in vitro activity of the novel dications as antiprotozoal agents against Trypanosoma brucei rhodesiense (T.b.r.) and Plasmodium falciparum (P.f.) was assessed. Interestingly, six of the newly synthesized dications viz 3a,b, 7a,b and 8a,b were more active against P.f. than the reference drug pentamidine. Also, some of the dications showed moderate antitrypanosomal activity. Thermal melting analysis of the novel dications was performed to determine their ligand-DNA relative binding affinities. Finally, docking of the dications with an AT rich DNA oligonucleotide was executed to understand their binding mode with the minor groove. [Copyright &y& Elsevier]

With the aim of incorporating a recognition element that acts as a fluorescent probe upon binding to DNA, three novel pyrrole (P) and imidazole (I)-containing polyamides were synthesized. The compounds contain a p-anisylbenzimidazolecarboxamido (Hx) moiety attached to a PP, IP, or PI unit, giving compounds HxPP (2), HxIP (3), and HxPI (4), respectively. These fluorescent hybrids were tested against their complementary nonfluorescent, non-formamido tetraamide counterparts, namely, PPPP (5), PPIP (6), and PPPI (7) (cognate sequences 5'-AAATTT-3', 5'-ATCGAT-3', and 5'-ACATGT-3', respectively). The binding affinities for both series of polyamides for their cognate and noncognate sequences were ascertained by surface plasmon resonance (SPR) studies, which revealed that the Hx-containing polyamides gave binding constants in the 106 M-1 range while little binding was observed for the noncognates. The binding data were further compared to the corresponding and previously reported formamido-triamides f-PPP (8), f-PIP (9), and f-PPI (10). DNase I footprinting studies provided additional evidence that the Hx moiety behaved similarly to two consecutive pyrroles (PP found in 5-7), which also behaved like a formamido-pyrrole (f-P) unit found in distamycin and many formamido-triamides, including 8-10. The biophysical characterization of polyamides 2-7 on their binding to the abovementioned DNA sequences was determined using thermal melts (ΔTM), circular dichroism (CD), and isothermal titration calorimetry (ITC) studies. Density functional calculations (B3LYP) provided a theoretical framework that explains the similarity between PP and Hx on the basis of molecular electrostatic surfaces and dipole moments. Furthermore, emission studies on polyamides 2 and 3 showed that upon excitation at 322 nm binding to their respective cognate sequences resulted in an increase in fluorescence at 370 nm. These low molecular weight polyamides show promise for use as probes for monitoring DNA recognition processes in cells. [ABSTRACT FROM AUTHOR]

This article discusses the first record of Ficimia publia, a species of snake (Squamata: Colubridae), in Michoacán, Mexico. The authors comment on the distribution of Ficimia publia throughout the region as well as its range. A map detailing its distribution and range in Michoacán, Jalisco, Guerrero, and Morelos is also presented.

Norepinephrine (NE) amplifies the strength of descending pain inhibition, giving inhibitors of spinal NET clinical utility in the management of pain. χ-MrIA isolated from the venom of a predatory marine snail noncompetitively inhibits NET and reverses allodynia in rat models of neuropathic pain. An analogue of χ-MrIA has been found to be a suitable drug candidate. On the basis of the NMR solution structure of this related peptide, Xen2174 (3), and structure−activity relationships of analogues, a pharmacophore model for the allosteric binding of 3to NET is proposed. It is shown that 3interacts with NET predominantly through amino acids in the first loop, forming a tight inverse turn presenting amino acids Tyr7, Lys8, and Leu9 in an orientation allowing for high affinity interaction with NET. The second loop interacts with a large hydrophobic pocket within the transporter. Analogues based on the pharmacophore demonstrated activities that support the proposed model. On the basis of improved chemical stability and a wide therapeutic index, 3was selected for further development and is currently in phase II clinical trials. [ABSTRACT FROM AUTHOR]

The design and synthesis of a series of urea-based nonpolycyclic aromatic ligands with alkylaminoanilino side chains as telomeric and genomic G-quadruplex DNA interacting agents are described. Their interactions with quadruplexes have been examined by means of fluorescent resonance energy transfer melting, circular dichroism, and surface plasmon resonance-based assays. These validate the design concept for such urea-based ligands and also show that they have significant selectivity over duplex DNA, as well as for particular G-quadruplexes. The ligand−quadruplex complexes were investigated by computational molecular modeling, providing further information on structure−activity relationships. Preliminary biological studies using short-term cell growth inhibition assays show that some of the ligands have cancer cell selectivity, although they appear to have low potency for intracellular telomeric G-quadruplex structures, suggesting that their cellular targets may be other, possibly oncogene-related quadruplexes. [ABSTRACT FROM AUTHOR]

Abstract: Imidazole (Im) and Pyrrole (Py)-containing polyamides that can form stacked dimers can be programmed to target specific sequences in the minor groove of DNA and control gene expression. Even though various designs of polyamides have been thoroughly investigated for DNA sequence recognition, the use of H-pin polyamides (covalently cross-linked polyamides) has not received as much attention. Therefore, experiments were designed to systematically investigate the DNA recognition properties of two symmetrical H-pin polyamides composed of PyImPyIm (5) or f-ImPyIm (3e, f=formamido) tethered with an ethylene glycol linker. These compounds were created to recognize the cognate 5′-ACGCGT-3′ through an overlapped and staggered binding motif, respectively. Results from DNaseI footprinting, thermal denaturation, circular dichroism, surface plasmon resonance and isothermal titration microcalorimetry studies demonstrated that both H-pin polyamides bound with higher affinity than their respective monomers. The binding affinity of formamido-containing H-pin 3e was more than a hundred times greater than that for the tetraamide H-pin 5, demonstrating the importance of having a formamido group and the staggered motif in enhancing affinity. However, compared to H-pin 3e, tetraamide H-pin 5 demonstrated superior binding preference for the cognate sequence over its non-cognates, ACCGGT and AAATTT. Data from SPR experiments yielded binding constants of 1.6×108 M−1 and 2.0×1010 M−1 for PyImPyIm H-pin 5 and f-ImPyIm H-pin 3e, respectively. Both H-pins bound with significantly higher affinity (ca. 100-fold) than their corresponding unlinked PyImPyIm 4 and f-ImPyIm 2 counterparts. ITC analyses revealed modest enthalpies of reactions at 298K (ΔH of −3.3 and −1.0kcalmol−1 for 5 and 3e, respectively), indicating these were entropic-driven interactions. The heat capacities (ΔC p) were determined to be −116 and −499calmol−1 K−1, respectively. These results are in general agreement with ΔC p values determined from changes in the solvent accessible surface areas using complexes of the H-pins bound to (5′-CCACGCGTGG)2. According to the models, the H-pins fit snugly in the minor groove and the linker comfortably holds both polyamide portions in place, with the oxygen atoms pointing into the solvent. In summary, the H-pin polyamide provides an important molecular design motif for the discovery of future generations of programmable small molecules capable of binding to target DNA sequences with high affinity and selectivity. [Copyright &y& Elsevier]

Given the increasing significance of diamidines as DNA-targeted therapeutics and biotechnology reagents, it is important to establish the variations in thermodynamic quantities that characterize the interactions of closely related compounds to different sequence AT binding sites. In this study, an array of methods including biosensor-surface plasmon resonance (SPR), isothermal titration microcalorimetry (ITC), circular dichroism (CD), thermal melting (Tm) and molecular modeling have been used to characterize the binding of dicationic diamidines related to DB75 (amidine−phenyl−furan−phenyl−amidine) with alternating and nonalternating AT sequences. Conversion of the central furan of DB75 to other similar groups, such as thiophene or selenophene, can yield compounds with increased affinity and sequence binding selectivity for the minor groove. Calorimetric measurements revealed that the thermodynamic parameters (Δ G, Δ H, Δ S) that drive diamidine binding to alternating and nonalternating oligomers can be quite different and depend on both DNA sequence and length. Small changes in a compound can have major effects on DNA interactions. By choosing an appropriate central group it is possible to “tune” the shape of the molecule to match DNA for enhanced affinity and sequence recognition. [ABSTRACT FROM AUTHOR]

The growth-inhibitory activities of an extensive series of quaternized quino[4,3,2- kl]acridinium salts against tumor cell lines in vitro have been measured and their biological properties interpreted in the light of differential binding to different DNA isoforms. Selectivity for quadruplex DNA binding and stabilization by compounds were explored through an array of methods: UV absorption and fluorescence emission spectroscopy, surface plasmon resonance, and competition dialysis. Quadruplex DNA interaction was further characterized through FRET and DNA polymerase arrest assays. Telomerase inhibition, inferred from the TRAP assay, is attributed to quadruplex stabilization, supported by the strong correlation ( R2= 0.81) across the series between quadruplex DNA binding affinity and TRAP inhibition potency. Growth inhibition potency in the NCI60 human tumor cell line panel is more marked in compounds with greater DNA duplex binding affinity ( R2= 0.82). Quantification of relative quadruplex and duplex binding affinity constants puts some of these ligands among the most selective quadruplex DNA interactive agents reported to date. [ABSTRACT FROM AUTHOR]

A series of 75 guanidine and 2-aminoimidazoline analogue molecules were assayed in vitro against Trypanosoma brucei rhodesienseSTIB900 and Plasmodium falciparumK1. The dicationic diphenyl compounds exhibited the best activities with IC 50values against T. b. rhodesienseand P. falciparumin the nanomolar range. Five compounds ( 7b, 9a, 9b, 10b, and 14b) cured 100% of treated mice upon ip administration at 20 mg/kg in the difficult to cure T. b. rhodesienseSTIB900 mouse model. Overall, the compounds that bear the 2-aminoimidazoline cations benefit from better safety profiles than the guanidine counterparts. The observation of a correlation between DNA binding affinity at AT sites and trypanocidal activity for three series of compounds supported the view of a mechanism of antitrypanosomal action due in part to the formation of a DNA complex. No correlation between antiplasmodial activity and in vitro inhibition of ferriprotoporphyrin IX biomineralisation was observed, suggesting that additional mechanism of action is likely to be involved. [ABSTRACT FROM AUTHOR]

Abstract: Chagas’ disease is an important parasitic illness caused by the flagellated protozoan Trypanosoma cruzi. The disease affects nearly 17 million individuals in endemic areas of Latin America and the current chemotherapy is quite unsatisfactory based on nitroheterocyclic agents (nifurtimox and benznidazol). The need for new compounds with different modes of action is clear. Due to the broad-spectrum antimicrobial activity of the aromatic dicationic compounds, this study focused on the activity of four such diamidines (DB811, DB889, DB786, DB702) and a closely related diguanidine (DB711) against bloodstream trypomastigotes as well as intracellular amastigotes of T. cruzi in vitro. Additional studies were also conducted to access the toxicity of the compounds against mammalian cells in vitro. Our data show that the four diamidines compounds presented early and high anti-parasitic activity (IC50 in low-micromolecular range) exhibiting trypanocidal dose-dependent effects against both trypomastigote and amastigote forms of T. cruzi 2h after drug treatment. Most of the diamidines compounds (except the DB702) exerted high anti-parasitic activity and low toxicity to the mammalian cells. Our results show the activity of reversed diamidines against T. cruzi and suggested that the compounds merit in vivo studies. [Copyright &y& Elsevier]

This study describes infant feeding practices in developing countries, specifically complementary liquids and foods in the first year of life. Data were compiled from Demographic and Health Surveys conducted from 1999 to 2003. We analyzed data from those countries with available data, including results for child-level 24-h and 7-d food and fluid intakes. We used datasets from 20 countries with information on >35,000 infants categorized by age: 0-6 and 6-12 mo. For analysis, we grouped data for fluids other than breast milk as water, other milk (e.g., tinned, powdered, animal), infant formula, and other liquids (e.g., fruit juice, herbal tea, sugar water). All specific solid foods were grouped as any solid foods. We present data on breast-feeding and maternal-reported fluid and solid intake by infants in a 24-h period, for individual countries, and in a pooled analysis. Pooled data show that 96.6% of 0- to 6- and 87.9% of 6- to 12-mo-old infants were currently breast-fed. Reported feeding of other fluids was lower among 0- to 6-mo-olds than 6- to 12-mo-olds: water (45.9 vs. 87.4%), other milk products (11.9 vs. 29.6%), infant formula (9.0 vs. 15.1%), and other liquids (15.1 vs. 41.0%). Pooled analysis showed that 21.9% of mothers reported feeding 0- to 6-mo-old infants some type of solid food, and 80.1% of mothers reported feeding solids to 6- to 12-mo-olds. These survey data show that other milks, other liquids, and solid foods are each much more commonly fed throughout infancy than commercial infant formulas in the countries studied. [ABSTRACT FROM AUTHOR]

Abstract: Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor–surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5′-d(CGAATTCGTCTCCGAATTCG)-3′. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K ∼108 M−1). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K =1.7×108 M−1 (ITC), K =2.4×108 M−1 (DSC), and K =2.9×108 M−1 (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 108 M−1. The ITC technique has the advantage of determining a full set of thermodynamic parameters, including ΔH, TΔS, and ΔC p in addition to ΔG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies. [Copyright &y& Elsevier]

Abstract: Pyrrole (Py) and imidazole (Im) polyamides can be designed to target specific DNA sequences. The effect that the pyrrole and imidazole arrangement, plus DNA sequence, have on sequence specificity and binding affinity has been investigated using DNA melting (A TM), circular dichroism (CD), and surface plasmon resonance (SPR) studies. SPR results obtained from a complete set of triheterocyclic polyamides show a dramatic difference in the affinity of f-lmPylm for its cognate DNA (/4= 1.9 x 1O M1) and f-PyPylm for its cognate DNA (Keq = 5.9 x 10 M1), which could not have been anticipated prior to characterization of these compounds. Moreover, f-lmPylm has a 10-fold greater affinity for CGCG than distamycin A has for its cognate, AATT. To understand this difference, the triamide dimers are divided into two structural groupings: central and terminal pairings. The four possible central pairings show decreasing selectivity and affinity for their respective cognate sequences: -ImPy> -PyPy->> -PyIm--ImIm-. These results extend the language of current design motifs for polyamide sequence recognition to include the use of "words" for recognizing two adjacent base pairs, rather than "letters" for binding to single base pairs. Thus, polyamides designed to target Watson-Crick base pairs should utilize the strength of -ImPy- and -PyPy- central pairings. The f/lm and f/Py terminal groups yielded no advantage for their respective C/G or T/A base pairs. The exception is with the -ImPy- central pairing, for which f/lm has a 10-fold greater affinity for C/G than f/Py has for TIA. [ABSTRACT FROM AUTHOR]

Replicon particles derived from a vaccine strain of Venezuelan equine encephalitis (VEE) virus were used as vectors for expression in vivo of the major envelope proteins (GL and M) of equine arteritis virus (EAV), both individually and in heterodimer form (GL/M). The immunogenicity of the different replicons was evaluated in horses, as was their ability to protectively immunize horses against intranasal and intrauterine challenge with a virulent strain of EAV (EAV KY84). Horses immunized with replicons that express both the GL and M proteins in heterodimer form developed neutralizing antibodies to EAV, shed little or no virus, and developed only mild or inapparent signs of equine viral arteritis (EVA) after challenge with EAV KY84. In contrast, unvaccinated horses and those immunized with replicons expressing individual EAV envelope proteins (M or GL) shed virus for 6–10 days in their nasal secretions and developed severe signs of EVA after challenge. These data confirm that replicons that co-express the GL and M envelope proteins effectively, induce EAV neutralizing antibodies and protective immunity in horses. [Copyright &y& Elsevier]

Investigates the amplification of pepleomycin-mediated DNA cleavage and apoptosis by unfused aromatic cations. Cytotoxicity of HL-60 treated with PEM in the presence of amplifiers; Cellular DNA damagae and internucleosomal DNA fragmentation by PEM in the presence of amplifiers; Enhancing effects.